Construction and application of myxobacteria chassis cells

By constructing myxobacterial chassis cells MxPKS, the challenges of redundant gene cluster competition and genetic manipulation in the synthesis of polyketides by myxobacterial strains were solved, achieving efficient synthesis and genetic background optimization. This method is applicable to the efficient production of various polyketides and the discovery of new drugs.

CN121780583APending Publication Date: 2026-04-03SHANDONG UNIV +1
View PDF 8 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-13
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

Existing myxobacterial strains exhibit redundant gene clusters that compete for carbon, nitrogen, and precursor substances in the synthesis of polyketides, resulting in low yields and difficulties in genetic manipulation. They also lack efficient genetic manipulation and high-expression sites, making it difficult to meet industrialization needs.

Method used

By constructing myxobacterial chassis cells MxPKS, systematically knocking out redundant secondary metabolic gene clusters, introducing a broad-spectrum multidrug efflux pump and a non-carboxylated malonyl-CoA synthesis pathway, inserting the φC31 phage attP site, optimizing the genetic background and metabolic flux, and achieving efficient synthesis.

Benefits of technology

It improves the yield and signal-to-noise ratio of polyketides, enhances cellular tolerance to toxic compounds, simplifies genetic manipulation, and forms a universal biosynthesis platform suitable for the efficient synthesis of various polyketides and the discovery of new drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121780583A_ABST
    Figure CN121780583A_ABST
Patent Text Reader

Abstract

The invention discloses construction and application of myxobacteria chassis cells. Hu04 modified by a model strain myxococcus flavus DK1622 is used as an original strain, and an MxDIRECT technology is adopted to carry out targeted traceless knockout on an imuB gene in the Hu04 strain and core genes of some polyketone compound biosynthetic gene clusters. Meanwhile, a broad-spectrum multi-drug efflux pump and a non-carboxylation malonyl-coenzyme A synthesis route are introduced into the strain, and a phiC31 integrase recognition site attP is inserted into a genome high expression site. Compared with a wild strain DK1622, the chassis cell has the characteristics of motion gene deletion, exopolysaccharide reduction, hereditary stability improvement and the like, the fermentation process is remarkably optimized, the strain enters the logarithmic phase earlier, the plateau phase is prolonged, the synthesis efficiency of a target product is improved, the metabolism background is simple, precursor supply is sufficient, gene manipulation is facilitated, and the application prospect is broad. The method has efficient and universal application potential in synthesis of polyketone compounds.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial genetic engineering and drug synthesis technology, specifically relating to a method for constructing myxobacterial polyketide chassis cells MxPKS and its application in the synthesis of polyketide compounds. Background Technology

[0002] Polyketides are an important class of secondary metabolites with broad-spectrum biological activity. They have irreplaceable medicinal value in fields such as antibacterial, antitumor, and immunosuppression, such as erythromycin, avermectin, and statins. Their microbial synthesis technology has always been one of the core directions of drug research and development and industrialization.

[0003] Myxobacteria, a class of Gram-negative bacteria capable of synthesizing abundant secondary metabolites, especially strains of the genus *Myxococcus*, have become important research subjects in the field of microbial synthesis of polyketide drugs due to their natural potential for synthesizing various polyketide compounds. However, natural myxobacterial strains face significant limitations in practical applications: on the one hand, their genomes often contain multiple redundant gene clusters related to polyketide synthesis (such as Carotenoid, Myxochromide, and Myxovirescin). These redundant gene clusters compete with the target product for carbon sources, nitrogen sources, and key precursor substances (such as malonyl-CoA), resulting in low yields of the target product. Furthermore, the complex metabolic background can interfere with the subsequent isolation and identification of the target compound. On the other hand, natural strains are difficult to genetically manipulate, lack genetic stability, and have weak tolerance to synthesized products. They also lack precisely regulated high-expression insertion sites, making it difficult to meet the industrialization requirements for efficient synthesis of target polyketide compounds. Although DK1622 is often used as the preferred chassis for heterologous expression as a model strain, it is not a fully optimized, metabolically simplified dedicated "chassis cell," and most studies are still conducted in wild-type or single mutant backgrounds. Therefore, there is a severe lack in the field of myxobacterial chassis cells that are universal, have a clean background, are easily genetically manipulated, and are specifically designed for the expression of polyketide compounds.

[0004] To address these challenges, constructing myxobacterial chassis cells with clear genetic backgrounds, controllable metabolic flux, and high synthetic efficiency is crucial. Currently, the construction of microbial chassis cells largely relies on single gene editing technologies. Dedicated and efficient gene editing systems and chassis modification strategies specifically for myxobacteria are still relatively scarce. In particular, there is a lack of systematic and traceless knockout of redundant gene clusters in *Myxococcus faecalis* strains, as well as multi-dimensional synergistic modification solutions such as the introduction of efflux pump systems and optimization of high-expression sites. This severely restricts the application of myxobacteria in the efficient synthesis of polyketide drugs.

[0005] To address the aforementioned issues, this study aims to construct the first universal myxobacterial chassis cell, MxPKS, specifically for the heterologous biosynthesis of polyketides, using Myxococcus faecalis HU04 as the starting strain through systematic engineering modification. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to provide a universal myxobacterial chassis cell with a simplified genetic background, optimized metabolic engineering, and ease of genetic manipulation. This addresses the technical bottlenecks encountered by existing microbial hosts when heterologously expressing polyketide synthase (PKS) gene clusters, such as complex metabolic backgrounds, insufficient precursor supply, poor tolerance to exogenous compounds, and difficulties in genetic manipulation. This chassis cell is suitable for the efficient biosynthesis, discovery, and production of various polyketide compounds.

[0007] To achieve the objectives of this invention, the technical solution is as follows:

[0008] In a first aspect, the present invention provides a method for constructing myxobacterial chassis cells MxPKS, using Hu04, a modified strain of the model strain Myxococcus faecalis DK1622, as the starting strain, and constructing the cells by modifying their genome as follows:

[0009] (1) Knock out key biosynthetic genes in the endogenous redundant secondary metabolic gene cluster;

[0010] (2) Introduce a broad-spectrum multidrug efflux pump;

[0011] (3) Introduce the non-carboxylated malonyl-CoA synthesis pathway;

[0012] (4) Insert φC31 phage into the high expression site identified in the genome. attP Site.

[0013] Preferably, in step (1), the core genes of the following redundant secondary metabolic gene clusters in the genome of the starting strain Hu04 are knocked out without scarring using the MxRedET-ISDra2 (MxDIRECT technology) combined with gene editing system previously developed in the laboratory, in order to eliminate the interference of endogenous metabolites: i muB Genes involved in DNA repair and related to genetic instability, the core genes of the Myxochromide synthesis gene cluster, the core genes of the Myxovirescin synthesis gene cluster, the core genes of the Myxalamid synthesis gene cluster, the core genes of the Myxochelin synthesis gene cluster, and the core genes of the Alkylpyrone synthesis gene cluster.

[0014] Preferably, in step (2), in order to enhance the tolerance of chassis cells to exogenous and over-synthesized compounds, a broad-spectrum multidrug efflux pump is introduced. The broad-spectrum multidrug efflux pump includes MFS family transport proteins (such as EmrB and QacA) and an RND-type triple efflux system. The key modules of the RND-type triple efflux system include inner membrane transport proteins (such as AcrB / AcrD / AcrF), outer membrane channel proteins, and membrane fusion proteins (MFP).

[0015] Preferably, the nucleotide sequence of the MFS family transporter is shown in SEQ ID NO.7 (gene A);

[0016] Preferably, the nucleotide sequence of the outer membrane channel protein is as shown in SEQ ID NO.8 (gene B);

[0017] Preferably, the nucleotide sequence of the membrane fusion protein is as shown in SEQ ID NO.9 (gene C);

[0018] Preferably, the nucleotide sequence of the inner membrane transporter is as shown in SEQ ID NO.10 (gene D).

[0019] Preferably, in step (3), to enhance the precursor supply of malonyl-CoA, a non-carboxylated malonyl-CoA synthesis pathway (NCM pathway) is introduced. The NCM pathway consists of two enzyme modules: 3-hydroxypropionic acid-CoA ligase (BauA) and engineered enoyl-CoA hydratase (MCR-C). This non-carboxylated malonyl-CoA synthesis pathway contains only two enzymatic reactions: first, 3-hydroxypropionic acid-CoA ligase (BauA) catalyzes the condensation of 3-hydroxypropionic acid with CoA to generate 3-hydroxypropionyl-CoA, and then engineered enoyl-CoA hydratase (MCR-C) dehydrates and directly generates malonyl-CoA.

[0020] Preferably, all enzymes in the NCM pathway have undergone codon optimization. The nucleotide sequence of the optimized 3-hydroxypropionic acid-CoA ligase is shown in SEQ ID NO.11, and the nucleotide sequence of the optimized engineered enoyl-CoA hydratase is shown in SEQ ID NO.12.

[0021] Preferably, in step (4), to facilitate the stable integration and high expression of the exogenous PKS gene cluster, φC31 phage is inserted at the high expression site identified by the genome. attP This site is used to achieve efficient, single-copy, and stable integration of exogenous gene clusters through site-specific recombination.

[0022] Preferably, the chassis cells are constructed using MxRedET-ISDra2 combined with gene editing technology for genome modification.

[0023] On the other hand, the present invention also provides a myxobacterial chassis cell MxPKS constructed according to the above construction method.

[0024] On the other hand, the present invention also provides the application of myxobacterial chassis cells MxPKS in the synthesis of polyketide compounds.

[0025] On the other hand, the present invention also provides a method for producing polyketide compounds, wherein chassis cells MxPKS are cultured under suitable expression conditions to obtain a culture containing polyketide compounds; and the polyketide compounds are isolated from the culture.

[0026] Preferably, the chassis cells MxPKS contain exogenous polyketide synthesis gene clusters.

[0027] Preferably, the polyketide compound synthesis gene cluster includes known gene clusters (such as bgc34) and unknown novel gene clusters.

[0028] The chassis cells MxPKS obtained by this invention can be applied to:

[0029] (1) Heterologous expression of unknown novel gene clusters or known polyketide synthase (PKS) gene clusters derived from actinomycetes, myxobacteria or other microorganisms for the discovery of new bioactive polyketide compounds.

[0030] (2) Efficient production of known polyketide antibiotics, antitumor drugs, immunosuppressants, etc. with medicinal value.

[0031] (3) As a general synthetic biology platform, it is used to create novel non-natural polyketide derivatives by modular assembly and rational design of PKS gene clusters.

[0032] Compared with existing technologies, the genetically engineered myxobacterial chassis cells and their construction method provided by this invention have significant beneficial effects: by systematically knocking out seven major redundant secondary metabolic gene clusters, interference from endogenous secondary metabolites is eliminated, significantly improving the signal-to-noise ratio for detecting target products, and aiding in the functional analysis of "hidden" biosynthetic gene clusters and the discovery of new drugs; knocking out imuB Gene and introduced φC31 attPThis platform integrates various technologies to enhance cell transformation efficiency and recombination probability, ensuring efficient and stable integration of large exogenous DNA fragments and supporting heterologous expression of massive gene clusters. The chassis cells possess advantages in growth and precursor supply, shortening fermentation cycles, extending product accumulation time, and increasing the concentration of core raw materials for polyketide synthesis to boost target product yield. A broad-spectrum efflux pump system is introduced to enhance cell tolerance to toxic compounds, broadening its application scenarios. Integrating all these advantages, a "plug-and-play" universal biosynthesis platform is constructed, allowing users to quickly initiate the synthesis of different compounds, saving R&D costs and time. At the research level, this platform serves as a tool for uncovering the "dark matter" of microbial genomes and discovering new natural products. At the industrial level, it provides a platform for the efficient manufacturing of polyketide drugs, potentially breaking through capacity and price bottlenecks. In summary, its core lies in precisely addressing the four major pain points of natural microorganisms as cell factories: "background noise," "operational difficulty," "low yield," and "intolerance," transforming them into four major advantages to form a "super chassis" serving new drug discovery and green manufacturing. Attached Figure Description

[0033] Figure 1 This study aimed to validate the construction strategy and gene cluster knockout of chassis cell MxPKS. Figure 1 (a) is a flowchart for constructing chassis cells MxPKS. Figure 1 (b) A gel image of the gene clusters knocked out during the construction of chassis cells MxPKS.

[0034] Figure 2 This is a schematic diagram of the RND system plasmid. Gene A: MFS family transporter. Gene B: Outer membrane channel protein of the RND efflux system. Gene C: Membrane fusion protein of the RND efflux system. Gene D: Inner membrane transporter of the RND efflux system.

[0035] Figure 3 This is a sequencing diagram of the RND system.

[0036] Figure 4 This is a sequencing diagram of the NCM system.

[0037] Figure 5 This is a systematic comparison of wild-type DK1622 and chassis MxPKS at the levels of liquid culture, electroporation recovery, and cell morphology. Figure 5 (a) Comparison of wild-type DK1622 and chassis MxPKS in liquid culture. Figure 5 (b) is a comparison of the morphology of single colonies after electroporation of wild-type DK1622 and chassis MxPKS. Figure 5 (c) is a comparison of electron micrographs of wild-type DK1622 and chassis MxPKS.

[0038] Figure 6This study compares the growth kinetics and morphological parameters of wild-type DK1622 and chassis MxPKS. Figure 6 (a) Comparison of growth curves for wild-type DK1622 and chassis MxPKS. Figure 6 (b) Comparison of cell diameters between wild-type DK1622 and chassis MxPKS.

[0039] Figure 7 This involves the analysis of heterologously expressed gene clusters and their products. Figure 7 (a) is a schematic diagram of the arrangement of the four gene clusters expressed heterologously. Figure 7 (b) is a liquid phase diagram of wild-type DK1622 and chassis MxPKS, and a liquid phase diagram of gene cluster expression. Figure 7 (c) shows the structure of the compound obtained by heterologous expression. Detailed Implementation

[0040] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0041] Unless otherwise specified, the experimental methods in the following examples are conventional experimental methods, and the experimental reagents and consumables mentioned in the following examples are all from conventional biochemical reagent companies.

[0042] The primers were synthesized by Shanghai Sangon Biotech Co., Ltd., the restriction endonuclease was from TakaRa Biotechnology (Beijing) Co., Ltd., the DNA polymerase was from Vazyme, and the antibiotic was Aladdin. The *E. coli* DH5α involved in the invention was purchased from Qingke Biotechnology. The *Myxococcus xanthus* Hu04 involved in this invention was from our research group; the construction method of strain Hu04 can be found in the literature "An upgraded *Myxococcus xanthus* chassis with enhanced growth characteristics for efficient genetic manipulation". Hu04 was modified from the model strain *Myxococcus xanthus* DK1622 in the following ways: 1) the multicellular behavior-related genes aglZ, pilA, and difA were deleted; 2) the two gene clusters BGC1 and BGC17, responsible for the synthesis of carotenoids and DKxanthene, were deleted; and 3) the programmed cell death-related gene mazF was deleted.

[0043] The process for constructing chassis cells MxPKS according to this invention is described below. Figure 1 (a).

[0044] In the process of constructing chassis cells, the genome was modified using the MxRedET-ISDra2 (MxDIRECT technology) combined with the gene editing system previously developed in the laboratory.

[0045] The MxRedET-ISDra2 combined gene editing system includes the cutting plasmid pZJY4111-ISDra2 and the RedET recombination system expression plasmid pSWU19-rrnd5 MYqaJ-MRecT-Km; the nucleotide sequence of the cutting plasmid pZJY4111-ISDra2 is shown in SEQ ID NO.3; the nucleotide sequence of the RedET recombination system expression plasmid pSWU19-rrnd5 MYqaJ-MRecT-Km is shown in SEQ ID NO.6.

[0046] The main vector backbone of the cleavage plasmid is the myxobacterial autonomous replication plasmid pZJY4111, which contains a high copy number replication initiation site, an apramycin resistance gene, a vanillic acid inducible promoter, and a TnpB cleavage system induced by this promoter; the main vector backbone of the RedET recombination system expression plasmid is the myxobacterial integration plasmid pSWU19, which contains a high copy number replication initiation site, a kanamycin resistance gene, and a phage integration site. attP The promoter rrnd5 and the homologous recombinase system MYqaJ-MRecT expressed under the control of this promoter.

[0047] The TnpB cleavage system comprises a TnpB encoding gene and a guide RNA; the guide RNA is a reRNA, and its 3' end contains a 20 bp guide sequence, which is complementary to the gene to be knocked out and guides the TnpB nuclease to cleave the target site.

[0048] The nucleotide sequence of the TnpB encoding gene is shown in SEQ ID NO.1; the nucleotide sequence of the guide RNA is shown in SEQ ID NO.2.

[0049] The homologous recombinase system MYqaJ-MRecT comprises two genes, MYqaJ and MRecT; the nucleotide sequence of the MYqaJ gene is shown in SEQ ID NO.4; and the nucleotide sequence of the MRecT gene is shown in SEQ ID NO.5.

[0050] The RedET recombination system expression plasmid on attP The site can recognize sites on the myxobacterial genome. attB The site was used to integrate the recombinase system MYqaJ-MRecT into the myxobacterial genome.

[0051] The steps for gene editing using the MxRedET-ISDra2 technology include:

[0052] (1) Construction of ISDra2 targeted cleavage plasmid:

[0053] The main vector backbone of this cleavage plasmid is the myxobacterial autonomous replication plasmid pZJY4111, which contains a high-copy replication initiation site, an apramycin resistance gene, a vanillic acid-inducible promoter, and a vanillic acid-induced TnpB cleavage system. This targeting cleavage system contains the TnpB (IsDra2) encoding gene, a reRNA backbone region, and a 20 bp guide sequence (i.e., the reRNA guide region) targeting the gene to be knocked out. The reRNA backbone region is 231 bp in length and is tandemly linked with IsDra2, with the sequence: 5'-GATTCAAGAATCCCGAAGTGAAGAATCTTGCCGTCCGTACATGGACTTGCCCGAACTGTGGGGAAACCCATGACCGAGACGAGAACGCTGCGCTGAACATTCGGCGTGAAGCGTTGGTGGCTGCGGGAATCTCAGACACCTTAAACGCTCATGGAGGCTATGTCAGACCTGCTTCGGCGGGCAATGGTCTGCGAAGTGAGAATCACGCGACTTTAGTCGTGTGAGGTTCAA-3'. A 20 bp guide sequence is attached to the 3' end of the reRNA backbone region. During each construction, only this 20 bp guide sequence needs to be changed on the cutting plasmid.

[0054] (2) Construction of seamless repair fragments:

[0055] Select 100-1000 bp sequences from both ends of the gene to be knocked out as left and right homologous arms. Connect the left and right homologous arms into a 200-2000 bp repair fragment by overlapping extension PCR. Use this repair fragment as a template and perform PCR using phosphorylation modification primers so that the 5' end of the repair fragment is modified by phosphorylation and thiophosphorylation, respectively.

[0056] (3) Preparation and electroporation of competent myxobacterial cells:

[0057] Remove the *Myxococcus faecalis* DK1622-MxRedET containing MYqaJ-MRecT (or MxRedET) from the -80℃ freezer, and add 100 μL to CTT (kana) liquid medium. Incubate at 30℃ with shaking at 200 rpm for strain activation. After 24 h, transfer the activated strain to fresh CTT (kana) liquid medium and incubate at 30℃ with shaking for 20-24 h. OD 600 Approximately 0.8-1.2. Take 1 OD. 600 The bacterial count, such as: measuring OD 600 If the result is 1, then 1 mL of bacterial culture should be used to prepare competent cells. Centrifuge the bacterial culture at 4°C and 8000 rpm, and discard the supernatant. Add 1 mL of pre-chilled ddH2O to wash the bacterial cells, centrifuge at 4°C and 8000 rpm, discard the supernatant, and repeat the washing process 3 times. Resuspend the washed bacterial cells in 100-200 μL of ddH2O, mix 400-800 ng of the cutting plasmid and 600-3600 ng of the repair fragment, add the mixture to the prepared competent cells, mix well, and transfer to a pre-chilled 2 mm electroporation cuvette for electroporation. Set the parameters of the Bio-Rad electroporator to 1250 V, 25 μF, 400 Ω, and 2 mm. After electroporation, wash the bacterial culture with 2 mL of antibiotic-free CTT liquid medium and revive in a 15 mL centrifuge tube. Revive at 30°C and 200 rpm for 4-6 h. After resuscitation, gradient plating was performed on CTT (kana + apra + vanillic acid) medium, with doses of 50 μL, 100 μL, 200 μL, and 500 μL respectively. After plating, the plates were incubated upside down in a 30°C incubator for 5-7 days, and single colonies were picked for verification.

[0058] (4) Detection of recombinants:

[0059] Single colonies were picked and grown in fresh CTT (kana+apra+vanillic acid) solid medium. After 2-3 days of growth, a suitable amount of bacterial cells was scraped and added to 20 μL ddH2O until obvious turbidity was observed. The medium was then boiled in a metal bath at 100℃ for 5 min, followed by an ice bath for 5 min, and repeated three times. The prepared template was centrifuged at 12000 rpm for 5 min, and the supernatant was used for PCR detection. Primers for PCR detection were designed 50 bp outside the homologous arms. If knockout failed, the PCR fragment would be the original genome fragment. If the scarless editing was successful, the PCR fragment would be smaller; the size of the smaller fragment needs to be analyzed based on the specific knockout situation.

[0060] (5) Relaxing the plasmid removes the cutting plasmid from the mutant strain, facilitating the next round of gene knockout:

[0061] The mutant strain carrying the cleavage plasmid was transferred into fresh CTT (kana) liquid medium and cultured with shaking at 30°C for 20-24 h. 1 OD was then collected. 600 The bacterial count was taken as 5×10 8 Take 100 μL and mix it into 900 μL of ddH2O to prepare a 5×10⁻⁶ solution. 7 And so on, until diluted to 5×10. 1 Take 5 × 10 2 and 5×10 3 100 μL of CTT was plated under gradient conditions, and single colonies were picked for verification after 5-7 days. Multiple primer pairs were designed on the cleavage system plasmid for PCR verification. If the corresponding band could not be obtained by PCR and the obtained single colonies could not grow in CTT (apra), the system removal was successful.

[0062] Example 1: Knockout of related genes using MxRedET-ISDra2 combined with gene editing technology

[0063] Taking the knockout of the Myxochelin biosynthetic gene cluster as an example (the primer sequences involved in the examples are shown in Table 1).

[0064] The strain Hu04-MxRedET, which previously contained the MYqaJ-MRecT recombinase system (obtained by introducing the pSWU19-rrnd5 MYqaJ-MRecT-Km plasmid into strain HU04), was used in the laboratory for a one-step, traceless knockout of the core genes of the Myxochelin biosynthesis gene cluster. The knockout fragment was located at 4280160…4300335, disrupting three core genes of this gene cluster, corresponding to the numbers MXAN_RS17625, MXAN_RS17630, and MXAN_RS36330, with a knockout length of 20176 bp.

[0065] (1) Construct a cleavage plasmid for targeted cleavage of the core gene MXAN_RS17630.

[0066] The TAM site TTGAT was searched within the MXAN_RS17630 gene. There are eight TTGAT sites in this gene. One suitable TAM was selected, and a 20 bp segment was selected from its 3' end as the guide sequence for targeted cleavage: 5'-GCTCCACACCTTCCTCGGCC-3'. This 20 bp guide sequence was added to the 3' end of the reRNA, thus constructing the cleavage plasmid targeting the MXAN_RS17630 gene. This describes the construction process of the cleavage plasmid map. Using a previously constructed cleavage plasmid (with pZJY4111 as the backbone) as a template, PCR was performed using RS17630-f and RS17630-r primers. The obtained fragments were recovered from the gel and assembled using Gbison to obtain the targeted cleavage plasmid pZJY4111-RS17630.

[0067] (2) Preparation of donor DNA fragments

[0068] 1000 bp segments were selected at each end of the gene sequence to be knocked out (4280160…4300335) as upstream and downstream homologous arms for repair. The upstream and downstream homologous arms were then subjected to overlap extension PCR to obtain the complete donor DNA fragment. The primers for obtaining the upstream homologous arm fragment were up-f and up-r, with the genome of strain HU04-MyxoRed / ET as the template. The primers for obtaining the downstream homologous arm fragment were dw-f and dw-r, with the genome of strain HU04-MyxoRed / ET as the template. The primers for overlap extension PCR were up-f and dw-r, with the up and dw primers obtained above as the template. After obtaining the complete donor fragment, specific phosphorylation modification primers were used to phosphorylate and thiophosphorylate the 5' end of the repair fragment, respectively: up-f(s) and dw-r(p).

[0069] (3) Using the cutting plasmids and repair fragments constructed in (1) and (2), the core gene of Myxochelin was knocked out in one step without any visible scarring.

[0070] Remove the strain Hu04-MxRedET, which needs to be edited, from the -80℃ freezer. Add 100 μL to CTT (kana) liquid medium and incubate at 30℃ with shaking at 200 rpm. This step is for strain activation. After 24 h, transfer the activated strain to fresh CTT (kana) liquid medium and incubate at 30℃ with shaking for 20-24 h. OD 600 Approximately 0.8-1.2. Take 1 OD. 600 The bacterial count, such as: measuring OD 600If the result is 1, then 1 mL of bacterial culture should be used to prepare competent cells. Centrifuge the bacterial culture at 4°C and 8000 rpm, and discard the supernatant. Add 1 mL of pre-chilled ddH2O to wash the bacterial cells, centrifuge at 4°C and 8000 rpm, discard the supernatant, and repeat the washing process 3 times. Resuspend the washed bacterial cells in 100-200 μL of ddH2O, mix 400 ng of the cleavage plasmid and 1800 ng of the donor fragment, and add them together to the competent cells. Transfer the mixture to a pre-chilled 2 mm electroporation cuvette for electroporation. Set the parameters of the Bio-Rad electroporator to 1250 V, 25 μF, 400 Ω, and 2 mm. After electroporation, wash the bacterial culture with 2 mL of antibiotic-free CTT liquid medium and thaw in a 15 mL centrifuge tube for 4-6 h. After resuscitation, 50 μL, 100 μL, 200 μL, and 500 μL of culture medium were incubated on CTT solid medium containing apramycin and vanillic acid for 5-7 days. Single colonies were then picked for verification. Each single colony was placed in fresh CTT (apra + vanillic acid) solid medium and allowed to grow for 2-3 days. A suitable amount of bacterial cells was scraped and added to 20 μL ddH2O until significant turbidity was observed. The mixture was then boiled in a metal bath at 100°C for 5 min, followed by an ice bath for 5 min, repeated three times. The prepared template was centrifuged at 12000 rpm for 5 min, and the supernatant was used for PCR detection. Forward and reverse primers were designed within 50 bp of the homologous arms for PCR; the primers were named check-f and check-r.

[0071] (4) Relaxing the plating removes the cutting plasmids from the mutant strains, facilitating the next round of gene editing.

[0072] The successfully knocked-out mutant strains from (3) were transferred into new CTT (kana) liquid medium and cultured with shaking at 30°C for 20-24 h. 1 OD was then collected. 600 The bacterial count was taken as 5×10 8 Take 100 μL and mix it into 900 μL of ddH2O to prepare a 5×10⁻⁶ solution. 7 And so on, until diluted to 5×10. 1 Take 5 × 10 2 and 5×10 3 100 μL of CTT (kana) was plated under gradient conditions. After 5-7 days, single colonies were picked for verification. Multiple primer pairs were designed for PCR verification on the cut plasmid. If the corresponding band could not be obtained by PCR and the obtained single colonies could not grow in CTT (apra), the system removal was successful. The primers used for this verification were Dra2check-f and Dra2check-r.

[0073] The above describes the entire process of scarless knockout of redundant gene clusters in the chassis using MxRedET-ISDra2 (MxDIRECT technology) combined with gene editing technology. Using this method, we sequentially knocked out the redundant gene clusters in strain Hu04. imuB The knockout genes, as well as the core genes of redundant gene clusters related to polyketide synthesis such as Myxochromide, Myxovirescin, Myxalamid, Myxochelin, and Alkylpyrone, are shown in Table 2.

[0074] like Figure 1 As shown in (b), the PCR bands of each gene cluster knockout mutant strain were reduced to 500-1000 bp compared to the wild type, which is consistent with the expected size of the deleted fragment, suggesting that the target region has been deleted.

[0075] Compared to the wild-type strain DK1622, we constructed strain KO12 by knocking out the aglZ, pilA, difA, mazF, and imuB genes and the BGC1, BGC17, BGC15, BGC13, BGC19, BGC10, and BGC24 gene clusters.

[0076] Example 2: Introduction of a broad-spectrum multidrug efflux pump

[0077] We obtained a relevant myxobacterial endogenous efflux pump gene in strain Vitiosangium sp. SDU295 through antismash prediction analysis, and obtained the gene fragment by PCR. The broad-spectrum multidrug efflux pump comprises MFS family transporters (such as EmrB and QacA) and an RND-type triple efflux system. The key modules of the RND-type triple efflux system include intima-membrane transporters (such as AcrB / AcrD / AcrF), outer membrane channel proteins, and membrane fusion proteins (MFPs). The nucleotide sequences of the MFS family transporters are shown in SEQ ID NO.7 (gene A); the outer membrane channel protein is shown in SEQ ID NO.8 (gene B); the membrane fusion protein is shown in SEQ ID NO.9 (gene C); and the intima-membrane transporter is shown in SEQ ID NO.10 (gene D). The gene fragments (geneA-geneD) were then ligated to the pBJ113 vector backbone via Gibson assembly (Source: T Ueki, S Inouye, M Inouye. Positive-negative KG cassettes for construction of multi-gene deletions using a singledrug marker. Gene 183 (1996) 153-157). This vector backbone contains homologous arms near high-expression sites, allowing for precise insertion near these sites via homologous recombination. A schematic diagram of the plasmid is shown below. Figure 2 As shown.

[0078] The assembled RND system was sequenced, and the sequencing chromatogram is shown below. Figure 3 As shown.

[0079] The RND system with accurate sequencing was electroporated into strain KO12 to obtain strain IS13.

[0080] The electroporation procedure is as follows: Remove the strain to be electroporated from the -80℃ freezer, add 100 μL to CTT (kana) liquid medium, and incubate at 30℃ with shaking at 200 rpm. This step is for strain activation. After 24 h, transfer the activated strain to fresh CTT (kana) liquid medium and incubate at 30℃ with shaking for 20-24 h. OD 600 Approximately 0.8-1.2. Take 1 OD. 600 The bacterial count, such as: measuring OD 600If the result is 1, then 1 mL of bacterial culture should be taken for the preparation of competent cells. Centrifuge the bacterial culture at 4°C and 8000 rpm, and discard the supernatant. Add 1 mL of ddH2O pre-chilled on ice to wash the bacterial cells, centrifuge at 4°C and 8000 rpm, discard the supernatant, and repeat the washing three times. Resuspend the washed bacterial cells in 100-200 μL of ddH2O, add the prepared RND system-related plasmid, and transfer to a pre-chilled 2 mm electroporation cuvette for electroporation. Set the parameters of the Bio-Rad electroporator to 1250 V, 25 μF, 400 Ω, and 2 mm. After electroporation, wash the bacterial culture with 2 mL of antibiotic-free CTT liquid medium and revive in a 15 mL centrifuge tube for 4-6 h. After revival, take 50 μL, 100 μL, 200 μL, and 500 μL respectively and incubate on CTT solid medium containing apramycin for 5-7 days, then pick single colonies for verification. Single colonies were picked and grown in fresh CTT (apra) solid medium. After 2-3 days of growth, an appropriate amount of bacterial cells was scraped and added to 20 μL ddH2O until obvious turbidity was observed. The mixture was then boiled in a metal bath at 100℃ for 5 min, followed by an ice bath for 5 min, and repeated three times. The prepared template was centrifuged at 12000 rpm for 5 min, and the supernatant was used for PCR detection. Forward and reverse primers were designed within 50 bp of the homologous arms for PCR. The validation primers used were RND-check-f and RND-check-r, and the primer sequences are shown in Table 1.

[0081] Example 3: Introduction of a malonyl-CoA precursor supply system (NCM)

[0082] We will codon-optimize the NCM pathway (synthesized by the company) published in Nature Catalysis (reference: Jian Li, Xin Mu, Wenyue Dong, et al. A non-carboxylative route for the efficient synthesis of central metabolite malonyl-CoA and its derived products. Nature Catalysis volume 7, pages 361–374 (2024)) and activate the pathway using either a strong promoter (J23104) or a moderately strong promoter (rrnd5). The pathway comprises: 1) BauA (3-hydroxypropionic acid-CoA ligase): responsible for “activation,” linking the substrate 3-hydroxypropionic acid to coenzyme A, preparing it for the next reaction. 2) MCR-C (engineered enoyl-CoA hydratase): responsible for “conversion,” directly generating the target product malonyl-CoA through a sophisticated dehydration reaction. The nucleotide sequence of BauA after codon optimization is shown in SEQ ID NO.11; the nucleotide sequence of MCR-C after codon optimization is shown in SEQ ID NO.12.

[0083] Before electroporating strain IS13, we sequenced three locations in this system, and the sequencing results are as follows: Figure 4 As shown.

[0084] Following the same principle and electroporation steps, the NCM pathway with correct sequencing was electroporated into strain IS13 to obtain strain IS14. The validation primers used were NCM-check-f and NCM-check-r, and the primer sequences are shown in Table 1.

[0085] Example 4: Insertion of φC31 phage attP site into a highly expressed site identified by genome sequencing

[0086] Using MxRedET-ISDra2 (MxDIRECT technology) attP The insertion site was inserted into a highly expressed position in strain IS14 for subsequent stable insertion and efficient heterologous expression of gene clusters, resulting in strain IS15.

[0087] (1) Constructing a cleavage plasmid for targeted cleavage of highly expressed regions

[0088] The selected high-expression site is located at 8698057 on the genome of *Hypertropha flavomarginata* Hu04. A TAM site, TTGAT, was searched near this location. A suitable TAM was selected, and a 20 bp segment was further selected from its 3' end as the guide sequence for targeted cleavage: 5'-GACGAAGCCGTGCTCGCCCC-3'. This 20 bp guide sequence was added to the 3' end of the reRNA, thus constructing the cleavage plasmid targeting the high-expression site. This describes the construction process of the cleavage plasmid map. Using a previously constructed cleavage plasmid (with pZJY4111 as its backbone) as a template, [the following steps were performed]. attP -f and attP -r was used as upstream and downstream primers for PCR. The obtained fragments were recovered from the gel and assembled using Gbison to obtain the targeted cleavage plasmid pZJY4111-. attP .

[0089] (2) Preparation of donor DNA fragments

[0090] Appropriate 1000 bp segments were selected at each end of the cleavage site as upstream and downstream homologous arms for repair. The upstream and downstream homologous arms were then subjected to overlap extension PCR to obtain the complete donor DNA fragment. The primers for obtaining the upstream homologous arm fragment were: attP -up-f and attP -up-r, the template is the genome of strain HU04-MyxoRed / ET; where attP -up-r is a long primer with a 50 bp length. attP Sequence: CAACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGGCGTAGGCCAGCATG. Primers for obtaining the downstream homologous arm fragment are: attP -dw-f and attP -dw-r, the template is the genome of strain HU04-MyxoRed / ET; the primers for overlap extension PCR are... attP -up-f and attP -dw-r, the template is the up and dw obtained above. After obtaining the complete donor fragment, the 5' end of the repair fragment is phosphorylated and thiophosphorylated using specific phosphorylation modification primers. The modification primers are: attP -up-f(s) and attP -dw-r(p).

[0091] (3) Using the cleavage plasmids and repair fragments constructed in (1) and (2), a one-step, seamless insertion of attP sequences at high expression sites is achieved.

[0092] Remove the IS14 strain to be edited from the -80℃ freezer, add 100 μL to CTT (kana) liquid medium, and incubate at 30℃ with shaking at 200 rpm. This step is for strain activation. After 24 h, transfer the activated strain to fresh CTT (kana) liquid medium and incubate at 30℃ with shaking for 20-24 h. OD 600 Approximately 0.8-1.2. Take 1 OD. 600 The bacterial count, such as: measuring OD 600 If the result is 1, then 1 mL of bacterial culture should be used to prepare competent cells. Centrifuge the bacterial culture at 4°C and 8000 rpm, and discard the supernatant. Add 1 mL of pre-chilled ddH2O to wash the bacterial cells, centrifuge at 4°C and 8000 rpm, discard the supernatant, and repeat the washing process 3 times. Resuspend the washed bacterial cells in 100-200 μL of ddH2O, mix 400 ng of the cleavage plasmid and 1800 ng of the donor fragment, and add them together to the competent cells. Transfer the mixture to a pre-chilled 2 mm electroporation cuvette for electroporation. Set the parameters of the Bio-Rad electroporator to 1250 V, 25 μF, 400 Ω, and 2 mm. After electroporation, wash the bacterial culture with 2 mL of antibiotic-free CTT liquid medium and thaw in a 15 mL centrifuge tube for 4-6 h. After resuscitation, 50 μL, 100 μL, 200 μL, and 500 μL of culture medium were incubated on CTT solid medium containing apramycin and vanillic acid for 5-7 days. Single colonies were then picked for verification. Single colonies were picked and placed in fresh CTT (apra + vanillic acid) solid medium. After 2-3 days of growth, a suitable amount of bacterial cells was scraped and added to 20 μL ddH2O until significant turbidity was observed. The medium was then boiled in a metal bath at 100°C for 5 min, followed by an ice bath for 5 min, repeated three times. The prepared template was centrifuged at 12000 rpm for 5 min, and the supernatant was used for PCR detection. Forward and reverse primers were designed 50 bp before and after the homologous arms for PCR. The primer names are... attP -check-f and attP -check-r.

[0093] (4) Relaxing the plating removes the cutting plasmids from the mutant strains, facilitating the next round of gene editing.

[0094] The successfully knocked-out mutant strains from (3) were transferred into new CTT (kana) liquid medium and cultured with shaking at 30°C for 20-24 h. 1 OD was then collected. 600 The bacterial count was taken as 5×10 8 Take 100 μL and mix it into 900 μL of ddH2O to prepare a 5×10⁻⁶ solution. 7 And so on, until diluted to 5×10. 1 Take 5 × 10 2 and 5×103 100 μL of CTT (kana) was plated under gradient conditions. After 5-7 days, single colonies were picked for verification. Multiple primer pairs were designed for PCR verification on the cut plasmid. If the corresponding band could not be obtained by PCR and the obtained single colonies could not grow in CTT (apra), the system removal was successful. The primers used for this verification were Dra2check-f and Dra2check-r.

[0095] Example 5: Comparison of growth curves of constructed chassis MxPKS and wild-type strain DK1622

[0096] (1) Preparation of culture medium

[0097] CTT liquid medium (1 L): 10 g casein peptone, 1.97 g MgSO4·7H2O, 10 mL Tris-HCl buffer, 10 mL PBS buffer, bring the volume to 1 L with distilled water, adjust the pH to 7.6, and autoclave at 121℃ for 20 min.

[0098] (2) Prepare yeast culture for MxPKS and the original strain DK1622

[0099] Remove the stored MxPKS and DK1622 from the -80℃ freezer, and transfer 100 μL to CTT liquid medium. Incubate at 30℃ with shaking at 200 rpm for strain activation. After 24 h, transfer the activated strain to a fresh 100 mL CTT liquid medium and incubate at 30℃ with shaking for 20–24 h to obtain seed cultures of MxPKS and DK1622.

[0100] (3) Determine the growth curve

[0101] Take 1 mL of seed culture MxPKS and DK1622 respectively, and measure the OD of the bacterial culture. 600 OD values ​​(if too concentrated, dilute before measurement). Transfer the seed culture to fresh CTT liquid medium at a 2% (v / v) ratio, with three replicates for each bacterial strain. Incubate at 30°C and 200 rpm, measuring OD every 4 hours. 600 The values ​​were used to plot growth curves, and the results showed that the constructed universal chassis MxPKS entered the logarithmic growth phase earlier and had a longer plateau phase compared to the original strain DK1622, which was more conducive to the accumulation of secondary metabolites. Figure 6 ).

[0102] A systematic comparison of wild-type DK1622 and chassis MxPKS at the levels of liquid culture, electroporation recovery, and cell morphology is shown in [reference needed]. Figure 5 .Depend on Figure 5(a) It can be seen that strain DK1622 exhibited agglomerative growth during fermentation, severely impacting fermentation biomass, while the chassis strain MxPKS showed a uniform dispersion with no visible aggregation. Figure 5 (b) It can be seen that strain DK1622 possesses both A-motility and S-motility, with the bacterial cells continuously expanding outwards, forming a typical "single colony" structure at the edge; strain MxPKS, due to the absence of both A-motility and S-motility, has smooth colony edges without expansion, and after electroporation, isolated single colonies with clear boundaries and uniform diameter can be obtained. Figure 5 (c) It can be seen that, compared with wild-type DK1622, chassis MxPKS has fewer extracellular polysaccharides and other substances, and the cells are loosely spaced, making it easier to take up extracellular plasmids or fragments during electroporation.

[0103] Example 6: Comparison of the metabolic profiles of general-purpose chassis MxPKS and wild-type strain DK1622 in different fermentation media

[0104] (1) Preparation of culture medium

[0105] The preparation of CTT liquid culture medium is shown in Example 4.

[0106] VY / 2 medium (1 L): 5 g yeast extract, 1 g CaCl2, 1.19 g HEPES, bring to a final volume of 1 L with distilled water, adjust pH to 7.6, and autoclave at 121℃ for 20 min.

[0107] (2) Prepare seed culture of universal chassis MxPKS and original strain DK1622 according to Example 4.

[0108] (3) Fermentation

[0109] The general-purpose chassis MxPKS and the original strain DK1622 were inoculated into different fermentation media (CTT and VY / 2) and cultured at 30℃ and 200 rpm for 5-7 days.

[0110] (4) Extraction

[0111] Ethyl acetate was added to the fermentation broth at a volume ratio of 1:1 for extraction. After three extractions, the extract was back-extracted once with water, and the ethyl acetate was evaporated using a rotary evaporator. 100 μL of methanol was added to wash out the product, and the mixture was centrifuged at 12,000 rpm for 10 min. The supernatant was filtered through a 0.45 μm filter membrane.

[0112] (5) HPLC analysis

[0113] The compounds were detected using HPLC-PDA with an injection volume of 10 μL. Analysis was performed using a C18 column (4.6 × 250 mm, 5 μm). The mobile phase consisted of water (A) and methanol (B). Mobile phase conditions: a linear gradient program was used at a flow rate of 0.8 mL / min, gradually increasing B from 5% to 100% for a total of 46 minutes. The methanol concentration was varied as follows: 5–100% B (0–30 min), 100% B (30–40 min), 5% B (40–46 min). Chromatograms were recorded at 210, 254, 280, and 365 nm.

[0114] HPLC results showed that the metabolite profile of the chassis cells was significantly simplified, and the signal intensity of endogenous secondary metabolites was reduced, greatly facilitating the detection, separation, and identification of the target polyketide compound. Figure 7 (b).

[0115] Example 7: Determining the ability of a general-purpose chassis MxPKS to express heterologous secondary metabolic biosynthetic gene clusters

[0116] (1) Acquisition of gene clusters

[0117] The corA-SDU70 and vtc-SDU295 gene clusters were obtained by PCR using the SDU70 genome (accession number SAMN27682953) and SDU295 genome, respectively, with primers named corA-F, corA-R and vtc-F, vtc-R. Information on the corA-SDU70 gene cluster can also be obtained from existing literature (Le-Le Zhu; Qingyu Yang; De-Gao Wang. et al. Deciphering the Biosynthesis and Physiological Function of 5-Methylated Pyrazinones Produced by Myxobacteria. ACS Central Science, 2024). bgc34-SDU8 and arc-SDU8 were both extracted from the SDU8 genome (accession number MW488041) library. The primers used for extraction were bgc34-F, bgc34-R and arc-F, arc-R, respectively. Information on the arc-SDU8 gene cluster can also be found in existing literature (Jia-Qi Hu 1, Jing-Jing Wang. et al. Combining NMR-Based Metabolic Profiling and Genome Mining for the Accelerated Discovery of Archangiumide, an Allenic Macrolide from the Myxobacterium Archangium violaceum SDU8. Org Lett. 2021 Mar 19;23(6):2114-2119.). Primer sequences are shown in Table 1. Information on the bgc34-SDU8 gene cluster is shown in Table 3. Information on the vtc-SDU295 gene cluster is shown in Table 4. Figure 7 In (a), the black arrows indicate the promoter positions in each gene cluster.

[0118] (2) Electrotransfer of gene clusters

[0119] Remove the MxPKS strain stored at -80℃ from the freezer, add 100 μL to CTT liquid medium, and incubate at 30℃ with shaking at 200 rpm. This step is for strain activation. After 24 h, transfer the activated strain to fresh CTT liquid medium and incubate at 30℃ with shaking for 20-24 h. OD 600 Approximately 0.8-1.2. Take 1 OD. 600 The bacterial count, such as: measuring OD 600If the result is 1, then 1 mL of bacterial culture should be taken for the preparation of competent cells. Centrifuge the bacterial culture at 4°C and 8000 rpm, and discard the supernatant. Add 1 mL of pre-chilled ddH2O to wash the bacterial cells, centrifuge at 4°C and 8000 rpm, discard the supernatant, and repeat the washing three times. Resuspend the washed bacterial cells in 100-200 μL of ddH2O, add the prepared gene cluster-related plasmid, and transfer to a pre-chilled 2 mm electroporation cuvette for electroporation. Set the parameters of the Bio-Rad electroporator to 1250 V, 25 μF, 400 Ω, and 2 mm. After electroporation, wash the bacterial culture with 2 mL of antibiotic-free CTT liquid medium and revive in a 15 mL centrifuge tube for 4-6 h. After revival, take 50 μL, 100 μL, 200 μL, and 500 μL respectively and incubate on CTT solid medium containing kanamycin for 5-7 days, then pick single colonies for verification. Single colonies were picked and grown in fresh CTT (Kana) solid medium. After 2-3 days of growth, a suitable amount of bacterial cells was scraped and added to 20 μL ddH2O until obvious turbidity was observed. The medium was then boiled in a metal bath at 100℃ for 5 min, followed by an ice bath for 5 min, and repeated three times. The prepared template was centrifuged at 12000 rpm for 5 min, and the supernatant was used for PCR detection. The detection primers were corA-check-F and corA-check-R; vtc-check-F and vtc-check-R; bgc34-check-F and bgc34-check-R; and arc-check-F and arc-check-R. The primer sequences are shown in Table 1.

[0120] (3) The fermentation extraction and HPLC analysis steps are the same as in Example 5.

[0121] Fermentation results showed that the redundant peaks of the chassis MxPKS were significantly reduced between 25 and 35 min retention times; all four heterologously expressed gene clusters showed corresponding novel compound peaks. Compounds 1 and 2 are products of the corA gene cluster, which have been reported as important signal regulatory molecules in myxobacteria; compounds 3-9 are products of the arc gene cluster, with compound 3 having been reported to have antiviral activity, and compounds 4-9 being novel compounds previously unreported. Compounds 10-13 are products of bgc34, with compounds 12 and 13 being novel compounds previously unreported. Compounds 14 and 15 are gene cluster products of vtc, representing a new group of polyketides whose unique disc-shaped five-ring scaffold is a major characteristic of antibiotic resistance and possesses antibiotic potential (see [link to relevant documentation]). Figure 7 (c).

[0122] Table 1 Primer sequences ; ; ;

[0123] Table 2 Renovation Information

[0124] Table 3. Gene annotation of the biosynthetic gene cluster bgc34 in strain Archangium gephyra SDU8

[0125] Table 4. Annotation of the vtc gene in strain Vitiosangium sp. SDU295

[0126] The above detailed description is a specific description of the embodiments of the present invention. These embodiments are not intended to limit the patent scope of the present invention. All equivalent implementations or modifications that do not depart from the present invention should be included in the patent scope of this case.

Claims

1. A method for constructing myxobacterial chassis cells MxPKS, characterized in that, The genome of Hu04, modified from the type strain *Myxococcus faecalis* DK1622, was constructed through the following modifications: 1) Knock out key biosynthetic genes in endogenous redundant secondary metabolic gene clusters; 2) Introduce a broad-spectrum multidrug efflux pump; 3) Introduce the non-carboxylated malonyl-CoA synthesis pathway; 4) Insert the φC31 phage attP site into the high expression site identified in the genome.

2. The construction method according to claim 1, characterized in that, The key biosynthetic genes of the endogenous redundant secondary metabolic gene cluster include imuB The core genes of the gene clusters including Myxochromide, Myxovirescin, Myxalamid, Myxochelin, and Alkylpyrone.

3. The construction method according to claim 1, characterized in that, The broad-spectrum multidrug efflux pump comprises MFS family transporters and an RND-type triple efflux system; the key modules of the RND-type triple efflux system include an inner membrane transporter, an outer membrane channel protein, and a membrane fusion protein; the nucleotide sequence of the MFS family transporter is shown in SEQ ID NO.7; the nucleotide sequence of the outer membrane channel protein is shown in SEQ ID NO.8; the nucleotide sequence of the membrane fusion protein is shown in SEQ ID NO.9; and the nucleotide sequence of the inner membrane transporter is shown in SEQ ID NO.

10.

4. The construction method according to claim 1, characterized in that, The non-carboxylated malonyl-CoA synthesis pathway consists of two enzyme modules: 3-hydroxypropionic acid-CoA ligase and engineered enoyl-CoA hydratase.

5. The construction method according to claim 4, characterized in that, All enzymes in the non-carboxylated malonyl-CoA synthesis pathway have undergone codon optimization. The nucleotide sequence of the optimized 3-hydroxypropionic acid-CoA ligase is shown in SEQ ID NO.11, and the nucleotide sequence of the optimized engineered enoyl-CoA hydratase is shown in SEQ ID NO.

12.

6. The construction method according to claim 1, characterized in that, Genome modification was performed using MxRedET-ISDra2 combined gene editing technology.

7. The myxobacterial chassis cells MxPKS constructed according to any one of claims 1-6.

8. The use of the myxobacterial chassis cells MxPKS as described in claim 7 in the synthesis of polyketide compounds.

9. A method for producing polyketide compounds, characterized in that, Under suitable expression conditions, the chassis cells MxPKS of claim 7 are cultured to obtain a culture containing polyketide compounds; the polyketide compounds are isolated from the culture.

10. The method according to claim 9, characterized in that, The chassis cells MxPKS contain exogenous polyketide synthesis gene clusters.

Citation Information

Patent Citations

  • Burkholderia mutant strain and chassis strain with reasonable and simplified genome as well as construction method and application of burkholderia mutant strain and chassis strain

    CN113583900A

  • Myxococcus flavus large-fragment knockout plasmid and knockout method thereof

    CN114032248A

  • Method for constructing myxobacteria expression chassis with genetic stability and application of myxobacteria expression chassis

    CN120591312A

  • Production of myxochelin A from a mutant strain of Myxococcus xanthus

    ES2994413A1

  • Production of polyketides

    JP2004508810A