Application of protoaucoside A in preparation of chikungunya virus infection resisting medicine

Abstract

The invention aims to provide a novel application of a known natural compound. By screening and researching small molecular compounds derived from medicinal and edible substances, the fact that the original aubergine A has the activity of resisting chikungunya virus infection is found. Research results show that the original aubergine A can inhibit the infection process of chikungunya virus in a cellular level and an animal model, and shows relatively low cytotoxicity in an effective dose range. The invention provides the application of the protoaucoside A in preparation of the medicine for resisting chikungunya virus infection, provides a new technical scheme for prevention and treatment of chikungunya virus infection, and has potential application value.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biomedicine, in particular to application of a natural small molecule compound proscillaridin A in preparation of a medicine for resisting chikungunya virus infection, and belongs to the field of antiviral drug research and development and new use discovery. BACKGROUND

[0002] Chikungunya virus (CHIKV) belongs to the alphavirus genus of the Togaviridae family, is a single-stranded positive-sense RNA virus, and is mainly transmitted by mosquitoes. Human infection can cause chikungunya fever, and its typical clinical manifestations include fever and joint pain. Some patients can have prolonged or chronic joint discomfort, which has a sustained impact on public health. In recent years, CHIKV has spread and caused epidemics in many regions, and the prevention and control pressure is increasing.

[0003] At present, there is still a lack of specific antiviral drugs for CHIKV in clinical practice. The existing treatment methods mainly focus on symptomatic and supportive treatment, which is difficult to directly inhibit viral replication or effectively control disease progression. Although various explorations have been carried out for the development of drugs for CHIKV, including some small molecule compounds, biological agents and nucleic acid treatment methods, most of them are still in the experimental research stage, and a mature and stable clinical application scheme has not yet been formed.

[0004] In the field of natural product research, substances with medicinal and edible properties have attracted attention due to their wide range of sources and good long-term application basis. Related studies have shown that natural active ingredients contained in a variety of medicinal and edible plants exhibit certain biological activities in different viral models. However, systematic research on CHIKV is still limited, and the related active substances and their modes of action need to be further explored.

[0005] Proscillaridin A (PA) is a natural compound derived from medicinal and edible plants, which belongs to the class of cardiac glycosides. Previous studies have shown that this class of compounds can exert biological effects by inhibiting Na⁺ / K⁺-ATPase, and has shown certain application potential in the field of tumor treatment, etc. The pharmacokinetic characteristics and safety of this class of compounds have been studied to some extent. However, there is no report in the prior art that proscillaridin A or its related compounds are used to inhibit chikungunya virus infection or replication, and the potential application value of proscillaridin A in the field of anti-CHIKV has not been revealed. SUMMARY

[0006] In view of the lack of specific intervention means for chikungunya virus (CHIKV) infection in the prior art, and the insufficient application of natural active ingredients in this field, the purpose of the present application is to provide a new use of a known natural compound, and to provide a new technical solution for the prevention and treatment of chikungunya virus infection.

[0007] The present application is based on the screening of a variety of small molecule compounds derived from medicinal and edible substances. It is unexpectedly found that Proscillaridin A (PA) can significantly inhibit the infection process of CHIKV at the cellular level and in animal models. Within the effective dose range, PA shows low cytotoxicity, good safety and application potential.

[0008] Based on the above findings, the present application provides a use of Proscillaridin A in the preparation of a drug for resisting CHIKV infection. The drug can be used to inhibit the replication of CHIKV in host cells, reduce viral load, or treat and / or alleviate the related diseases or symptoms caused by CHIKV infection.

[0009] The use of the present application is not based on the existing pharmacological use of Proscillaridin A, but on its novel role in resisting CHIKV infection. This technology provides a new research direction and application basis for the development of natural small molecules in the field of anti-virus. BRIEF DESCRIPTION OF DRAWINGS

[0010] Figure 1 : PA cytotoxicity detection results schematic diagram. This diagram shows the effect of different concentrations of PA on cell survival rate to evaluate its cytotoxicity.

[0011] Figure 2 : PA antiviral activity immunofluorescence detection results. Among them, Figure (A) shows the immunofluorescence staining results of PA on different genotypes of virus infected cells under different concentrations; Figure (B) is a quantitative analysis diagram of the immunofluorescence results, showing the inhibitory effect of PA on viral activity under different concentrations.

[0012] Figure 3 : PA antiviral activity on different viruses schematic diagram. This diagram shows the antiviral activity of PA in multiple virus models, and compares its effect in different virus infections. Among them, (A) is the immunofluorescence graph of different viruses (B) is the quantitative graph of immunofluorescence results.

[0013] Figure 4 : Viral load and survival curve of mice in drug administration group and control group schematic diagram. The diagram shows the effect of PA on viral load in drug administration group and control group mice, and its effect on the survival rate of mice. Among them, (A) brain tissue viral load (B) mouse survival rate (C) brain tissue HE section staining DETAILED DESCRIPTION

[0014] I. Main experimental materials

[0015] A library of 1690 food and medicinal compounds (MCE, USA), protogalcin A, human liver cancer cells (Huh7 cells), chikungunya virus (CHIKV), CHIKV-E1 protein antibody, AF 488 fluorescently labeled anti-rabbit IgG, nuclear fluorescent dye DAPI, 3% BSA, methanol, Cell Counting Kit-8 (CCK8), DMEM high-glucose medium (Dulbecco's Modified Eagle Medium, DMEM), dimethyl sulfoxide (DMSO), WT-C57BL / 6 mice.

[0016] II. Experimental Methods

[0017] 1. High-throughput screening of 1,1690 medicinal and edible natural small molecule compounds for anti-CHIKV compounds

[0018] High-throughput screening of anti-CHIKV activity was conducted using a library of 1690 food-medicine homologous compounds. Using Huh7 cells infected with the CHIKV-ROSS strain (MOI=1) as a model, compounds at a final concentration of 10 µM were simultaneously added to 96-well Huh7 cells along with the virus. After co-culturing at 37℃ and 5% CO2 for 24 h, CHIKV-specific protein expression was detected by immunofluorescence. The screening criteria were an inhibition rate ≥95% and no significant cytotoxicity. The experiment was independently repeated twice to screen for target active compounds. Compound PA was ultimately selected.

[0019] 2. Detection of PA cytotoxicity

[0020] (1) In advance, the cultured Huh7 cells were seeded into 96-well plates at a density of 80%.

[0021] (2) On the second day, PA was diluted to five concentration gradients of 400, 80, 16, 3.2 and 0.64 μM using DMEM complete medium (all drugs were dissolved in DMSO), and DMSO of equal concentration was used as a control.

[0022] (3) Discard the supernatant in the well plate, add the diluted drug of different concentrations to the well plate, and incubate in an incubator for 24 hours.

[0023] (4) Discard the supernatant, mix DMEM complete culture medium and CCK8 reagent at a ratio of 10:1, 100 μL / well of the mixture, and incubate in a cell culture incubator for 1.5 h.

[0024] (5) The absorbance density (OD value) of each well at 450 nm was detected by a multi-functional microplate reader.

[0025] (6) Calculate the relative cell viability of each well:

[0026] Relative cell activity (%) = [(OD compound - OD blank well) / (OD DMSO - OD blank well)] × 100

[0027] (7) The half-cytotoxic concentration (CC50) of each drug was calculated using GraphPad Prism 9.5 software based on the relative cell activity value.

[0028] (8) The results showed that PA had low toxicity, with a CC50 of approximately 400 μM. Figure 1 )

[0029] 3. Detection of PA activity against two mainstream CHIKV strains

[0030] (1) The cultured Huh7 cells were seeded into 96-well plates at a density of 80%.

[0031] (2) On the second day, cells were infected with CHIKV-ECSA and CHIKV-Aisan (MOI=1) respectively. At the same time, different concentrations of PA (the compounds were diluted with DMEM complete medium, with a total concentration gradient of 80, 16, 3.2, 0.64, 0.128 nM) were added to the wells, and DMSO of equal concentration was used as a control.

[0032] (3) After 24 hours of incubation, the cells were detected by immunofluorescence.

[0033] The specific steps are as follows: ① Cell fixation: Remove the culture medium from the 96-well plate, wash the cells twice with PBS, add 100 μl of pre-cooled methanol to each well, fix at -20℃ for 30 min, and wash the cells three times with pre-cooled PBS.

[0034] ② Blocking: Add 100 μl of 3% BSA to each well and incubate at room temperature for 2 h. Wash three times with pre-cooled PBS.

[0035] ③ Primary antibody incubation: Add 100 μl of CHIKV E1 protein-specific rabbit monoclonal antibody (1:1000 dilution) to each well, incubate at room temperature for 1 h, and wash 3 times with pre-cooled PBS.

[0036] ④ Secondary antibody incubation: Add 100 μl of AF 488 fluorescently labeled anti-rabbit IgG (1:2000 dilution) to each well, incubate at room temperature in the dark for 2 h, and wash 3 times with pre-cooled PBS in the dark.

[0037] ⑤ Labeling cell nuclei: Add the nuclear fluorescent dye DAPI (1:10000, diluted with PBS) to each well, incubate at room temperature in the dark for 10 min, and wash 3 times with pre-cooled PBS in the dark.

[0038] ⑥ Detect and count the number of green AF 488 positive cell clones under a fluorescence microscope.

[0039] (4) Counting positive clones. The inhibition rate of each compound against CHIKV at different concentrations was calculated based on the number of positive clones:

[0040] Inhibition rate % = [(ba) / b] * 100

[0041] a represents the number of positive clones in wells with added drug; b represents the number of positive clones in wells with the same concentration of DMSO.

[0042] (6) Based on the inhibition rate, calculate the half-maximal effective concentration (EC50) of PA using GraphPad Prism 9.5 software.

[0043] (7) The results showed that PA had a significant inhibitory effect on the virus, with an EC50 of approximately 0.004 μM. Figure A is the immunofluorescence image, and Figure B is the quantification image. Figure 2 A, B)

[0044] 4. PA detection against other viruses

[0045] (1) The cultured Huh7 cells were seeded into 96-well plates at a density of 80% one day in advance, and the next day the cells were completely covered.

[0046] (2) Infect cells with WNV, EV71, JEV or ZIKV (MOI of each virus is 1), and add different concentrations of PA (PA is diluted with DMEM complete medium, with a total of 80, 16, 3.2, 0.64, 0.128 nM, 5 concentration gradients) and DMSO of equal concentration as control.

[0047] (3) After incubation at 37 ℃ for 24 h, immunofluorescence detection was performed.

[0048] (4) Calculate the number of positive clones in each well, the inhibition rate of PA against each virus and its EC50 (the calculation method is the same as above).

[0049] (5) The results showed that PA had an inhibitory effect on major viruses (including major arboviruses and enteroviruses). Figure 3 A, B).

[0050] 5. Extraction, reverse transcription, and real-time quantitative PCR (RT-qPCR) of RNA from CHIKV-infected cells.

[0051] (1) RNA extraction (24-well plate):

[0052] ① After cell treatment, discard the supernatant, add 500 μL of TRIzol lysis buffer to each well and repeatedly pipette until the cells are completely lysed. Collect the lysis buffer into a nuclease-free EP tube.

[0053] ② Add 100 μL of chloroform to each EP tube, shake for 10 s, and let stand at room temperature for 15 min. After standing, centrifuge at high speed (12000 rpm / min × 15 min, 4 ℃) to separate the layers.

[0054] ③ Carefully aspirate the upper colorless liquid using a micropipette (be careful not to aspirate the middle protein precipitate and the lower red phenol-chloroform phase), and transfer it to a new nuclease-free EP tube.

[0055] ④ Add 250 μL of isopropanol to each EP tube (pre-cool the isopropanol in a -20 ℃ freezer beforehand), gently mix until the liquid becomes clear, and let stand at room temperature for 10 min. Centrifuge at high speed (12000 rpm / min × 10 min, 4 ℃).

[0056] ⑤ Discard the supernatant, add 500 μL of 75% ethanol to each EP tube, mix by spiral mixing for 2 min, and wash the precipitate. Centrifuge at 7500 rpm / min × 15 min, 4 ℃.

[0057] ⑥ Discard the supernatant, open the EP tube cap, and air dry at room temperature until the precipitate disappears (use a 10 μL pipette to aspirate as much liquid as possible to facilitate rapid drying of the RNA and avoid degradation). Add 20 μL of nuclease-free water to each EP tube and gently pipette to completely dissolve the RNA.

[0058] ⑦ The concentration and purity of the extracted RNA were detected using an enzyme-linked immunosorbent assay (ELISA) reader.

[0059] (2) Reverse transcription:

[0060] Note: In a 20 μL reverse transcription system, the amount of RNA used is 2 μg. Calculate the required volume based on the RNA concentration. After mixing the prepared reverse transcription system, place it in a 37 ℃ water bath for 30 min.

[0061] Reagent Volume RNA According to concentration calculation (total amount 2 μg) 5x PrimeScript RT Master Mix 4 μL DEPC H2O Make up to 20 μL Total volume 20 μL

[0062] (3) RT-qPCR

[0063] RT-qPCR was performed using the TAKARA TB green kit from Japan.

[0064] Primers and their sequences

[0065] Primer name Sequence CHIKV-F-1 AGACCAGTCGACGTGTTGTAC CHIKV-R-1 GTGCGCATTTTGCCTTCGTA GAPDH Forward primer TGGGCTACACTGAGCACCAG GAPDH Reverse primer AAGTGGTCGTTGAGGGCAAT

[0066] ① Prepare the reaction system (20 μL system): primers (forward + reverse) 0.5 μL; DEPC water: 9.5 μL; TBgreen+rox: 9.5 μL; cDNA product: 0.5 μL.

[0067] ② Set the reaction program (two-step method, 40 cycles): Pre-denaturation: 95 ℃, 30 s; Denaturation: 95 ℃, 5 s; Annealing and extension: 60 ℃, 30 s; Dissolution reaction: 95 ℃, 5 s, 60 ℃, 1 min, 95 ℃, 15 s.

[0068] ③ The same reaction system and procedure were repeated 3 times, the average value was taken, and the data were analyzed using the ∆∆CT method to calculate the relative quantity (RQ) of RNA.

[0069] 6. Detection of PA antiviral activity in a C57BL / 6 mouse lethal model

[0070] (1) Animal husbandry

[0071] All mice were housed in negative pressure isolation cages in the BSL3 laboratory of the Naval Medical University. The environment was kept at a suitable temperature and humidity, with ample food and water, no noise, and the bedding was changed regularly.

[0072] (2) Mouse grouping

[0073] After weighing all WT-C57BL / 6 mice, they were randomly divided into three groups according to their weight: virus control group (only given virus), PA administration group (given virus), and blank control group, with 8 mice in each cage. The mice were marked by ear tagging in this experiment.

[0074] (3) Virus inoculation (all mice were inoculated with the CHIKV-ROSS strain)

[0075] ① Virus inoculation method: This experiment used nasal droplet infection method, and the day of virus inoculation was recorded as Day 0.

[0076] ② Virus inoculation dosage: Based on previous preliminary experimental results, each mouse was inoculated with 50 μL of 4×10 6 PFU / mL virus is the optimal lethal model; all mice die within approximately 14 days. Therefore, each mouse should be inoculated with 50 μL of virus at a concentration of 4 × 10⁴ μL. 6PFU / mL virus.

[0077] (4) Drug administration to mice

[0078] ① Administration method and dosage: Intraperitoneal injection. Based on the results of previous preliminary experiments, the dose that ensures no toxicity is 1 mg / Kg / d. Therefore, each mouse was given 1 mg / Kg / d.

[0079] ② Administration time: The drug was administered at a fixed time every day, while the control group was given the drug solvent.

[0080] ③ Drug dissolution method: When preparing the mixed solvent, prepare it according to the following volume ratio: take 10% dimethyl sulfoxide (DMSO), 40% PEG300 (or PEG400), 5% Tween-80, and 45% saline. Mix the above four components thoroughly to obtain the mixed solvent for drug dissolution. Then add the drug to be dissolved into the mixed solvent and gently shake to help dissolve until the drug is completely dispersed and dissolved.

[0081] (5) Symptom observation

[0082] Mice were weighed daily after infection with the virus, and the time of death for each group of mice was recorded (mice that survived for more than 15 days and whose weight gradually increased were considered long-term survivors). Survival curves were plotted to evaluate the protective effect of PA on infected mice.

[0083] (6) Obtain mouse brain tissue

[0084] Tissue collection: After blood collection from mice, they were euthanized by cervical dislocation. The mouse carcasses were soaked in 75% ethanol for 5 min and immediately dissected to collect brain tissue. A portion of the brain tissue was directly soaked in tissue fixative for histopathological analysis (the histopathological analysis was performed by Hunan Aifang Biotechnology Co., Ltd.); the other portion was placed in 1.5 mL EP tubes and frozen at -80 ℃ for later use.

[0085] (7) Tissue homogenate

[0086] ① Thaw the frozen tissue and place it on ice for later use.

[0087] ② Take a portion of the tissue, place it in a 2 mL grinding tube for weighing, and add 1 mL of PBS buffer solution.

[0088] ③ Place the grinding tube containing the tissue into the 2 mL 48-well adapter, set the grinding parameters (60 Hz, 180 s), and start grinding.

[0089] ④ After grinding, centrifuge at 6000 rpm for 10 min.

[0090] ⑤ Take the supernatant, divide it into portions, and freeze it in a -80 ℃ freezer for later use.

[0091] (8) The viral load in brain tissue was detected using the RT-qPCR method in step 5. The results are as follows: Figure 4 As shown, the viral mRNA expression level was significantly higher in the DMSO group, while the viral mRNA expression level was extremely low in the PA group. This indicates that PA treatment significantly inhibited the viral load in brain tissue.

Claims

1. The application of protogalloside A in the preparation of drugs for treating chikungunya virus infection.

2. The application according to claim 1, characterized in that: The anti-chikungunya virus infection drug is used to inhibit the infection of chikungunya virus in host cells.

3. The application according to claim 1 or 2, characterized in that: The anti-Chikungunya virus infection drug is used to reduce the viral load of Chikungunya virus in the host.

4. The application according to any one of claims 1 to 3, characterized in that: The anti-Chikungunya virus infection drug is used to treat and / or alleviate diseases or related symptoms caused by Chikungunya virus infection.

5. The application according to any one of claims 1 to 4, characterized in that: The aforementioned protogaloside A is a natural small molecule compound derived from a plant that is both a food and a medicine.

6. The application according to any one of claims 1 to 5, characterized in that: The application demonstrated anti-chikungunya virus activity at the cellular level and / or in animal models.

7. The application according to any one of claims 1 to 6, characterized in that: The protogaloside A exhibits low cytotoxicity within the effective dose range for its anti-Chikungunya virus activity.

8. The application according to any one of claims 1 to 7, characterized in that: The anti-Chikungunya virus infection drug is a single active ingredient preparation or a composition containing protogaloside A.

9. The application according to claim 8, characterized in that: The composition also includes pharmaceutically acceptable carriers, excipients, or excipients.

Images