Furanone derivative diamortide A with antifungal activity as well as preparation method and application of furanone derivative diamortide A

Abstract

The invention discloses a furanone derivative diamortide A with antifungal activity, the furanone derivative diamortide A has a structure as shown in a formula I. An antibacterial activity screening test on the compound shows that the compound has a remarkable inhibition effect on alternaria alternata. The invention also discloses a preparation method of the furanone derivative diamortide A with antifungal activity, the diamortide A is a secondary metabolite obtained by fermentation of PDB of metabolite DJJ 5-2, the diamortide A is obtained by fermentation and separation of a PDB culture medium, and the purity of the purified diamortide A can reach 94-96%. The fermentation period is short, the conditions are mild, the extraction and separation processes of the secondary metabolites are simple to operate, the stereoselectivity is strong, the cost is low, and industrialization is easy to realize. The invention also discloses an application of the furanone derivative diamortide A with antifungal activity in preparation of antifungal drugs, and the furanone derivative diamortide A can realize an inhibition effect on pathogenic fungus alternaria alternata.

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical chemical preparation technology, specifically relating to a furanone derivative, dialectide A, with antifungal activity, its preparation method, and its application. Background Technology

[0002] Plant diseases are a significant factor affecting crop quality and yield. The widespread use of synthetic chemicals in agriculture can lead to environmental and health problems, such as pest and disease resistance, pesticide residues, yield losses, decreased soil productivity, and the pathogenicity and carcinogenicity of residues. Therefore, plant endophytic fungi, due to the broad bioactivity of their metabolites, have become a safer option in agriculture. Finding pollution-free, green, and safe agricultural control methods has become a current research focus. Fusarium and Alternaria are pathogens of crops and most plants, and finding low-cost, green biopesticide lead compounds is also a current research hotspot. Secondary metabolites of plant endophytes are an important pathway for discovering bioactive natural small molecule drugs, characterized by simple and efficient preparation methods, low production costs, and ease of mass production. Summary of the Invention

[0003] The purpose of this invention is to overcome the shortcomings of the prior art and provide a furanone derivative, diameteride A, with antifungal activity. It can automatically measure and identify the size of the medicine box and use a robotic arm to grasp the medicine box to achieve medication replenishment, thereby improving work efficiency.

[0004] Another object of the present invention is to provide a method for preparing a furanone derivative, dialectide A, which has antifungal activity.

[0005] Another object of the present invention is to provide the use of a furanone derivative, dialectide A, with antifungal activity in the preparation of antifungal drugs.

[0006] One technical solution to achieve the above objective is: a furanone derivative, dialectide A, with antifungal activity. This type of compound can significantly inhibit plant diseases caused by the plant pathogen *Altemaria alternata*, and has the structure shown in Formula I:

[0007]

[0008] The present invention also provides a method for preparing the above-mentioned furanone derivative, dialectide A, which has antifungal activity, comprising the following steps:

[0009] S1. The endophytic fungus *Diaporthe* sp. DJJ 5-2 of *Rhododendron* was inoculated into PDB liquid medium and placed on a constant temperature shaker for liquid fermentation culture to obtain liquid fermentation product. *Diaporthe* sp. DJJ 5-2 was deposited at the China Center for Type Culture Collection on September 22, 2025, with accession number CCTCCNO:M20252090.

[0010] S2, the liquid fermentation product obtained in step S1 is extracted with ethyl acetate, and the ethyl acetate extract is concentrated to obtain the crude extract of *Metacarpa* DJJ 5-2PDB medium fermentation.

[0011] S3, the crude extract of *D. 5-2PDB* culture medium was separated and purified by reversed-phase chromatography and normal-phase chromatography to obtain a furanone derivative, dialectide A, with antifungal activity.

[0012] In the preparation method of the above-mentioned furanone derivative dialectide A with antifungal activity, in step S1, the PDB liquid culture medium is made of 200g potato, 20g glucose and 1L water, the fermentation temperature is 28℃, the fermentation time is 7 days, and the fermentation speed is 200rpm.

[0013] In the preparation method of the above-mentioned furanone derivative dialogide A with antifungal activity, in step S2, the liquid fermentation product obtained in step S1 is extracted with ethyl acetate 5 times, and all ethyl acetate extracts are concentrated under vacuum to obtain the crude extract of *Metacarpa* DJJ 5-2PDB medium fermentation.

[0014] In the preparation method of the above-mentioned furanone derivative dialogide A with antifungal activity, in step S2, the volume ratio of ethyl acetate to PDB liquid culture medium is 1:1 during each extraction.

[0015] In the preparation method of the above-mentioned furanone derivative dialectide A with antifungal activity, the specific steps of separation and purification by reversed-phase chromatography and normal-phase chromatography in step S3 are as follows:

[0016] S31: Dissolve the crude extract of *Cyclocarya spp.* DJJ 5-2PDB culture medium obtained in step S2 using a 1:1 volume ratio dichloromethane-methanol mixed solution to obtain a concentrated crude extract solution.

[0017] S32: Mix the concentrated crude extract solution from step S31 with silica gel, dry it in a 55°C oven to remove organic solvent, pack it into a 100-200 mesh silica gel column, and perform gradient elution sequentially with petroleum ether, dichloromethane, a 50:1 (v / v) mixture of dichloromethane and methanol, a 10:1 (v / v) mixture of dichloromethane and methanol, and methanol. This divides the crude extract into five fractions (Fractions 1-Fractions 5) based on their polarity.

[0018] S33: Fraction 2 was separated using RP-18 reverse phase separators in a methanol-water system. Gradient elution was performed sequentially with methanol-water volume ratios of 0:100, 20:80, 40:60, 60:100, and 40:0. The resulting samples were divided into three segments by TLC colorimetric comparison: Fr.2.1-Fr.2.3.

[0019] S34: Then, Fr.2.1 was separated using gel separation technology, dividing Fr.2.1 into four segments, namely Fr.2.1.1 to Fr.2.1.4;

[0020] S35: Finally, a mixture of petroleum ether and ethyl acetate in a volume ratio of 3:1 was used as the elution system. Fr.2.1.2 was separated repeatedly using gel column and silica gel normal phase column. After separation, the furanone derivative dialportide A with antifungal activity was identified.

[0021] In the preparation method of the above-mentioned furanone derivative dialectide A with antifungal activity, the amount of silica gel used in step S32 and the dry weight of the crude extract used in step S31 are equal.

[0022] The present invention also provides the application of the above-mentioned furanone derivative with antifungal activity, dialectide A, or the furanone derivative with antifungal activity obtained by the above preparation method, in the preparation of antifungal drugs.

[0023] The application of the above-mentioned furanone derivative diabetestide A with antifungal activity, wherein the antifungal drug is an anti-Altemaria alternata active drug, and the anti-Altemaria alternata active drug is used to inhibit plant diseases caused by the plant pathogen Altemaria alternata.

[0024] The above-mentioned application of a furanone derivative, dialectide A, with antifungal activity, wherein the raw materials for preparing the antifungal drug include furanone derivative, dialectide A, or the ethyl acetate extract from step S2, or the crude extract of *Mammillaria* fermented in DJJ 5-2PDB medium.

[0025] The present invention provides a furanone derivative, dialectide A, with antifungal activity, the structure of which is shown in Formula I. Antibacterial activity screening tests on this compound showed that it has a significant inhibitory effect on *Alternaria alternata*, with a MIC ≤ 4 μg / mL.

[0026] The antibacterial compound, dialogide A, provided by this invention is a secondary metabolite obtained from PDB fermentation of *Diaporthe sp. DJJ 5-2*. Diaportide A was isolated by fermentation in PDB medium, and its purity after purification reached 94-96%. The advantages of this preparation method are its short fermentation cycle, mild conditions, simple extraction and separation process of the secondary metabolite, strong stereoselectivity, low cost, and ease of industrialization. It can inhibit the pathogenic fungus *Altemaria alternata*, providing a research basis for the development of small-molecule antifungal drugs.

[0027] The furanone derivative diabetestide A provided by this invention, which has antifungal activity, can be used to prepare antifungal drugs and can significantly inhibit plant diseases caused by the plant pathogen Altemaria alternata.

[0028] Biological Preservation Instructions

[0029] The endophytic fungus genus *Diaporthe* sp. DJJ 5-2, deposited at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, China, was deposited on September 22, 2025. The accession number is CCTCC NO: M 20252090. Attached Figure Description

[0030] Figure 1 Morphological image of the endophytic fungus genus *Diaporthe* sp. *DJJ* 5-2, found in rhododendrons;

[0031] Figure 2 For the compound dialogide A 1 H-NMR spectrum (400MHz, CD3OD);

[0032] Figure 3 For the compound dialogide A 13 C-NMR spectrum (100MHz, CD3OD);

[0033] Figure 4 The HSQC spectrum (CD3OD) of compound diameteride A is shown below.

[0034] Figure 5 The HMBC spectrum (CD3OD) of compound diameteride A is shown.

[0035] Figure 6 For the compound dialogide A 1 H- 1 H COSY spectrum (CD3OD);

[0036] Figure 7 The NOESY spectrum (CD3OD) of compound diameteride A is shown.

[0037] Figure 8 Here is the HR-ESI-MS spectrum of compound dialogide A;

[0038] Figure 9 The IR spectrum of compound diameteride A;

[0039] Figure 10 A key two-dimensional correlation diagram for compound dialogide A;

[0040] Figure 11 This is an ECD comparison image of compound diameteride A. Detailed Implementation

[0041] The present invention will be further described below with reference to its implementation, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions and modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention. Unless otherwise specified, the analytical grade reagents used in the present invention can be purchased from the market. The dichloromethane, methanol, petroleum ether, ethyl acetate, etc. used in the present invention are all analytical grade organic solvents.

[0042] In this invention, the culture belongs to the genus DJJ 5-2 (Diaporthe sp.DJJ 5-2), with the deposit name Diaporthesp.DJJ 5-2, and the deposit address is the China Center for Type Culture Collection, Wuhan University, Wuhan, China. This culture was received by the China Center for Type Culture Collection on September 22, 2025, and registered, with the accession number CCTCCNO:M 20252090. Upon request, it will be preserved for thirty years from that date, and will be extended for another five years upon receiving a request for a sample of the culture before the expiration date.

[0043] Example 1: Isolation and Identification of Strains:

[0044] The endophytic fungus *Diaporthe* sp. DJJ 5-2 of rhododendron was obtained through screening using the following method:

[0045] The collected rhododendron plants were sterilized with 75% ethanol solution for 20 seconds, and then washed six times with sterile water to remove excess ethanol solution. The washed yam tissue was then cut into 2mm pieces. 3 Small pieces of tissue were sterilized by flame and then transferred to plates (PDA or Bengal red agar) using forceps. Five pieces of tissue were transferred to each plate, for a total of 20 plates per medium. All operations were performed in a sterile laminar flow hood. The petri dishes were sealed with sealing film and placed in a constant temperature incubator at 28°C. During the incubation process, the morphology and growth of the fungi were observed every other day until they reached a suitable level for isolation. The incubated fungi were then removed and numbered. They were then inoculated onto PDA medium. After a period of growth, it was observed whether there were single colonies. Identical strains were removed, and the remaining strains after deweighting were inoculated onto test tube slant and stored at 4°C for later use.

[0046] Please see Figure 1 Strains DJJ 5-2 were cultured on PDA medium, and the colony morphology was as follows: Figure 1 As shown: The mycelium grows slowly, forming circular colonies approximately 3 cm in diameter after 3 days of incubation at 28℃. The upper surface of the colonies is white and yellowish-white flocculent, while the lower surface is black in the center, gradually fading in color from the center to the periphery. The mycelium is dense and grows radially. No exudate was observed in the colonies, and there was no obvious odor.

[0047] The ITS gene sequence obtained from strain DJJ 5-2 was assembled, and its confidence interval sequence was determined as follows:

[0048] TGCTGACGCGACCAGGCGCACCCAGAAACCCTTTGTGAACTTATACCTTACTGTTGCCTCGGCGCTAGCTGGTCCTTCGGGGCCCCTCACCCTCGGGTGTTGAGACAGCCCGCCGGCGGCCAACCCAACTCTTGTTTT TACACTGAAACTCTGAGAATAAAACATAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTT TGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCTGGCTTGGTGATGGGGCACTGCCTGTAAAAGGGCAGGCCCTGAAATTCAGTGGCGAGCTCGCCAGGAC CCCGAGCGCAGTAGTTAAACCCTCGCTTTGGAAGGCCCTGGCGGTGCCCTGCCGTTAAACCCCCAACTTCTGAAAATTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAAGGGGGGGAGGAA

[0049] Combining morphological characteristics and molecular identification, specifically by analyzing the internal transcribed spacer region (ITS) of rRNA (mycelial samples were sent to Qingke Biotechnology Co., Ltd. for extraction, amplification, and sequencing), the sequencing results were input into GenBank (www.ncbi.nlm.nih.gov). Using homologous sequences in GenBank, the results showed that the endophytic fungus DJJ 5-2 had a similarity of 99.26% with Diaporthe sp. in NCBI. Therefore, the isolated endophytic fungus was identified as a species of endophytic fungus of the genus *Diaporthe*, DJJ 5-2 (Diaporthe sp.DJJ 5-2), and was named and bio-deposited, with the accession number CCTCC NO:M 20252090.

[0050] Example 2: Preparation of compound diameteride A:

[0051] The present invention relates to a furanone derivative, dialportide A, which has antifungal activity. This compound significantly inhibits plant diseases caused by the plant pathogen *Altemaria alternata*, and has the structure shown in Formula I:

[0052]

[0053] Diaportide A is prepared by the following method:

[0054] S1, the endophytic fungus *Diaporthe* sp. DJJ 5-2 of *Rhododendron* was inoculated into PDB liquid medium and placed on a constant-temperature shaker for liquid fermentation to obtain the liquid fermentation product, specifically:

[0055] S11, bacterial cell activation: The endophytic bacteria isolated in Example 1 were inoculated into PDA slant medium and cultured in a constant temperature incubator at 28°C for 3 days to complete the activation. The activated strains were then stored in a refrigerator at 4°C for later use.

[0056] Preparation of S12, PDB liquid culture medium: Wash and peel fresh potatoes, then cut them into 1cm³ pieces. 3 Weigh 200g of chopped yam chunks and add them to 1L of water. Boil for 20 minutes, filter through gauze to obtain the water extract of the potato, add 20g of glucose and stir to dissolve evenly. Dispense into 1L Erlenmeyer flasks, 300ml of culture medium per flask. Autoclave at 121℃ for 30 minutes, then remove and allow to cool naturally for later use.

[0057] S13, Fermentation process: Activated endophytic fungi of the genus *Metacarpa* were inoculated into prepared PDB liquid culture medium and cultured in a constant temperature incubator to obtain liquid fermentation product. The fermentation conditions were 200 rpm, 28°C, and 7 days.

[0058] S2, after fermentation, the PDB ferment broth was extracted with ethyl acetate at a volume ratio of 1:1 (medium to ethyl acetate). The ethyl acetate extraction was performed five times, and the crude fermentation extract was obtained after vacuum concentration.

[0059] S3, the crude fermentation extract was separated and purified by reversed-phase chromatography and normal-phase chromatography to obtain a furanone derivative, dialectide A, with antifungal activity, specifically:

[0060] S31, the obtained crude fermentation extract is dissolved in an appropriate amount of dichloromethane-methanol mixed solution with a volume ratio of 1:1 to obtain a concentrated crude extract solution;

[0061] S32, the above concentrated crude extract solution is mixed with silica gel of equal mass (dry weight of crude extract), and dried in a 55°C constant temperature oven to remove organic solvent. A column is packed with 100-200 mesh silica gel, and gradient elution is performed sequentially using petroleum ether, dichloromethane, a mixed solution of dichloromethane:methanol (v:v) = 50:1, a mixed solution of dichloromethane:methanol (v:v) = 10:1, and methanol, thereby dividing the crude extract into 5 fractions (Fractions 1-5) based on polarity differences.

[0062] S33, Fraction 2 was separated using RP-18 reverse phase separator with a methanol-water system, eluted sequentially in a methanol:water gradient (0:100, 20:80, 40:60, 60:100, 40:0, v / v). The sample was divided into three segments by TLC colorimetric comparison, namely Fr.2.1-Fr.2.3.

[0063] S34, Fr.2.1 was separated using gel separation technology and divided into four segments: Fr.2.1.1 to Fr.2.1.5;

[0064] S35, Fr.2.1.2 was separated by repeated use of gel column and silica gel normal phase column, and a petroleum ether and ethyl acetate (3:1, v / v) elution system was selected to separate and identify dialogide A.

[0065] Example 3: Diaportide A Structure Identification

[0066] Please see Figures 2 to 11 The prepared diameteride A (hereinafter referred to as compound 1) was used to identify the structure of compound diameteride A by 1D / 2D NMR (one-dimensional nuclear magnetic resonance spectroscopy and two-dimensional nuclear magnetic resonance spectroscopy) and HR-ESI-MS (high-resolution electrospray ionization mass spectrometry).

[0067] Depend on 1 H-NMR and 13 C-NMR, combined with HSQC and DEPT spectra, can yield the chemical shifts of the corresponding C and H phase connections of this compound, as shown in Table 1.

[0068] Table 1: Proton (400MHz) and carbon (100MHz) spectra data (CD3OD) of compound 1

[0069]

[0070]

[0071] Diaportide A, a yellow oily substance. (0.2 mg / mL, MeOH). The molecular ion peak of compound 1 was determined to be 195.0657 [M+H] based on HR-ESI-MS data. + (The calculated value is 195.0657[M+H]) + From this, we can deduce that the molecular formula of compound 1 is C16. 10 H 10 O4, with an unsaturation degree of 6. Compound 1 at 1783 cm⁻¹ -1 and 1677cm -1 The presence of significant infrared absorption indicates the presence of ester carbonyl and ketone carbonyl groups. According to... 13 C-NMR and DEPT spectra show that compound 1 contains one methyl group (δc (ppm): 26.0); two methylene groups (δc (ppm): 27.5, 29.1); three methine groups (δc (ppm): 112.3, 120.0, 75.7); and four quaternary carbons (δc (ppm): 178.8, 157.5, 154.1, 188.7).

[0072] Based on the above analysis, and in conjunction with the reference Yuan L, Lin X, Zhao PJ, et al. New polyketides from endophytic Diaporthe sp. XZ-07[J]. Helvetica Chimica Acta ,2009, 92: 1184-1190; It is thus inferred that compound 1 has a similar structural skeleton to 3,4-dihydro-5'-[(1R)-1-hydroxyethyl][2,2'-bifuran]-5(2H)-one, but the difference lies in the fact that the hydroxyl group at C-9 in compound 1 is oxidized to a carbonyl group. Compound 1's 1 H- 1 H COSY spectrum (see) Figure 7 Display H-6 ( δ H 6.75) / H-7 ( δ H 7.37), H-2 ( δ H 2.76) / H-3 ( δ H 2.64) / H-4 ( δ H 5.67) is correlated. According to the HMBC spectrum (see... Figure 5 ) to obtain H-10 ( δ H 2.50) and C-9 ( δ c 188.7), C-8 ( δc 154.1) related; H-6 ( δ H 6.75) and C-7 ( δ c 120.0), C-8 ( δ c 154.1), C-5 ( δ c 157.5) related; H-4 ( δ H 5.67) and C-3 ( δ c 27.5), C-5 ( δ c 157.5) related; H-3 ( δ H 2.64) and C-2 ( δ H 2.64) related; H-2 ( δ H 2.76) and C-1 ( δ c 178.8) is related. Its absolute configuration is determined by comparing experimental ECD with calculated ECD (see Figure 11 Furthermore, based on the biosynthetic pathways reported in the literature, the absolute configuration of compound 1 was determined to be 4. S .

[0073] Compound 1 (diaportide A) has the structure shown in Formula I:

[0074]

[0075] Example 4: Inhibitory activity of furanone derivative dialportide A against Alternaria:

[0076] In 96-well plates, the activity of some isolated compounds against the plant pathogenic fungi *Altemaria alternata* and *Fusarium asiaticum* was determined using a two-fold dilution method, with nystatin as a positive control. The specific procedure was as follows: the compound was accurately weighed and dissolved in dimethyl sulfoxide (DMSO) to a concentration of 10.24 mg / mL. Nystatin was used as a positive control, and a concentration of 10.24 mg / mL was prepared. *Altemaria alternata* and *Fusarium asiaticum* were cultured on a shaker at a constant temperature for 36 h. Under aseptic conditions in a laminar flow hood, add 5 μL of the compound solution to the first two wells of a 96-well plate, followed by 85 μL of PDB. Add 90 μL of PDB to wells 3-10. Add another 90 μL of PDB to well 2, mix well, and then add 90 μL of PDB to well 3. Repeat this 2-fold dilution process until well 10. For easier observation, well 11 is left empty, and well 12 serves as a blank PDB control. Take 200 μL of bacterial suspension, add 9800 μL of PDB, mix well, and add 10 μL of the prepared bacterial suspension to each well of the 96-well plate. At this point, the compound concentrations from wells 1-10 are 512, 256, 128, 64, 32, 16, 8, 4, 2, and 1 mg / mL, respectively. After completing the above operations, the 96-well plate was placed in a 28°C incubator. Observations and records were made at 12h, 24h, and 36h intervals to observe and record fungal growth at different concentrations of each compound. The minimum inhibitory concentration (MIC) was recorded, and each compound was tested in triplicate. The antibacterial results are shown in the table below:

[0077] Table 2, Antifungal activity results of compound 1 (MICs, μg / mL):

[0078] Compounds Fusarium asiaticum Altemaria alternata Compound 1 128 4 Nystatin 1 1

[0079] Experimental results showed that compound 1 (diaportide A) had significant inhibitory activity against Alternaria alternata, with a MIC ≤ 4 μg / mL.

[0080] The furanone derivative dialogide A, as a small molecule drug against Alternaria alternata, has significant research value. It can be used to prepare antifungal drugs and inhibit plant diseases caused by the plant pathogen Alternaria alternata. The raw materials for preparing antifungal drugs can include the furanone derivative dialogide A, the ethyl acetate extract from step S2, or the crude extract from the fermentation of *Alternaria alternata* on DJJ 5-2PDB medium. The microbial fermentation method for dialogide A offers a novel, low-cost, high-quality, and high-yield mass production approach.

[0081] In summary, the furanone derivative dialogide A of this invention, possessing antifungal activity, is a secondary metabolite obtained from PDB fermentation of Diaporthe sp. DJJ 5-2. Diaportide A was isolated by fermentation in PDB medium, and its purity after purification reached 94-96%. The advantages of this preparation method include a short fermentation cycle, mild conditions, simple extraction and separation of the secondary metabolite, strong stereoselectivity, low cost, and ease of industrialization. It can inhibit the pathogenic fungus *Altemaria alternata*, providing a research basis for the development of small-molecule antifungal drugs.

[0082] Those skilled in the art should recognize that the above embodiments are merely illustrative of the present invention and are not intended to limit the present invention. Any variations or modifications to the above embodiments that are within the spirit and essence of the present invention will fall within the scope of the claims of the present invention.

Claims

1. A furanone derivative, dialectide A, with antifungal activity, characterized in that, It has the structure shown in Equation I:

2. A method for preparing the furanone derivative diameteride A with antifungal activity as described in claim 1, characterized in that, Includes the following steps: S1, the endophytic fungus *DJJ 5-2* of *Rhododendron* was inoculated into PDB liquid medium and placed on a constant temperature shaker for liquid fermentation culture to obtain liquid fermentation product. *DJJ 5-2* was deposited at the China Center for Type Culture Collection on September 22, 2025, with accession number CCTCC NO: M20252090. S2, the liquid fermentation product obtained in step S1 is extracted with ethyl acetate, and the ethyl acetate extract is concentrated to obtain the crude extract of *Metacarpa* DJJ 5-2PDB medium fermentation. S3, the crude extract of *D. 5-2PDB* culture medium was separated and purified by reversed-phase chromatography and normal-phase chromatography to obtain a furanone derivative, dialectide A, with antifungal activity.

3. The method for preparing a furanone derivative, dialectide A, with antifungal activity as described in claim 2, characterized in that, In step S1, the PDB liquid culture medium is made from 200g potatoes, 20g glucose and 1L water, with a fermentation temperature of 28℃, a fermentation time of 7 days and a fermentation speed of 200rpm.

4. The method for preparing a furanone derivative, dialectide A, with antifungal activity as described in claim 2, characterized in that, In step S2, the liquid fermentation product obtained in step S1 is extracted five times with ethyl acetate, and all ethyl acetate extracts are concentrated under vacuum to obtain the crude extract of *Metacarpa* DJJ 5-2PDB medium fermentation.

5. The method for preparing a furanone derivative, dialectide A, with antifungal activity as described in claim 4, characterized in that, In step S2, the volume ratio of ethyl acetate to PDB liquid culture medium is 1:1 for each extraction.

6. The method for preparing a furanone derivative, dialectide A, with antifungal activity as described in claim 2, characterized in that, In step S3, the specific steps for separation and purification using reversed-phase chromatography and normal-phase chromatography are as follows: S31: Dissolve the crude extract of *Cyclocarya spp.* DJJ 5-2PDB culture medium obtained in step S2 using a 1:1 volume ratio dichloromethane-methanol mixed solution to obtain a concentrated crude extract solution. S32: Mix the concentrated crude extract solution from step S31 with silica gel, dry it in a 55°C oven to remove organic solvent, pack it into a 100-200 mesh silica gel column, and perform gradient elution sequentially with petroleum ether, dichloromethane, a 50:1 (v / v) mixture of dichloromethane and methanol, a 10:1 (v / v) mixture of dichloromethane and methanol, and methanol. This divides the crude extract into five fractions (Fractions 1-Fractions 5) based on their polarity. S33: Fraction 2 was separated using RP-18 reverse phase separators in a methanol-water system. Gradient elution was performed sequentially with methanol-water volume ratios of 0:100, 20:80, 40:60, 60:100, and 40:

0. The resulting samples were divided into three segments by TLC colorimetric comparison: Fr.2.1-Fr.2.

3. S34: Then, Fr.2.1 was separated using gel separation technology, dividing Fr.2.1 into four segments, namely Fr.2.1.1 to Fr.2.1.4; S35: Finally, a mixture of petroleum ether and ethyl acetate in a volume ratio of 3:1 was used as the elution system. Fr.2.1.2 was separated repeatedly using gel column and silica gel normal phase column. After separation, the furanone derivative dialportide A with antifungal activity was identified.

7. The method for preparing a furanone derivative, dialectide A, with antifungal activity as described in claim 6, characterized in that, In step S32, the amount of silica gel used and the dry weight of the crude extract used in step S31 are considered.

8. The use of a furanone derivative with antifungal activity, dialectide A, as described in claim 1, or a furanone derivative with antifungal activity, dialectide A, obtained by any one of claims 2 to 7, in the preparation of antifungal drugs.

9. The application of the furanone derivative dialectide A with antifungal activity as described in claim 8, characterized in that, The antifungal drug is an anti-Alternaria alternata active drug, which is used to inhibit plant diseases caused by the plant pathogen Alternaria alternata.

10. The application of the furanone derivative dialectide A with antifungal activity as described in claim 8, characterized in that, The raw materials for preparing the antifungal drug include furanone derivatives such as dialectide A, ethyl acetate extract from step S2, or crude extract of *Metacarpa* var. *metacarpa* fermented in DJJ 5-2PDB medium.

Images