Transcription factor HbWRKY73 related to saline-alkaline tolerance as well as coding gene and application of transcription factor HbWRKY73
By cloning and identifying the sequence of the WRKY transcription factor HbWRKY73 in short-awned barley grass, a recombinant expression vector was constructed and the HbWRKY73 gene was overexpressed in rice. This solved the problem of the lack of salt-tolerant transcription factors in existing technologies, improved the salt tolerance of rice, and promoted the breeding of new salt-tolerant plant varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-20
- Publication Date
- 2026-04-07
AI Technical Summary
Current technologies lack research on the WRKY transcription factor in short-awned barley grass in response to salt and alkali stress, making it difficult to effectively utilize its application technology in the cultivation of salt-tolerant transgenic plants.
The amino acid and nucleotide sequences of the WRKY transcription factor HbWRKY73 from short-awned barley grass were cloned and identified. A recombinant expression vector was constructed, and the expression of salt-alkali-tolerant genes was regulated in rice by overexpressing the HbWRKY73 gene, thereby enhancing the salt-alkali resistance of the plant.
The regulation of HbWRKY73 protein significantly enhanced the resistance of transgenic rice to salt and alkali stress, promoted the breeding of new salt-tolerant plant varieties, and has great value for production and application.
Smart Images
Figure CN121800899A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a salt-tolerant transcription factor HbWRKY73, its encoding gene, and its applications. Background Technology
[0002] Currently, the global area of saline-alkali soils reaches 1 billion hectares, with my country ranking third in the world in terms of saline-alkali soil area. The soda-alkali land of the Songnen Plain is one of the three major concentrated distribution areas of soda-alkali soils globally. Affected by both global climate change and human activities, land salinization is becoming increasingly severe. Saline-alkali soils not only severely inhibit plant growth and development, causing crop yield reduction and hindering the sustainable development of agriculture and animal husbandry, but also pose a potential threat to global food security. Against this backdrop, conducting research on the discovery of salt-tolerant plant germplasm resources and the mechanisms of salt tolerance is of significant theoretical and practical importance for promoting salt-alkali resistance breeding in plants.
[0003] Abiotic stresses such as soil salinization can adversely affect plant growth and development. Plant cells can sense stress signals in the environment and, through signal transduction pathways, trigger specific physiological and metabolic responses and regulate gene expression, thereby forming stress resistance. The expression of most WRKY genes is induced by abiotic stresses, with some genes playing a negative regulatory role in stress responses, while others can act as positive regulators in the plant stress response process. WRKY transcription factors can bind to cis-acting elements such as the W-box (TTGAC) and WT-box (GACTTT) in the promoter regions of downstream genes, participating in the plant's response to various abiotic stresses such as salinity and drought by regulating the expression of downstream genes.
[0004] Short-awned barley grass is a dominant species in the original natural vegetation of the Songnen Plain, and has long grown in areas rich in nutrients. Barley grass, with its isohalite ions, has evolved extremely strong salt and alkali tolerance in saline-alkali soil environments, making it a rare germplasm rich in salt and alkali tolerance genes. Conducting research on the salt and alkali tolerance of short-awned barley grass germplasm resources, identifying its salt and alkali tolerance functional genes, and elucidating its molecular regulatory mechanisms can provide key technical support for plant salt-alkali resistant genetic engineering breeding.
[0005] Currently, scholars both domestically and internationally have conducted in-depth analyses of the adaptation mechanisms and resistance mechanisms of plants to abiotic stresses at the molecular biology level, and have identified a large number of stress-related genes. Existing studies have confirmed that numerous transcription factors are involved in the plant response network to abiotic stresses such as drought, salinity, and low temperature; among them, the functions of WRKY family genes in abiotic stress responses of various plants have been successively reported, but the role and mechanism of WRKY family transcription factors in the regulation of salinity stress resistance in *Barley stubble* have been rarely studied to date.
[0006] In summary, there is an urgent need to discover the WRKY transcription factor of short-awned barley grass involved in the salt-alkali stress response, clarify its encoding gene sequence, and develop the application technology of this gene in the breeding of salt-alkali tolerant transgenic plants. Summary of the Invention
[0007] The purpose of this invention is to overcome the shortcomings of the existing technology and provide a salt-alkali tolerance-related transcription factor HbWRKY73, its encoding gene, and its applications.
[0008] The objective of this invention is achieved through the following technical solution: a salt-alkali tolerance-related transcription factor HbWRKY73, the amino acid sequence of which is shown in SEQ ID No.1.
[0009] The present invention also provides the encoding gene of the salt tolerance-related transcription factor HbWRKY73, characterized in that its nucleotide sequence is shown in SEQ ID No. 2.
[0010] The present invention also provides the application of the transcription factor HbWRKY73 or the encoding gene described herein in the cultivation of salt-tolerant transgenic rice.
[0011] The present invention also provides a recombinant expression vector, expression cassette or recombinant bacterial cell encoding the transcription factor HbWRKY73, which is associated with the salt and alkali tolerance trait.
[0012] The present invention also provides the application of recombinant expression vectors, expression cassettes or recombinant bacterial cells encoding the transcription factor HbWRKY73, which is associated with the salt tolerance trait, in the cultivation of salt-tolerant transgenic rice.
[0013] The beneficial effects of this invention are as follows: The HbWRKY73 protein provided by this invention can regulate the plant's resistance to salt-alkali stress. Induced by salt-alkali stress, it can participate in the response of *Barley grass* to salt-alkali stress. The transcription factor HbWRKY73 and its encoding gene can be used to cultivate new salt-alkali tolerant crop varieties. By overexpressing the *Barley grass* HbWRKY73 gene, the expression of salt-alkali tolerance-related genes can be regulated, thereby obtaining salt-alkali tolerant plants. The transcription factor HbWRKY73 and its encoding gene of this invention can be used to cultivate new salt-alkali tolerant plant varieties and have significant production application value. Attached Figure Description
[0014] Figure 1 This is an agarose gel electrophoresis image of the PCR amplification product of the short-awned barley grass gene HbWRKY73. Figure 2 This refers to the expression levels of the HbWRKY73 gene in different tissues under salt-alkali stress conditions. Figure 3 This describes the subcellular localization of the HbWRKY73 protein in tobacco leaves. Figure 4 These are the PCR test results of rice plants transgenic with the HbWRKY73 gene; Figure 5 These are the PCR test results of rice plants transgenic with the HbWRKY73 gene; Figure 6 It represents the relative gene expression level in HbWRKY73 transgenic rice plants; Figure 7 These are the experimental results of T3 generation HbWRKY73 transgenic rice lines and wild-type rice under salt-alkali stress. Detailed Implementation
[0015] The present invention will now be described in detail with reference to the accompanying drawings.
[0016] Example 1: Cloning of the HbWRKY73 gene in short-awned barley grass Seeds of *Barley grass* were collected at the Anda Field Experiment Base, located at Zhangjiadian Andong 2nd Road, Wolitun Town, Anda City, Suihua City, Heilongjiang Province, and germinated in the laboratory. Leaves from two-leaf stage seedlings were selected as samples, and RNA was extracted using the Plant RNA Kit from Tiangen Biotech (Beijing) Co., Ltd., strictly following the instructions. RNA quality and concentration were detected by agarose gel electrophoresis and NanoDrop spectrophotometer. For RNA that met quality standards, the cDNA synthesis reaction system was prepared according to Table 1-1 using the TransScript One-Step gDNA Removal and cDNA Synthesis reagent from Beijing TransGen Biotech Co., Ltd., and reverse transcribed into cDNA.
[0017] Table 1-1 Preparation of cDNA Synthesis Reaction Solution
[0018] Reaction conditions: 50 ℃ for 15 min, 85 ℃ for 5 s, store at 4 ℃.
[0019] Based on the HbWRKY73 gene sequence annotated in the *Barley grass* transcriptome data, sequence alignment and analysis were performed using the NCBI website. Primer-specific primers for this gene were designed using the software tool Primer 5.0 to amplify the *Barley grass* HbWRKY73 gene. HbWRKY73-clo-F: ATGATCAAGGGAGACCAGAGG, SEQ ID No. 3; HbWRKY73-clo-R: CTAATTAATGTGCTCCCTTTTC, SEQ ID No. 4.
[0020] Using cDNA as a template, PCR reaction was performed using KOD One™ PCR MasterMix reagent from Toyobo (Shanghai) Biotechnology Co., Ltd. The PCR reaction system for the cloned fragments was prepared according to Table 1-2, and the reaction procedure is shown in Table 1-3.
[0021] Table 1-2 PCR Reaction System
[0022] Table 1-3 PCR reaction procedures
[0023] The HbWRKY73 gene was amplified by PCR using specific primers HbWRKY73-clo-F and HbWRKY73-clo-R. The PCR products were then detected by 1% agarose gel electrophoresis. The amplification results are shown below. Figure 1 As shown, the target DNA band is correctly positioned and sized. PCR products were recovered using the OMEGA Gel Extraction Kit according to the manufacturer's instructions. The recovered products were ligated into the pMD19-T vector, and the ligation system is shown in Table 1-4.
[0024] Table 1-4 PMD-19-T Carrier Linkage System
[0025] Reaction conditions: 16℃, 1h Transformation of TOP10 competent cells. The *E. coli* strain TOP10 (purchased from Shanghai Angyu Biotechnology Co., Ltd.) was used. The ligation product was transformed according to the following procedures: (1) Remove Escherichia coli TOP10 competent cells from -80℃ and place them on ice to thaw slowly; (2) When the competent cells are in a semi-molten state, add the ligation product and keep them on ice for 30 minutes. (3) Place it in a 42℃ water bath for 60 seconds, then remove it and let it stand on ice for 2 minutes; (4) Add 700 µL of antibiotic-free liquid LB medium to a clean bench and incubate at 37°C and 200 rpm for 1 h. (5) Place the bacterial solution at room temperature, centrifuge at 4000 r / min for 2 min, and take 700 μL of supernatant in a clean bench. Mix the remaining bacterial solution by suction and beating. (6) After coating, invert the plate and place it in a 37°C incubator overnight; (7) Three single-clone colonies were selected on LB solid medium and subjected to PCR detection. Colonies with the correct bands were considered positive clones. Positive clones were cultured in a shaking culture for identification and then sent to Jilin Kumei Biotechnology Co., Ltd. for sequencing analysis to verify the correctness of the inserted fragment. Sequencing results showed that the sequence was completely identical to SEQ ID NO: 1. The obtained HbWRKY gene coding sequence was 1836 bp in length, encoding 611 amino acids, and contained typical WRKY family domains. After successful sequencing, the plasmid was extracted, yielding the pMD19-T-HbWRKY73 recombinant plasmid.
[0026] Example 2: Spatiotemporal expression pattern analysis of HbWRKY73 gene in short-awned barley grass under salt-alkali stress Short-awned barley grass seeds germinated to the two-leaf stage in a culture room. Seedlings were subjected to salt-alkali stress treatment with 200 mM NaHCO3 solution. Treatment durations were set at five gradients: 0 h (CK), 3 h, 6 h, 12 h, and 24 h. Young leaves of the stressed plants were collected, and total RNA was extracted. Using the CYP2 gene as an internal control, the expression pattern of the HbWRKY73 gene was analyzed by qRT-PCR using the TransStart® Probe qPCR SuperMix kit. The real-time quantitative PCR reaction system is shown in Table 2-1, and the real-time quantitative PCR reaction program is shown in Table 2-2. -ΔΔct The relative expression levels of genes were calculated using this method. The results are as follows: Figure 2 As shown, HbWRKY73 is expressed in both roots and leaves, but the expression level in roots is significantly higher than in leaves, while the expression level in leaves is relatively low. The RT-qPCR and transcriptome data showed a high degree of consistency in expression patterns, further validating the reliability of the experimental results. The primers used for RT-qPCR are as follows: CYP2-F:CCTGTCGTGTCGTCGGTCTAAA, SEQ ID No.5; CYP2-R:ACGCAGATCCAGCAGCCTAAAG, SEQ ID No.6; qRT-WRKY72-F:GAAGTGACACGAAGGTGCAG, SEQ ID No.7; qRT-WRKY72-R:TGTGGTTGTCTCTGTGGCGG, SEQ ID No. 8.
[0027] Table 2-1 Real-time quantitative system
[0028] Table 2-2 Real-time quantitative PCR reaction program
[0029] Example 3: Subcellular localization experiment of HbWRKY73 gene 1. Subcloning was performed using the pMD19-T-HbWRKY73 recombinant plasmid (obtained in Example 1) as a template.
[0030] Using the correctly sequenced positive clone plasmid obtained in Example 1 as a template, cloning primers for the pBI121-GFP-HbWRKY73 vector were designed and constructed using Snapgene software. The restriction enzyme sites were Kpn I and BamHI. The primers used are as follows: Inf-PBI121-GFP-HbWRKY73-F: ggactctagaggatccATGATCAAGGGAGACCAGAG, SEQ IDNo.9; Inf-PBI121-GFP-HbWRKY73-R: cgacctcgagggtaccATTAATGTGCTCCCTTTTC, SEQ ID No. 10.
[0031] The PCR reaction system is shown in Table 1-1 (only the primers are different), and the PCR reaction procedure is shown in Table 1-2. After separation by 1.5% agarose gel electrophoresis, the PCR products were recovered using the OMEGA Gel Extraction Kit according to the manufacturer's instructions. The recovered products were ligated into the pBI121-GFP vector and digested with Kpn I and BamHI according to the ligation system shown in Table 3-1, at 37°C for 30 min. The digested products were detected by 1% agarose gel electrophoresis to confirm complete digestion and that the fragment size met the requirements. The digested products were then recovered from the gel for ligation. Recombination was performed at 50°C for 30 min according to the ligation system shown in Table 3-2. The ligation products were then transformed into competent cells. The transformation method is described in Example 1.
[0032] Table 3-1 Enzyme digestion system
[0033] Table 3-2 Connection System
[0034] Positive clones were selected, cultured in a shaker, identified, and then sequenced. Sequencing analysis verified the correctness of the inserted fragment. Plasmids were extracted after successful sequencing.
[0035] 2. The recombinant plasmid pBI121-GFP-HbWRKY73 was transformed into Agrobacterium using the heat shock transformation method. The specific steps are as follows: (1) Take EHA105 competent cells out of the -80℃ freezer, wait on ice until they partially thaw, and insert them into ice when the cells are in an ice-water mixture state for later use. (2) Take 100 μL of competent cells, add 1 μg (volume not greater than 10 μL) of plasmid DNA to be transformed, gently stir the bottom of the tube to mix, and perform the following treatments in sequence: stand on ice for 5 minutes, liquid nitrogen for 5 minutes, water bath at 28℃ for 5 minutes, ice bath for 5 minutes. (3) Then add 700 μL of antibiotic-free YEB liquid medium and incubate at 28°C with shaking for 3 hours; (4) Centrifuge at 6000 rpm for one minute to collect bacteria, keep 100 μL of supernatant, gently pipette and resuspend the bacterial block and spread it on YEB plate containing the corresponding antibiotics (50 μg / mL Kana, 20 μg / mL Rif), and incubate upside down in a 28°C incubator for 3 days; (5) PCR detection, and preserve the bacterial solution with the correct test results.
[0036] 3. Agrobacterium tumefaciens transiently transforms tobacco leaves (1) Take 50µl of the correctly identified original bacterial culture and inoculate it into 5mL of YEP (containing the corresponding antibiotics 50μg / mL Kana and 20μg / mL Rif) liquid culture medium. Incubate overnight at 28℃ and 200rpm for 16-18h until OD600=0.8-1.0; (2) Take 2 ml of overnight bacterial culture and inoculate it into 5 mL of YEP liquid medium (containing the corresponding antibiotics 50 μg / mL Kana and 20 μg / mL Rif), and incubate at 28℃ and 200 rpm for 5-6 h until OD600 = 0.8-1.0; (3) Centrifuge the large-scale bacterial culture at 6000 rpm for 8 min and collect the bacterial cells; (4) Preparation of resuspension buffer: 5 mL 10 mM MgCl2, 10 mL 10 mM MES (pH 5.5), 50 µl 100 µM acetylsuccinone (AS), add ddH2O to 500 mL; (5) Resuspend the collected bacterial cells 2-3 times using resuspension buffer until the bacterial solution has an OD600 of 0.8-1.0; (6) Place the mixed bacterial solution in a 28℃ incubator and let it stand in the dark for 2-3 hours; (7) Select healthy tobacco plants and water them thoroughly 24 hours before injection so that the leaves can be injected. Use a sterile syringe to inject the induced bacterial solution into the intercellular spaces from the back of the leaves. (8) The injected tobacco was placed in a dark incubator at 28 ℃ for 2 days; (9) Tear off leaf tissue from the infected area, prepare a temporary slide, and observe the fluorescence signal through an inverted fluorescence microscope.
[0037] The results are as follows Figure 3 As shown, the GFP tag emits green fluorescence. In the 35S:WRKY73-GFP labeled image, the green fluorescence indicates the location of HbWRKY73 in the cell. DAPI specifically binds to DNA in the cell nucleus and emits blue fluorescence. In the DAPI labeled image, the blue fluorescence indicates the location of the cell nucleus. Bright shows the structure of tobacco cells under bright field, and Merged combines the GFP, DAPI, and bright field channels into a single image. The blue fluorescence of DAPI and the green fluorescence signal of the 35S-HbWRKY73-GFP fusion protein are both expressed in the cell nucleus. These results indicate that the HbWRKY73 protein is specifically localized in the cell nucleus, consistent with the nuclear localization signal (NLS) predicted by bioinformatics and the functional characteristics of typical WRKY transcription factors.
[0038] Example 4: Obtaining HbWRKY73 transgenic rice and its salt-alkali resistance test 1. Construction of expression vector 1300-FLAG-HbWRKY73 Using the correctly sequenced positive clone plasmid obtained in Example 1 as a template, cloning primers for the 1300-FLAG-HbWRKY73 vector were designed and constructed using Snapgene software. The restriction enzyme sites were Kpn I and BamHI. The primers used are as follows: Inf-1300-FLAG-HbWRKY73-F:ACGATGATAAGGGCGGTACCATGATCAAGGGAGACCAGAGGC, SEQ ID No. 11; Inf-1300-FLAG-HbWRKY73-R: AGGCTACGTAGGATCCATTAATGTGCTCCCTTTTCTTCACAGG, SEQ ID No. 12.
[0039] The PCR reaction system is shown in Table 1-1 (only the primers are different), and the PCR reaction procedure is shown in Table 1-2. After separation by 1.5% agarose gel electrophoresis, the PCR products were recovered using the OMEGA Gel Extraction Kit according to the manufacturer's instructions. The recovered products were ligated into the 1300-FLAG vector and digested with Kpn I and BamHI according to the digestion and ligation system shown in Table 3-1, at 37°C for 30 min. The digested products were detected by 1% agarose gel electrophoresis to confirm complete digestion and consistent fragment size. The digested products were then recovered from the gel for ligation. The ligation system was followed by incubation at 50°C for 30 min according to Table 3-2. The ligation products were then transformed into competent cells (transformation method is described in Example 1). Positive clones were picked, cultured, identified, and sequenced. Sequencing analysis verified the correctness of the inserted fragment. After successful sequencing, the plasmid was extracted. The correct recombinant plasmid was named 1300-FLAG-HbWRKY73.
[0040] 2. The 1300-FLAG-HbWRKY73 recombinant plasmid was transformed into Agrobacterium using the heat shock transformation method. The method is described in Example 3.
[0041] 3. Obtaining HbWRKY73 transgenic rice plants An optimized Agrobacterium-mediated genetic transformation method for japonica rice (SLAMET-LOEDIN et al., 2014; Liu Defang, 2019) was used to transform the constructed vector plasmid into Agrobacterium EHA105. After rooting, the plants were cultured at 30℃ under light for 7-10 days, resulting in 12 transgenic plants, labeled OE#1, OE#2, OE#3, OE#4, OE#5, OE#6, OE#7, OE#8, OE#9, OE#10, OE#11, and OE#12. Genomic DNA was extracted from the rice using an Omaga plant DNA extraction kit. Positive seedlings were detected by PCR. The PCR reaction system is shown in Table 4-1, and the PCR reaction procedure is shown in Table 4-2. The PCR primers are as follows: M13-F: CAGGAAACAGCTATGAC, SEQ ID No. 13; HbWRKY73-400bp-R: CCATCTGGATTATTAGTGCTTCCC, SEQ ID No. 14.
[0042] Table 4-1 PCR reaction system for detecting positive rice seedlings
[0043] Table 4-2 PCR Reaction Procedure
[0044] The results are as follows Figure 4 , Figure 5 As shown, except for OE#9, all overexpression lines had obvious specific bands, indicating that HbWRKY73 was successfully inserted and overexpressed in rice, while wild-type (WT) showed no specific bands, verifying the successful construction of transgenic plants.
[0045] Transgenic positive plants were used for propagation, and T3 generation seeds were used for subsequent functional verification experiments.
[0046] 4. Salt and alkali resistance detection of T3 generation HbWRKY73 transgenic rice Select plump and healthy wild-type rice seeds and the three with the highest HbWRKY73 expression levels (see...). Figure 6 Transgenic rice lines OE#8, OE#11, and OE#12 were used. After sterilization, the seeds were spread evenly in 9cm petri dishes, and 25ml of sterile water was added. Germination was carried out in a 30℃ incubator for 24-48 hours. After germination, the seeds were transferred to a light incubator at 28℃, with 16 hours of light and 8 hours of darkness, and 60% humidity, keeping the seedbed moist. Once the seedlings reached 5cm in height, the culture medium was changed from distilled water to 1 / 8 Hoagland's solution, and cultivation continued. Nutrients were added daily, and the seedlings reached the three-leaf stage after 14 days. The culture medium was then replaced with 60mM NaHCO3 for 9 days of stress. Figure 7 As shown, the image labeled 0mM-NaHCO3-0day represents the state of rice on day 0 under conditions without sodium bicarbonate; the image labeled 0mM-NaHCO3-9day represents the state of rice on day 9 under conditions without sodium bicarbonate; the image labeled 0mM-NaHCO3-9day represents the state of rice on day 0 under 60mM sodium bicarbonate stress; and the image labeled 60mM-NaHCO3-9day represents the state of rice on day 9 under 60mM sodium bicarbonate stress. The figure clearly shows that the salt-alkali treatment group and the untreated group were in the same state on day 0, with leaves unfolded and green, and remained upright. However, after 9 days of treatment with 60mM NaHCO3, the growth of the stressed group was inhibited compared with the untreated group, and the leaves showed varying degrees of yellowing and curling. However, the wild-type (WT) plants showed a stronger stress phenotype, with more severe yellowing and curling, and the mortality rate was significantly higher than the other three overexpressed lines. This indicates that the HbWRKY73 gene can enhance the resistance of transgenic rice seedlings to salt-alkali stress.
[0047] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.
Claims
1. A salt tolerance-related transcription factor, HbWRKY73, characterized in that: Its amino acid sequence is shown in SEQ ID No.
1.
2. The gene encoding the salt tolerance-related transcription factor HbWRKY73 as described in claim 1, characterized in that: Its nucleotide sequence is shown in SEQ ID No.
2.
3. The application of the transcription factor HbWRKY73 as described in claim 1 or the encoding gene as described in claim 2 in the cultivation of salt-tolerant transgenic rice.
4. A recombinant expression vector, expression cassette, or recombinant bacterial cell containing the encoding gene of the transcription factor HbWRKY73, which is associated with salt and alkali tolerance as described in claim 2.
5. The application of the recombinant expression vector, expression cassette, or recombinant bacterial cell encoding the transcription factor HbWRKY73, which is associated with salt tolerance as described in claim 4, in the cultivation of salt-tolerant transgenic rice.