Pigeon adenovirus type 1 and pigeon circovirus bivalent inactivated vaccine and preparation method thereof
By using inactivated vaccine strains of pigeon adenovirus type 1 and pigeon circovirus to prepare an inactivated adjuvant vaccine, the problems of insufficient immunogenicity and protective efficacy of existing vaccines were solved, and effective protection of pigeon flocks was achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-12
- Publication Date
- 2026-04-07
AI Technical Summary
Currently, there is a lack of highly immunogenic and effective bivalent inactivated vaccines against pigeon adenovirus type 1 and pigeon circovirus, making it difficult to effectively prevent diseases caused by these two viruses in pigeon flocks.
Pigeon adenovirus type 1 strain QYH-HB-1 and pigeon circovirus strain QYH-HB-2 were used as vaccine strains. After inactivation treatment, they were mixed in a 1:1 ratio to prepare an inactivated adjuvant vaccine. Mineral oil and aluminum stearate were used as the oil phase, and Tween 80 was used as the emulsifier to prepare the inactivated adjuvant vaccine.
The prepared bivalent inactivated vaccine can effectively prevent anorexia, weight loss, diarrhea and respiratory symptoms caused by pigeon adenovirus type 1 and pigeon circular virus. It has good safety and immunization effect and is suitable for different breeding environments.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of veterinary biological products, and more specifically, to a bivalent inactivated vaccine of pigeon adenovirus type 1 and pigeon circovirus, and its preparation method. Background Technology
[0002] Pigeon adenovirus (PiAdV) is one of the important viruses infecting domestic pigeons, racing pigeons, and meat pigeons. It belongs to the genus Aviadenovirus in the family Adenoviridae. Currently, two main types are known: pigeon adenovirus type 1 (PiAdV-1) and pigeon adenovirus type 2 (PiAdV-2), which differ in pathogenicity and clinical manifestations. Viral characteristics: Non-enveloped, double-stranded DNA virus, genome length approximately 45-48 kb. Stability: Relatively resistant to environmental factors, it can survive for a long time in feces and contaminated objects. Clinical manifestations: PiAdV-1 (classic type): Primarily infects young pigeons; symptoms include vomiting, diarrhea, and weight loss; often complicated by E. coli infection, leading to worsening of the condition; histopathology shows inclusion bodies in the intestines and hepatocytes. PiAdV-2 (inclusion body hepatitis type): Can infect pigeons of all ages; characterized by acute liver necrosis and sudden death; high mortality rate, especially severe in mixed infections. The main route of transmission is through the fecal-oral route; the virus can also be indirectly transmitted through contaminated feed, water, transportation vehicles, and personnel; outbreaks are more likely to occur under stress conditions such as competitions, training, and intensive transportation. Mixed infections and their impact: Mortality is low when infected alone; however, mixed infections with E. coli, porcine circovirus, herpesvirus, etc., significantly increase the risk of death; it is one of the important pathogenic factors of Young Pigeon Disease Syndrome (YPDS).
[0003] Pigeon Circovirus (PiCV) is a member of the Circoviridae family. It is a non-enveloped icosahedral virus, approximately 15-22 nm in diameter, with a single-stranded circular DNA genome of about 1.7-2.3 kb, encoding replication-associated proteins (Rep) and capsid proteins (Cap). It exhibits high genetic diversity. Key characteristics: Immunosuppressive pathogen: PiCV primarily affects young pigeons (especially those under 4 months old), leading to decreased lymphocytes and weakened immunity, making them susceptible to secondary infections. Global distribution: Widely present in wild and domestic pigeon flocks, with infection rates reaching up to 70%. Transmission: Primarily horizontal transmission via the fecal-oral route, but vertical transmission via eggs is also possible. Clinical manifestations and harms: "Young Pigeon Disease Syndrome" (YPDS): Infected pigeons exhibit weakness, anorexia, weight loss, diarrhea, and respiratory symptoms, with increased morbidity and mortality. Immunosuppression: PiCV itself has a low mortality rate, but it can significantly weaken the pigeon's immune system, making the flock more susceptible to E. coli, adenovirus, etc., leading to mixed infections and death.
[0004] There are few reports on bivalent inactivated vaccines for pigeon adenovirus and pigeon circovirus. There is an urgent need to develop bivalent inactivated vaccines with good immunogenicity and high protective efficacy to meet the needs of farmers. Summary of the Invention
[0005] The purpose of this invention is to provide a bivalent inactivated vaccine of pigeon adenovirus type 1 and pigeon circovirus and its preparation method.
[0006] To achieve the objectives of this invention, in a first aspect, this invention provides a pigeon adenovirus vaccine strain, which is a pigeon adenovirus (… Aviadenovirus columbae The strain QYH-HB-1 of type 1 is currently deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China, with accession number CGMCC No. 47084 and deposit date November 26, 2025.
[0007] Secondly, the present invention provides a pigeon circovirus vaccine strain, which is pigeon circovirus (… Pigeon circovirus The QYH-HB-2 strain is currently deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China, with accession number CGMCC No. 47085 and deposit date November 26, 2025.
[0008] Thirdly, the present invention provides the application of vaccine strains QYH-HB-1 and / or QYH-HB-2 in vaccine preparation.
[0009] Fourthly, the present invention provides a vaccine product, characterized in that the active ingredient is an inactivated vaccine strain QYH-HB-1 and / or QYH-HB-2 or their antigenic proteins.
[0010] Fifthly, the present invention provides a bivalent inactivated vaccine of pigeon adenovirus type 1 and pigeon circovirus, wherein the vaccine contains inactivated pigeon adenovirus type 1 strain QYH-HB-1 with accession number CGMCC No. 47084 and pigeon circovirus strain QYH-HB-2 with accession number CGMCC No. 47085.
[0011] In a sixth aspect, the present invention provides a method for preparing the bivalent inactivated vaccine, wherein pigeon adenovirus type 1 strain QYH-HB-1 is inoculated into pigeon embryos for virus propagation, and pigeon circovirus strain QYH-HB-2 is inoculated into pigeon embryo fibroblasts for virus propagation, and the virus fluid is inactivated; the inactivated pigeon adenovirus type 1 and pigeon circovirus virus fluids are mixed at a volume ratio of (0.8~1.2):(0.8~1.2) (preferably a volume ratio of 1:1) to prepare an aqueous phase, and then an inactivated adjuvant vaccine is prepared according to conventional methods.
[0012] Furthermore, the virus solution was inactivated using formaldehyde.
[0013] Preferably, the final formaldehyde concentration in the virus solution is 0.15%.
[0014] Furthermore, an inactivated adjuvant vaccine was prepared by emulsifying the aqueous and oil phases.
[0015] Preferably, the oil phase is prepared by mixing 94-96 parts of mineral oil and 0.8-1.2 parts of aluminum stearate evenly and heating to 80°C, then adding 4-6 parts of Span 80, and maintaining the temperature at 115°C~118°C for 30-35 minutes, followed by cooling to complete the oil phase preparation. The parts are by weight.
[0016] Preferably, 0.8 to 1.2 parts of the aqueous phase are mixed with 1.8 to 2.2 parts of the oil phase (for example, 1 part of the aqueous phase is mixed with 2 parts of the oil phase); the parts are by weight.
[0017] Furthermore, the quality standard for the bivalent inactivated vaccine antigen is as follows: the viral fluid harvested from pigeon embryos after inoculation with pigeon adenovirus type 1 QYH-HB-1 strain has a viral titer ≥10 per 0.1 ml of viral fluid. 4.0 EID 50 Pigeon circovirus strain QYH-HB-2 was inoculated into pigeon embryo fibroblasts for viral replication, and the viral titer of the harvested viral fluid was ≥10. 4.0 TCID 50 / ml.
[0018] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects: (i) The present invention uses virus strains with good immunogenicity, high viral titer and good viral purity screened from isolated and identified epidemic strains as vaccine strains for pigeon adenovirus type 1 and pigeon circovirus bivalent inactivated vaccines. Through optimization of culture conditions such as the optimal inoculation dose and the optimal harvest time, stable pigeon adenovirus and pigeon circovirus are cultured.
[0019] (ii) The bivalent inactivated vaccine of the present invention has a preventive effect against anorexia, weight loss, diarrhea and respiratory symptoms and death caused by pigeon adenovirus type 1 and pigeon circular virus.
[0020] (III) Research results on the vaccine’s production process, safety, and immunization evaluation show that the vaccine has good safety and stable immunization effect. Attached Figure Description
[0021] Figure 1 The results of the autopsy examination of the pathogenicity of strain QYH-HB-1 to pigeons in a preferred embodiment of the present invention are shown.
[0022] Figure 2 The results of the autopsy examination of the pathogenicity of strain QYH-HB-2 to pigeons in a preferred embodiment of the present invention are shown.
[0023] Figure 3 This is the necropsy result of the immune group after challenge with the QYH-HB-1 strain in a preferred embodiment of the present invention.
[0024] Figure 4 This is the autopsy result of the immune group after challenge with the QYH-HB-2 strain in a preferred embodiment of the present invention.
[0025] Figure 5 This is the autopsy result of the control group after being challenged with the QYH-HB-1 strain in a preferred embodiment of the present invention.
[0026] Figure 6 This is the autopsy result of the control group after being challenged with the QYH-HB-2 strain in a preferred embodiment of the present invention. Detailed Implementation
[0027] This invention aims to provide a bivalent inactivated vaccine against pigeon adenovirus type 1 and pigeon circovirus. This bivalent inactivated vaccine contains pigeon adenovirus strain QYH-HB-1 and pigeon circovirus strain QYH-NB-2 isolated from the field. This invention also relates to the application of pigeon adenovirus strain QYH-HB-1 and pigeon circovirus strain QYH-NB-2 in the preparation of inactivated vaccines (adenovirus inactivated vaccines).
[0028] In the bivalent inactivated vaccine of the present invention, the preferred volume ratio of the inactivated virus solution of pigeon adenovirus QYH-HB-1 strain and pigeon circovirus QYH-NB-2 strain is 1:1. In the above-mentioned inactivated vaccine, the virus is inactivated using formaldehyde.
[0029] The preparation method of the bivalent inactivated vaccine of the present invention is as follows: 1. Oil phase preparation: Take 94 parts of mineral oil and 1 part of aluminum stearate, mix them evenly in an oil phase preparation tube and heat to 80°C. Then add 5 parts of Span 80 and maintain the temperature at 115°C for 30 minutes. After cooling, the oil phase preparation is complete.
[0030] 2. Aqueous phase preparation Mix inactivated pigeon adenovirus and pigeon circovirus solutions (preferably in a volume ratio of 1:1); take 95 parts of the mixed antigen solution and 5 parts of sterilized Tween 80, and mix thoroughly. 3. Emulsification Take 2 parts of oil phase and 1 part of water phase, put them into an emulsification tank, stir at 3500 r / min for 30 minutes to complete the emulsification preparation.
[0031] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.
[0032] Unless otherwise specified, the term "parts" in this invention refers to parts by weight.
[0033] Example 1: Isolation and Screening of Wild-type Adenovirus Strains 1. Isolation and identification of wild-type pigeon adenovirus strains Since 2024, the inventors have collected multiple tissue samples suspected of being infected with pigeon adenovirus in Hebei, Heilongjiang, Shandong, Henan, Jiangsu, Yunnan and Ningxia. The main symptoms of the diseased pigeons include vomiting, diarrhea and weight loss; histopathology shows inclusion bodies in the intestines and liver cells.
[0034] Liver and spleen tissues exhibiting typical symptoms and pathological changes were collected, weighed, and then added to sterile PBS at a 1:3 weight ratio. The tissues were then minced and ground, centrifuged at 12000 rpm for 10 minutes at 4°C, and aseptically filtered. Five 6-7 day old pigeon embryos were inoculated into each embryo via the yolk sac, 0.1 mL per embryo. Embryos that died within 24 hours were discarded. Thereafter, the embryos were observed every 24 hours, and dead embryos were removed promptly. All embryos were collected after 240 hours, the tissues were homogenized, and samples were retained for PCR testing. The remaining virus isolates were stored at -70°C for later use.
[0035] 2. PCR amplification and identification The embryonic tissue homogenate from pigeon embryos inoculated with the isolated virus was collected, and viral genomic DNA was extracted using standard methods. PCR was performed to amplify the gene. Specific bands were excised under UV light and purified using an agarose gel extraction kit. The purified DNA was ligated and transformed into competent E. coli cells. Positive samples were sequenced and subjected to phylogenetic analysis.
[0036] 3. The sample undergoes purity testing. Established detection methods such as PCR and RT-PCR were used to detect whether the isolated strains contained other common contaminating viruses. The detection items included pigeon circovirus, pigeon rotavirus, and pigeon Newcastle disease virus.
[0037] 4. Virus titer determination The isolated virus solution was serially diluted 10-fold with PBS in centrifuge tubes to a final concentration of 10. -6 10 -3 ~10 -6 The diluted virus solution was inoculated into the yolk sac of 6-7 day old pigeon embryos and cultured for another 240 hours. Dead embryos were promptly removed. All embryos were collected individually, crushed, and DNA extracted for PCR testing. A positive PCR result indicated infection, while a negative result indicated no infection. The EID was calculated using the Reed-Muench method. 50 .
[0038] Based on the virus purity and proliferation ability, the preliminarily isolated and identified viral fluids were screened to identify a strain of pigeon adenovirus type 1 isolated from Hebei in 2025, which was named QYH-HB-1 strain.
[0039] Example 2: Isolation and Screening of Wild-type Pigeon Circovirus Strains 1. Isolation and identification of wild-type pigeon circovirus strains Since 2024, the inventors have collected multiple tissue samples suspected of being infected with pigeon circovirus in Hebei, Heilongjiang, Shandong, Henan, Jiangsu, Yunnan and Ningxia. The main symptoms of the diseased pigeons were weakness, loss of appetite, weight loss, diarrhea and respiratory symptoms, with increased morbidity and mortality.
[0040] Collect liver tissues showing typical symptoms, weigh them, add sterile PBS at a weight ratio of 1:3, cut and grind them, centrifuge at 12000 r / min for 10 min at 4℃, filter aseptically, and inoculate them into pigeon embryo fibroblasts that have grown into a dense monolayer. After adsorption for 1 hour, replace with DMEM medium containing 1% bovine serum and culture for 8-10 days.
[0041] 2. PCR amplification and identification The supernatant from the isolated virus inoculated into pigeon embryo fibroblasts was used to extract viral genomic DNA using standard methods. PCR was performed to amplify the gene. Specific bands were excised under UV light and purified using an agarose gel extraction kit. The purified DNA was ligated and transformed into competent *E. coli* cells. Positive samples were sequenced and subjected to phylogenetic analysis.
[0042] 3. The sample undergoes purity testing. Established detection methods such as PCR and RT-PCR were used to detect whether the isolated strains contained other common contaminating viruses. The detection items included pigeon adenovirus type 1 and 2, pigeon rotavirus, and pigeon Newcastle disease virus.
[0043] 4. Virus titer determination The harvested viral fluid was serially diluted 10-fold with PBS to 10-fold. -5 Take 10 -2 -10 -5 Four dilutions were inoculated into 8 wells of 96-well plates confluent with pigeon embryo fibroblasts, with 0.1 ml of each dilution inoculated into each well. The plates were incubated for 8–10 days, and viral genomic DNA was extracted from each well using standard methods. PCR was performed to amplify the gene. A positive PCR result indicated infection, while a negative result indicated no infection. The TCID was calculated using the Reed-Muench method. 50 .
[0044] Based on the virus fluids that were initially isolated and identified, and according to the purity and proliferation capacity of the virus, a strain of pigeon circovirus QYH-HB-2, which was isolated from Hebei in 2024, was selected.
[0045] Example 3: Identification and properties of QYH-HB-1 and QYH-HB-2 strains 1. Sterility test According to the appendix of the current Chinese Veterinary Pharmacopoeia, after inoculation with the F1 generation of QYH-HB-1 and QYH-HB-2 strains, no sterile growth was observed.
[0046] 2. Virus content determination The QYH-HB-1 strain was serially diluted 10-fold with PBS in centrifuge tubes to a final concentration of 10. -6 10 -3 ~10 -6 The diluted virus solution was inoculated into the yolk sac of 6-7 day old pigeon embryos and cultured for another 240 hours. Dead embryos were promptly removed. All embryos were collected individually, crushed, and DNA extracted for PCR testing. A positive PCR result indicated infection, while a negative result indicated no infection. The EID was calculated using the Reed-Muench method. 50 The results showed that the virus content of the QYH-HB-1 strain F1 was 10. 4.25 EID 50 / 0.1mL.
[0047] The QYH-HB-2 strain was serially diluted 10-fold with PBS to a final concentration of 10. -5 Take 10 -3 -10 -5Four dilutions were inoculated into 96-well plates confluent with pigeon embryo fibroblasts, with 0.1 ml of each dilution inoculated into 8 wells per well. After 8-10 days of incubation, viral genomic DNA was extracted from each well using standard methods. PCR was performed to amplify the gene. A positive PCR result indicated infection, while a negative result indicated no infection. The TCID was calculated using the Reed-Muench method. 50 The results showed that the virus content of the QYH-HB-2 strain F1 was 10. 3.25 TCID 50 / 0.1mL.
[0048] 3. Virulence determination of QYH-HB-1 and QYH-HB-2 strains (pathogenicity to pigeons): Thirty healthy 30-day-old pigeons (fecal samples tested negative for pigeon adenovirus and pigeon circovirus by PCR) were randomly divided into three groups of 10 each. Groups 1 and 2 were intravenously inoculated with QYH-HB-1 and QYH-HB-2 virus strains, respectively, 0.1 mL per pigeon. Groups 3 were inoculated with an equal volume of sterile saline as a normal control group. Clinical manifestations of the pigeons in each group were observed daily after inoculation. Necropsy was performed on dead pigeons, and the number of deaths and pathological changes were recorded.
[0049] Pigeons in the QYH-HB-1 group began to show symptoms on the 3rd day after vaccination, and died within 7 days. All affected pigeons exhibited symptoms such as frequent vomiting, loss of appetite, watery diarrhea (green or yellowish-green), lethargy, ruffled feathers, unsteady gait, and high fever. Autopsy revealed intestinal hemorrhage and hepatosplenomegaly. In the QYH-HB-2 group, pigeons began to show symptoms on the 2nd week after vaccination. Affected pigeons exhibited lethargy, ruffled feathers, and difficulty breathing, and began to die after 3 weeks. Surviving pigeons gradually recovered to normal 4 weeks after vaccination. Autopsy of sick pigeons revealed lymphatic tissue atrophy. The control group, vaccinated with physiological saline, showed normal mental state, normal feed and water intake, and 100% survived. Results are shown in Table 1. Figure 1 , Figure 2 .
[0050] Table 1. Pathogenicity test of QYH-HB-1 strain and QYH-HB-2 strain in 30-day-old pigeons.
[0051] Example 4: Preparation of antigens from strains QYH-HB-1 and QYH-HB-2 1. Preparation of antigens for production (1) Antigen preparation The QYH-HB-1 strain was inoculated into the yolk sac of 6-7 day old pigeon embryos and cultured for another 240 hours. Dead embryos were removed in time, and all pigeon embryos were collected, crushed, and samples were retained for testing.
[0052] Inoculate healthy pigeon embryo fibroblasts with QYH-HB-2 strain virus solution, incubate at 37℃ with 5% CO2 for 240 hours, harvest, freeze and thaw once, harvest virus solution, and retain samples for testing.
[0053] The samples to be tested shall be subjected to sterility testing, mycoplasma testing, and exogenous virus testing according to the appendix of the current Chinese Veterinary Pharmacopoeia. They should be free from bacterial, fungal, mycoplasma, and exogenous virus contamination, and the virus content of QYH-HB-1 strain per 0.1 ml of virus solution before inactivation should be ≥10. 4.0 EID 50 The viral load of QYH-HB-2 strain should be ≥10 mmol / L per 1 ml of solution. 4.0 TCID 50 Store at 2-8℃ before inactivation, and do not exceed 3 days.
[0054] 2. Inspection of semi-finished products (1) Sterility test: According to the appendix of the current Chinese Veterinary Pharmacopoeia, the inactivated QYH-HB-1 and QYH-HB-2 strains should be tested for sterility and should show no growth.
[0055] (2) Inactivation test QYH-HB-1 virus culture medium was inactivated at 37°C for 24 hours with formaldehyde at a final concentration of 0.15%. After inactivation, samples were taken for sterility and inactivation tests and stored at 2-8°C for no more than 7 days. Three batches of inactivated virus culture medium were taken and 0.1 ml was inoculated into each pigeon embryo. After culturing for 240 hours, the embryos were harvested and then blindly passaged once. The embryos were then crushed and PCR tests were performed. All results should be negative to determine complete inactivation.
[0056] QYH-HB-2 virus culture medium was inactivated at 37°C for 24 hours using formaldehyde with a final concentration of 0.15%. After inactivation, samples were taken for sterility and inactivation tests and stored at 2-8°C for no more than 7 days. Three batches of inactivated virus culture medium were inoculated at 1% into 24-well plates of well-grown pigeon embryo fibroblasts and cultured at 37°C with 5% CO2. Observations were made every 12 hours for 240 hours, followed by one blind passage. PCR tests of all sample wells should be negative to indicate complete inactivation.
[0057] PCR detection method: Amplification template preparation: Take 200 μl of the test sample and extract DNA using a DNA extraction kit. The DNA can be used directly for PCR amplification or frozen at -70℃ for later use.
[0058] The primer sequences used for PCR detection are as follows: QYH-HB-1-F: ATCAACTACGACAACGAAGGC; QYH-HB-1-R: GAAGGTGTCGAGTCCGGGGCT.
[0059] QYH-HB-2-F:TCAARTATGGGCGTGGCTTG; QYH-HB-2-R: CTGTTGCTGGTCACTATTATCAC.
[0060] PCR amplification: Using the DNA from the detection sample as a template, primers QYH-HB-1-F / R and QYH-HB-2-F / R were added according to the following reaction system: primer F (25 pmol / L) 1 μl, primer R (25 pmol / L) 1 μl, 2×Taq enzyme 10 μl, DNA template 1 μl, ddH2O 7 μl, total volume 20 μl. PCR amplification conditions were: pre-denaturation 95℃ for 5 min; denaturation 95℃ for 30 s, annealing 55℃ for 30 s, extension 72℃ for 30 s, for a total of 30 cycles; final extension 10 min.
[0061] Electrophoresis detection: Prepare a 1% agarose gel, add 10 μl of PCR amplification product, electrophores at 110V for 30 minutes, observe the results under a gel imaging system, and take pictures for recording.
[0062] Example 5: Vaccine Preparation and Testing 1. Vaccine preparation (1) Preparation of oil phase: Take 94 parts of mineral oil and 1 part of aluminum stearate, mix them evenly in the oil phase preparation tube and heat to 80°C, then add 5 parts of Span 80, and maintain the temperature at 115°C for 30 minutes. After cooling, the oil phase preparation is complete.
[0063] (2) Aqueous phase preparation: Mix the inactivated pigeon adenovirus type 1 virus solution and pigeon circovirus solution at a volume ratio of 1:1. Take 95 parts of the mixed antigen solution and 5 parts of sterilized Tween 80 solution and mix thoroughly.
[0064] (3) Emulsification: Take 2 parts of oil phase and 1 part of water phase, put them into an emulsification tank, stir at 3500 r / min for 5 minutes, and stir at 8000 r / min for 15 minutes to complete the emulsification preparation.
[0065] (4) Dispense in a fixed quantity, seal with a cap, affix a label, and store at 2~8℃.
[0066] 2. Safety trials of vaccines (1) Safety trial of single-dose administration via different routes at the minimum age of administration Twenty healthy 30-day-old pigeons (fecal samples tested negative for pigeon adenovirus and pigeon circovirus by PCR) were divided into four groups: groups 1-3, each consisting of five pigeons, and group 4, a control group of five pigeons. Groups 1-3 were administered pigeon adenovirus type 1 and pigeon circovirus bivalent inactivated vaccines intramuscularly, batch numbers 20250601, 20250602, and 20250603 respectively, at a dose of 0.2 mL / pigeon. The control group (n=10 pigeons) received 0.2 mL / pigeon sterile saline intramuscularly. All groups were raised and managed under the same conditions and observed for 14 consecutive days. Any deaths were necropsied to examine internal organs for lesions. Live pigeons were also observed for adverse reactions. After 14 days, all surviving pigeons were euthanized and their internal organs were examined for lesions. The safety results of the single-dose vaccination trial at the minimum age of administration are shown in Table 2.
[0067] Table 2. Safety trial results of single-dose vaccination at the minimum age of administration.
[0068] (2) Safety trial of single-dose repeated vaccination Twenty healthy 30-day-old pigeons (fecal samples tested negative for pigeon adenovirus and pigeon circovirus via PCR) were divided into four groups: groups 1-3 (immunization groups, 5 pigeons each) and group 4 (control group, 5 pigeons each). Groups 1-3 were administered pigeon adenovirus type 1 and pigeon circovirus bivalent inactivated vaccines intramuscularly, batch numbers 20250601, 20250602, and 20250603 respectively, at a dose of 0.2 mL / pigeon. The control group (10 pigeons) received 0.2 mL / pigeon sterile saline intramuscularly. All groups were raised and managed under the same conditions and observed for 14 consecutive days. Any pigeons that died were necropsied to examine their internal organs for lesions. A second vaccination with the same dose was administered 14 days after the first vaccination, and the pigeons were observed for another 14 days for adverse reactions. Any pigeons that died were necropsied to examine their internal organs for lesions. Local inflammation and tissue lesions in the pigeons were assessed. Fourteen days after the second immunization, all surviving pigeons were euthanized to observe for any lesions in their internal organs. The safety results of the single-dose repeated vaccination test are shown in Table 3.
[0069] Table 3. Safety trial results of single-dose repeated vaccination
[0070] (3) Safety trial of single overdose inoculation Twenty healthy 30-day-old pigeons (fecal samples tested negative for pigeon adenovirus and pigeon circovirus by PCR) were divided into four groups: groups 1-3, each consisting of five pigeons, and group 4, a control group of five pigeons. Groups 1-3 were administered pigeon adenovirus type 1 and pigeon circovirus bivalent inactivated vaccines intramuscularly, batch numbers 20250601, 20250602, and 20250603 respectively, at a dose of 1.0 mL / pigeon. The control group (n=10 pigeons) received 1.0 mL / pigeon sterile saline intramuscularly. All groups were raised and managed under the same conditions and observed for 14 consecutive days. Any deaths were necropsied to examine internal organs for lesions. Live pigeons were also observed for adverse reactions. After 14 days, all surviving pigeons were euthanized and their internal organs were examined for lesions. The safety trial results for single-dose vaccination at the minimum age of administration are shown in Table 4.
[0071] Table 4. Safety test results of overdose vaccination
[0072] 3. Vaccine efficacy trials Forty healthy 30-day-old pigeons (fecal samples tested negative for pigeon adenovirus and pigeon circovirus by PCR) were divided into four groups of 10 each. Groups 1-3 were intramuscularly inoculated with three batches of pigeon adenovirus type 1 and pigeon circovirus bivalent inactivated vaccine, batches 20250601, 20250602, and 20250603, respectively, 0.2 mL per pigeon. A non-immunized challenge control group was also included, receiving 0.2 mL / pigeon sterile saline intramuscularly. Fourteen days post-immunization, pigeons were intravenously injected with 0.1 mL each of QYH-HB-1 and QYH-HB-2 strains, and observed for 14 consecutive days. Any deaths were necropsy performed on the deceased pigeons. Fourteen days after challenge, all surviving pigeons were necropsyed one by one to observe for visceral lesions. Results showed that the pigeons in the immunized pigeon adenovirus type 1 and pigeon circovirus bivalent inactivated vaccine groups had normal mental state, feed intake, and water consumption, and all organs were normal after necropsy. Specific results are shown in Table 5. Figures 3-6 .
[0073] Table 5 Results of Immunopotency Test
[0074] The vaccine prepared in this invention uses whole viruses, which can be customized for breeding areas such as public sheds, and more targeted vaccine development can be carried out to adapt to viral mutations.
[0075] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. Pigeon adenovirus vaccine strain, which is pigeon adenovirus ( Aviadenovirus columbae Type 1 QYH-HB-1 strain, preservation number CGMCC No. 47084.
2. Pigeon circovirus vaccine strain, which is pigeon circovirus (… Pigeon circovirus The strain QYH-HB-2, with the preservation number CGMCC No.47085, was obtained.
3. The use of the vaccine strain described in claim 1 and / or claim 2 in vaccine preparation.
4. A vaccine product, characterized in that, The active ingredient is an inactivated vaccine strain or its antigen protein as described in claim 1 and / or claim 2.
5. A bivalent inactivated vaccine against pigeon adenovirus type 1 and pigeon circovirus, characterized in that, The vaccine contains inactivated pigeon adenovirus type 1 strain QYH-HB-1 with accession number CGMCC No. 47084 and pigeon circovirus strain QYH-HB-2 with accession number CGMCC No. 47085.
6. The method for preparing the bivalent inactivated vaccine according to claim 5, characterized in that, Pigeon adenovirus type 1 strain QYH-HB-1 was inoculated into pigeon embryos for virus propagation, and pigeon circovirus strain QYH-HB-2 was inoculated into pigeon embryo fibroblasts for virus propagation. The virus fluid was inactivated. The inactivated pigeon adenovirus type 1 and pigeon circovirus virus fluids were mixed at a volume ratio of (0.8~1.2):(0.8~1.2) to prepare an aqueous phase, and then prepared into an inactivated adjuvant vaccine according to conventional methods.
7. The method according to claim 6, characterized in that, The virus solution is inactivated using formaldehyde; Preferably, the final formaldehyde concentration in the virus solution is 0.15%.
8. The method according to claim 6, characterized in that, An inactivated adjuvant vaccine was prepared by emulsifying the aqueous and oil phases. Preferably, the oil phase is prepared by mixing 94-96 parts of mineral oil and 0.8-1.2 parts of aluminum stearate evenly and heating to 80°C, then adding 4-6 parts of Span 80, and maintaining the temperature at 115°C~118°C for 30-35 minutes, and then cooling to obtain the final product; the parts are by weight.
9. The method according to claim 8, characterized in that, Mix 0.8 to 1.2 parts of the aqueous phase with 1.8 to 2.2 parts of the oil phase; the parts are by weight.
10. The method according to any one of claims 6-9, characterized in that, The quality standard for the bivalent inactivated vaccine antigen is as follows: the viral fluid harvested from pigeon embryos after inoculation with pigeon adenovirus type 1 QYH-HB-1 strain has a viral titer ≥10 per 0.1 ml of viral fluid. 4.0 EID 50 Pigeon circovirus strain QYH-HB-2 was inoculated into pigeon embryo fibroblasts for viral replication, and the viral titer of the harvested viral fluid was ≥10. 4.0 TCID 50 / ml.