Method for producing D-tagatose with high efficiency and low cost

Abstract

The invention discloses a method for producing D-tagatose with high efficiency and low cost. According to the invention, a double-enzyme cascade engineering strain B.subtilis WB800N-pHT01-araA-lacZ, which can be used for simultaneously expressing a beta-galactosidase gene lacZ and an L-arabinose isomerase gene araA, is constructed, and the double-enzyme cascade engineering strain B.subtilis WB800N-pHT01-araA-lacZ is constructed; culturing the engineering strain, centrifugally collecting thalli, resuspending the collected thalli by using a substrate solution containing whey powder (lactose), and reacting at constant temperature; and finally, centrifuging the reaction liquid after the reaction is finished, taking supernate, filtering the supernate through a 0.22 m water system small filter, and determining the D-tagatose in the supernate by high performance liquid chromatography, the yield of the D-tagatose being up to 77.5 g / L. The method provided by the invention can realize efficient reutilization of the milk product byproduct whey powder, and has the advantages of simple operation method, mild reaction conditions, high efficiency, low cost and the like.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and specifically relates to a method for producing D-tagatose efficiently and at low cost. Background Technology

[0002] D-tagatose, a rare sugar, is one of the most promising natural functional low-calorie sweeteners in recent years. It is an excellent sucrose substitute with important physiological functions, such as lowering blood sugar, inhibiting carbohydrate absorption, improving gut microbiota, and preventing tooth decay. It has significant applications in diet, medicine, and health care. Whole-cell biotransformation for D-tagatose production offers advantages such as simplicity, low cost, and environmental friendliness, making it the preferred method for large-scale production.

[0003] L-arabinose isomerases can catalyze the synthesis of D-tagatose from D-galactose. However, D-galactose is expensive as a substrate and is not the preferred substrate for the industrial production of D-tagatose. Lactose is much cheaper than D-galactose, and β-galactosidase can hydrolyze lactose to obtain D-galactose and D-glucose, thus providing a direct substrate of D-galactose for the biosynthesis of D-tagatose.

[0004] Whey powder is a byproduct of dairy production and has an extremely high biochemical oxygen demand, currently leading to resource waste and environmental pollution. Whey powder typically contains 70%-80% lactose and is inexpensive; using it as a substrate to produce D-tagatose, a high-value-added product, has significant environmental and economic value.

[0005] Therefore, constructing engineered strains capable of efficiently catalyzing the biosynthesis of D-tagatose from the inexpensive substrate whey powder (lactose) and establishing a simple, efficient, and low-cost method for producing D-tagatose is of great practical significance. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention provides a method for producing D-tagatose efficiently and at low cost.

[0007] To achieve the above-mentioned objectives, the present invention employs the following technical solution: This invention provides a method for producing D-tagatose efficiently and at low cost, comprising the following steps: (1) The L-arabinose isomerase gene araA Restriction enzyme sites linked to vector plasmid pHT01 BamH I and Xba Between I and II, the recombinant plasmid pHT01- was constructed. araA ; (2) The β-galactosidase gene lacZ The recombinant plasmid pHT01- linked to step (1)araA restriction enzyme site Xba I and Sma I, to construct the recombinant plasmid pHT01- araA lacZ (3) The recombinant plasmid pHT01- araA lacZ transformed into the competent cells B. B. subtilis The final concentration of chloramphenicol in the LB solid medium was 10 μg / mL, and after being fully mixed, it was placed in a 37 °C constant temperature water bath for 45 min. Then it was placed in a 37 °C, 200 rpm shaker for 3 h. The bacterial solution was spread on the LB solid medium containing 10 μg / mL chloramphenicol, and incubated at 37 °C overnight. Finally, single colonies were picked and transferred to LB liquid medium, and chloramphenicol was added to a final concentration of 10 μg / mL, and incubated at 37 °C, 200 rpm for 12 h, to obtain a double-enzyme cascade engineering strain B. B. subtilis WB800N-pHT01- araA lacZ (4) The double-enzyme cascade engineering strain of step (3) B. subtilis WB800N-pHT01- araA lacZ was inoculated into TB medium (formula: 12 g / L peptone, 24 g / L yeast powder, 4 mL / L glycerol, 17 mM KH2PO4, 72 mM K2HPO4) containing 10 μg / mL chloramphenicol at an inoculation amount of 2%, and incubated at 37 °C, 200 rpm until the OD 600 was between 0.6 and 0.8, then IPTG was added to a final concentration of 0.2 mM, and the induction culture was continued for 24 h. The bacterial solution was centrifuged and washed with double distilled water for 2-3 times, and the bacterial cells were collected by centrifugation again. The bacterial cells were resuspended in a substrate solution containing lactose to an OD 600 = 44-51, and placed in a 54-56 °C constant temperature water bath for 11-13 h to construct a biosynthesis D-tagatose reaction system. After the reaction was completed, the supernatant was collected by centrifugation, boiled again and centrifuged, and the collected supernatant was filtered through a water-based filter with a pore size of 0.22 μm. The filtrate contained D-tagatose.

[0008] Further, the L-arabinose isomerase gene in step (1) araA has one of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID No. 1; ​​​​​​(2) a nucleotide sequence having more than 95% homology with the nucleotide sequence shown in SEQ ID No. 1 and encoding an amino acid sequence having the same function as the amino acid sequence shown in SEQ ID No. 2.

[0009] Further, the beta-galactosidase gene in the step (2) has one of the following nucleotide sequences: lacZ (1) the nucleotide sequence shown in SEQ ID No. 3; (2) a nucleotide sequence having more than 95% homology with the nucleotide sequence shown in SEQ ID No. 3 and encoding an amino acid sequence having the same function as the amino acid sequence shown in SEQ ID No. 4.

[0010] Further, the concentration of lactose in the substrate solution is 70 g / L - 500 g / L, and the pH needs to be adjusted to 8.0 by using sodium hydroxide.

[0011] Further, the substrate solution can also be prepared by dissolving whey powder or other lactose-containing raw materials.

[0012] Further, the conversion rate of D-tagatose is not less than 15%.

[0013] The present application also provides a double-enzyme cascade engineering strain, which simultaneously contains an L-arabinose isomerase gene with the nucleotide sequence shown in SEQ ID No. 1 araA and a beta-galactosidase gene with the nucleotide sequence shown in SEQ ID No. 3 lacZ .

[0014] Compared with the prior art, the present application has the following beneficial effects and advantages: The present application constructs a double-enzyme cascade engineering strain capable of catalyzing whey powder (lactose) into D-tagatose B. B. subtilis WB800N-pHT01- araA - lacZ ; the engineering strain has high substrate tolerance, and when the concentration of the substrate lactose is 500 g / L, the yield of D-tagatose reaches 77.5 g / L after 12 h of reaction, and the conversion rate is 15.5%. The present application uses a double-enzyme cascade engineering strain to construct a method for efficiently and low-cost producing D-tagatose, and the method can realize the production of high-value rare sugar D-tagatose from dairy by-product whey powder. The method is simple, efficient and low-cost, and its implementation has important significance for environmental protection, economic development and sugar production. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 ​is a recombinant plasmid pHT01 araA - lacZ Construction of spectrum (A) and SDS-PAGE analysis of recombinant protein (B); wherein 1 is B. subtilis WB800N-pHT01 whole protein; 2 is Bacillus subtilis WB800N-pHT01- araA - lacZ Whole protein.

[0016] Figure 2 is a double enzyme cascade engineering strain B. subtilis WB800N-pHT01- araA - lacZ Catalytic activity preliminary verification high performance liquid chromatogram.

[0017] Figure 3 is the trend chart of the concentration of lactose, D-glucose, D-galactose and D-tagatose with time when the concentration of lactose is 100 g / L (A), 200 g / L (B), 300 g / L (C), 400 g / L (D) and 500 g / L (E).

[0018] Figure 4 is the analysis of the concentration of lactose, D-glucose, D-galactose and D-tagatose in the reaction liquid when the whey powder is 100 g / L (the concentration of lactose is 70 g / L) and the reaction time is 12 h. DETAILED DESCRIPTION

[0019] The technical solutions of the present application will be further described in detail below in combination with the drawings and specific embodiments, but the scope of protection claimed by the present application is not limited to the scope expressed in the examples. In the following examples, the materials, reagents, etc. used are obtained from commercial channels unless otherwise specified.

[0020] The L-arabinose isomerase gene in the present application araA is derived from Lactobacillus fermentum strain CGMCC 2921, the nucleotide sequence of which is shown as SEQ ID No. 1, and the amino acid sequence of which is shown as SEQ ID No. 2; the beta-galactosidase gene lacZ is derived from Escherichia coli str. K-12, the nucleotide sequence of which is shown as SEQ ID No. 3, and the amino acid sequence of which is shown as SEQ ID No. 4.

[0021] Example 1 A method for efficiently and low-cost producing D-tagatose, the specific steps of which are as follows: (1) Double enzyme cascade engineering strain Bacillus subtilis WB800N-pHT01- araA - lacZConstruction, cultivation, and collection (a) L-arabinose isomerase gene araA The synthesis of the nucleotide sequence SEQ ID No. 1 was completed by Beijing Qingke Biotechnology Co., Ltd., yielding the recombinant plasmid pET22(b)- araA. L-arabinose isomerase gene araA Restriction enzyme sites linked to vector plasmid pHT01 BamH I and Xba Between I and II, the recombinant plasmid pHT01- was constructed. araA Using recombinant plasmid pET22(b)- araA As an L-arabinose isomerase gene araA The primers used to amplify the template are as follows: pHT01- araA -U: CGCGGATCCTATGAGAAAAATGCAGGATTATAAATTTTG (SEQ ID No. 5); pHT01- araA -D: TCCTCTAGAGGTTATTTGATGTTAATAAAATCCAC (SEQ ID No. 6).

[0022] (b) β-galactosidase gene lacZ The synthesis of the nucleotide sequence SEQ ID No. 3 was completed by Beijing Qingke Biotechnology Co., Ltd., yielding the recombinant plasmid pET28(a)- lacZ. β-galactosidase gene lacZ Linked to recombinant plasmid pHT01- araA Restriction enzyme sites Xba I and Sma Between I and II, the recombinant plasmid pHT01- was constructed. araA - lacZ The plasmid map is shown in Figure 1A. The recombinant plasmid pET28(a)- lacZ As a β-galactosidase gene lacZ The primers used to amplify the template are as follows: pHT01- lacZ -U: TATTAACATCAAATAACCTCTAGAGAAGGAGAAAATAATGACGATGATTACAGAT (SEQ ID No. 7); pHT01- lacZ -D: CATTAGGCGGGCTGCCCCGGGGACTATTTCTGGCACCACAC (SEQ ID No. 8).

[0023] (c) The recombinant plasmid pHT01- araA - lacZ was transformed into B. subtilis WB800N to a final concentration of 10 μg / mL, and after thorough mixing, it was placed in a 37 ℃ constant temperature water bath for 45 min; then it was placed in a 37 ℃, 200 rpm shaker for 3 h; next, the bacterial solution was spread on LB solid culture medium containing 10 μg / mL chloramphenicol resistance, and it was placed at 37 ℃ for stationary culture overnight; finally, single colonies were picked and transferred to LB liquid medium, and chloramphenicol was added to a final concentration of 10 μg / mL, and it was cultured at 37 ℃, 200 rpm for 12 h, and the double-enzyme cascade engineering strain B. subtilis WB800N-pHT01- araA - lacZ .

[0024] (d) The double-enzyme cascade engineering strain B. subtilis WB800N-pHT01- araA - lacZ was inoculated into TB medium containing 10 μg / mL chloramphenicol at an inoculation amount of 2%, and it was cultured at 37 ℃, 200 rpm until the OD 600 was between 0.6 and 0.8 (about 3-4 h), and then the inducer IPTG was added to a final concentration of 0.2 mM, and it was continued to be induced for 24 h; the bacterial solution was collected by centrifugation, and it was washed with double distilled water for 2-3 times, and the bacterial bodies were collected again by centrifugation.

[0025] (e) Protein expression verification of L-arabinose isomerase (LAI) and β-galactosidase (LacZ) 1 mL of the bacterial solution after induction culture was taken, the bacterial bodies were collected by centrifugation, and the bacterial bodies were resuspended with 400 μL of sterile double distilled water; the resuspended bacterial solution was placed in an ice water bath, and the bacterial bodies were broken by using an ultrasonic disrupter, breaking for 5 s and stopping for 5 s, for 5 min; after breaking, 30 μL of sample was taken for detection of total protein. In the above 30 μL sample, 6 μL of 5×Loading buffer was added, and after thorough mixing, it was denatured by using a PCR instrument at 100 ℃ for 10 min, and then SDS-PAGE protein electrophoresis was performed to detect total protein, and whether the target protein was expressed was verified.

[0026] The results of SDS-PAGE protein electrophoresis analysis are shown in Figure 1 B, compared with the control recombinant strain, L-arabinose isomerase and β-galactosidase were successfully expressed.

[0027] (2) Double enzyme cascade engineering strain B. subtilis WB800N-pHT01- araA - lacZ Preliminary verification of catalytic activity Resuspend the bacteria to OD 600 =45 with substrate solution containing 100 g / L lactose (pH 8.0) to construct the reaction system for biosynthesis of D-tagatose, and place it in a 55 ℃ constant temperature water bath for 12 h. After the reaction is completed, centrifuge to collect the supernatant, and then boil and centrifuge again. The collected supernatant is filtered through a water-based filter with a pore size of 0.22 μm, and the reaction solution is analyzed by high performance liquid chromatography (HPLC). The HPLC conditions are shown in Table 1. As shown in the results, Figure 2 D-tagatose exists in the reaction solution, proving that the double enzyme cascade engineering strain B. subtilis WB800N-pHT01- araA - lacZ has the ability to catalyze lactose to D-tagatose.

[0028] Table 1. HPLC detection conditions

[0029] Example 2 Double enzyme cascade engineering strain B. subtilis WB800N-pHT01- araA - lacZ Catalyzing lactose to produce D-tagatose Double enzyme cascade engineering strain B. subtilis WB800N-pHT01- araA - lacZ Construction, culture, and collection of (a)-(d) in step (1) of Example 1.

[0030] Wash the double enzyme cascade engineering strain B. subtilis WB800N-pHT01- araA - lacZ 2-3 times with double distilled water; resuspend the bacteria to OD 600 =45 with substrate solution containing 100 g / L lactose (adjust pH to 8.0 with sodium hydroxide), and place it in a 55 ℃ constant temperature water bath for 12 h. After the reaction is completed, centrifuge the reaction solution at 14000 rpm for 5 min to remove the bacteria. The obtained supernatant is boiled for 5 min and then centrifuged. The obtained supernatant is diluted and filtered through a water-based filter with a pore size of 0.22 μm. The reaction solution is quantitatively analyzed by high performance liquid chromatography (HPLC). The HPLC conditions are shown in Table 1.

[0031] As shown in the results, Figure 3As shown in Figure A, after 12 hours of reaction, the conversion rate of D-tagatose reached 25%.

[0032] Example 3: Two-enzyme cascade engineered strains B. subtilis WB800N-pHT01- araA - lacZ Catalytic production of D-tagatose from lactose Double enzyme cascade engineered strains B. subtilis WB800N-pHT01- araA - lacZ The construction, cultivation, and collection are the same as steps (a)-(d) in (1) of Example 1.

[0033] Washing the double-enzyme cascade engineered strain with double-distilled water B. subtilis WB800N-pHT01- araA - lacZ Resuspend the bacterial cells 2-3 times; resuspend the cells to OD using a substrate solution containing 200 g / L lactose (adjusted to pH 8.0 with sodium hydroxide). 600 The solution was prepared at 50°C and placed in a 55°C constant temperature water bath for 12 h. After the reaction, the reaction solution was centrifuged at 14000 rpm for 5 min to remove the bacterial cells. The supernatant was boiled for 5 min and then centrifuged again. The supernatant was diluted and filtered through a 0.22 μm pore size aqueous filter. The reaction solution was quantitatively analyzed by high performance liquid chromatography (HPLC). The HPLC conditions are shown in Table 1.

[0034] The results are as follows Figure 3 As shown in B, after 12 h of reaction, the conversion rate of D-tagatose reached 21%.

[0035] Example 4: Two-enzyme cascade engineered strains B. subtilis WB800N-pHT01- araA - lacZ Catalytic production of D-tagatose from lactose Double enzyme cascade engineered strains B. subtilis WB800N-pHT01- araA - lacZ The construction, cultivation, and collection are the same as steps (a)-(d) in (1) of Example 1.

[0036] Washing the double-enzyme cascade engineered strain with double-distilled water B. subtilis WB800N-pHT01- araA - lacZ Resuspend the bacterial cells 2-3 times; resuspend the cells to OD using a substrate solution containing 300 g / L lactose (adjust pH to 8.0 with sodium hydroxide). 600The solution was prepared at 50°C and placed in a 55°C constant temperature water bath for 12 h. After the reaction, the reaction solution was centrifuged at 14000 rpm for 5 min to remove the bacterial cells. The supernatant was boiled for 5 min and then centrifuged again. The supernatant was diluted and filtered through a 0.22 μm pore size aqueous filter. The reaction solution was quantitatively analyzed by high performance liquid chromatography (HPLC). The HPLC conditions are shown in Table 1.

[0037] The results are as follows Figure 3 As shown in Figure C, after 12 hours of reaction, the conversion rate of D-tagatose reached 18.6%.

[0038] Example 5: Double-enzyme cascade engineered strains B. subtilis WB800N-pHT01- araA - lacZ Catalytic production of D-tagatose from lactose Double enzyme cascade engineered strains B. subtilis WB800N-pHT01- araA - lacZ The construction, cultivation, and collection are the same as steps (a)-(d) in (1) of Example 1.

[0039] Washing the double-enzyme cascade engineered strain with double-distilled water B. subtilis WB800N-pHT01- araA - lacZ Resuspend the bacterial cells 2-3 times; resuspend the cells to OD using a substrate solution containing 400 g / L lactose (adjusted to pH 8.0 with sodium hydroxide). 600 The solution was prepared at 50°C and placed in a 55°C constant temperature water bath for 12 h. After the reaction, the reaction solution was centrifuged at 14000 rpm for 5 min to remove the bacterial cells. The supernatant was boiled for 5 min and then centrifuged again. The supernatant was diluted and filtered through a 0.22 μm pore size aqueous filter. The reaction solution was quantitatively analyzed by high performance liquid chromatography (HPLC). The HPLC conditions are shown in Table 1.

[0040] The results are as follows Figure 3 As shown in Figure D, after 12 h of reaction, the conversion rate of D-tagatose reached 17.9%.

[0041] Example 6: Engineered strains with dual enzyme cascades B. subtilis WB800N-pHT01- araA - lacZ Catalytic production of D-tagatose from lactose Double enzyme cascade engineered strains B. subtilis WB800N-pHT01- araA - lacZ The construction, cultivation, and collection are the same as steps (a)-(d) in (1) of Example 1.

[0042] Washing the double-enzyme cascade engineered strain with double-distilled water B. subtilis WB800N-pHT01- araA - lacZ Resuspend the bacterial cells 2-3 times; resuspend the cells to OD using a substrate solution containing 500 g / L lactose (adjusted to pH 8.0 with sodium hydroxide). 600 The solution was prepared at 50°C and placed in a 55°C constant temperature water bath for 12 h. After the reaction, the reaction solution was centrifuged at 14000 rpm for 5 min to remove the bacterial cells. The supernatant was boiled for 5 min and then centrifuged again. The supernatant was diluted and filtered through a 0.22 μm pore size aqueous filter. The reaction solution was quantitatively analyzed by high performance liquid chromatography (HPLC). The HPLC conditions are shown in Table 1.

[0043] The results are as follows Figure 3 As shown in E, after 12 h of reaction, the conversion rate of D-tagatose reached 15.5%.

[0044] Example 7: Two-enzyme cascade engineered strains B. subtilis WB800N-pHT01- araA - lacZ Catalytic production of D-tagatose from whey powder Double enzyme cascade engineered strains B. subtilis WB800N-pHT01- araA - lacZ The construction, cultivation, and collection are the same as steps (a)-(d) in (1) of Example 1.

[0045] (1) Preparation of substrate solution: Take 10 g of whey powder, add distilled water, stir with a magnetic stirrer, then boil in a boiling water bath, and centrifuge to remove solids; then adjust the pH of the supernatant to 8.0 with NaOH. The supernatant becomes turbid after adding NaOH, which may be due to the precipitation of protein or salt ions. Centrifuge again to collect the supernatant, and make up to 100 mL as the substrate solution for later use. HPLC quantitative analysis showed that the lactose content in the whey powder was 70%, that is, the lactose concentration in the above substrate solution was 70 g / L.

[0046] (2) Production of D-tagatose: Washing the double-enzyme cascade engineered strain with double-distilled water B. subtilis WB800N-pHT01- araA - lacZ Collect bacterial cells by centrifugation at 10,000 rpm for 5 min 2-3 times; resuspend the bacterial cells sequentially with the prepared substrate solution to OD. 600The solution was placed in a 55 ℃ constant temperature water bath for 12 h. After the reaction was completed, the reaction solution was centrifuged at 14000 rpm for 5 min to remove the bacterial cells. The supernatant was boiled for 5 min and then centrifuged again. The supernatant was diluted and filtered through a 0.22 μm pore size aqueous filter. The reaction solution was then quantitatively analyzed by high performance liquid chromatography (HPLC).

[0047] The results are as follows Figure 4 As shown, after 12 h of reaction, the concentration of D-tagatose was 17.5 g / L, and the conversion rate of D-tagatose reached 25%.

[0048] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. A method for producing D-tagatose efficiently and at low cost, characterized in that, Includes the following steps: (1) The L-arabinose isomerase gene araA The plasmid was ligated to the vector plasmid to obtain the recombinant plasmid p- araA ; (2) The β-galactosidase gene lacZ The recombinant plasmid p- attached to step (1) lacZ The recombinant plasmid p- was obtained. araA - lacZ ; (3) The recombinant plasmid p- from step (2) araA - lacZ Transformed into Bacillus subtilis, and cultured and screened to obtain a double-enzyme cascade engineered strain; (4) Cultivate the double enzyme cascade engineered strain of step (3), collect the bacterial cells by centrifugation, resuspend the bacterial cells with a substrate solution containing lactose, and react at a constant temperature. After the reaction is completed, centrifuge to collect the supernatant, filter it, and obtain the filtrate containing D-tagatose.

2. The method according to claim 1, characterized in that, The L-arabinose isomerase gene in step (1) araA It has one of the following nucleotide sequences: (1) The nucleotide sequence as shown in SEQ ID No. 1; (2) A nucleotide sequence that has more than 95% homology with the nucleotide sequence shown in SEQ ID No.1 and encodes an amino acid sequence that has the same function as the amino acid sequence shown in SEQ ID No.

2.

3. The method according to claim 1, characterized in that, The β-galactosidase gene in step (2) lacZ It has one of the following nucleotide sequences: (1) The nucleotide sequence as shown in SEQ ID No. 3; (2) A nucleotide sequence that has more than 95% homology with the nucleotide sequence shown in SEQ ID No. 3 and encodes an amino acid sequence that has the same function as the amino acid sequence shown in SEQ ID No.

4.

4. The method according to claim 1, characterized in that, The concentration of lactose in the substrate solution is 70 g / L - 500 g / L, and the pH needs to be adjusted to 8.0 using sodium hydroxide.

5. The method according to claim 4, characterized in that, The substrate solution can also be prepared by dissolving whey powder or other lactose-containing raw materials.

6. The method according to claim 1, characterized in that, In step (3), the culture temperature of the double enzyme cascade engineered strain is 36 ℃-38 ℃, and the culture speed is 180 rpm-220 rpm.

7. The method according to claim 1, characterized in that, The isothermal reaction in step (4) is at a temperature of 54℃-56℃ and a reaction time of 11 h-13 h.

8. The method according to claim 1, characterized in that, In step (4), the filtration process uses a small water filter with a pore size of 0.22µm.

9. The method according to claim 1, characterized in that, The conversion rate of the D-tagatose is not less than 15%.

10. A dual-enzyme cascade engineered strain, characterized in that, The dual-enzyme cascade engineered strain also contains the L-arabinose isomerase gene with the nucleotide sequence shown in SEQ ID No.

1. araA and the β-galactosidase gene with nucleotide sequences as shown in SEQ ID No.

3. lacZ .

Images