Application of DIRAS2 inhibitor in preparation of medicine for preventing and / or treating diseases characterized by glycolysis enhancement

Abstract

The invention relates to the field of biological medicines, and discloses application of a DIRAS2 inhibitor in preparation of a medicine for preventing and / or treating diseases characterized by glycolysis enhancement. According to the invention, RNA-seq sequencing and cell and animal model experiments are utilized to verify and explore the influence of DIRAS2 expression on glycolysis of oral precancerous lesion cells, and it is clear that cell glycolysis can be significantly inhibited by inhibiting DIRAS2, so that cells are interfered to obtain energy to maintain survival. The method can be applied to treatment of all diseases related to glycolytic phenotype change, and cell glycolysis is interfered by regulating and controlling DIRAS2 expression in a targeted manner, so that the disease treatment effect is improved. The invention provides a new target for clinically intervening oral leukoplakia progress from the perspective of targeted molecule development and reducing the morbidity of oral cancer, and has important scientific and practical significance.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and more specifically, to the use of DIRAS2 inhibitors in the preparation of medicaments for the prevention and / or treatment of diseases characterized by enhanced glycolysis. Background Technology

[0002] Oral squamous cell carcinoma (OSCC) is the most common head and neck malignancy, accounting for approximately 90% of all oral malignancies. Current data predicts that by 2040, the incidence of OSCC will increase by about 40%, and the mortality rate will also rise accordingly. [1] Oral leukoplakia (OLK) is a common and most studied oral potentially malignant disorder (OPMD), with a risk of progressing to malignancy ranging from 1% to 30%. [2] The malignant transformation rate of OLK with dysplasia is 31%-40%. [3] In response to my country's "Healthy China Initiative," early and effective intervention in oral leukoplakia, which may become malignant, has been identified as a crucial measure to reduce the incidence of oral cancer. Currently, treatment methods for OLK (oral leukoplakia) primarily involve surgical and non-surgical approaches. While surgical procedures, laser therapy, cryotherapy, and photodynamic therapy have some therapeutic effects, the recurrence rate remains high. Among non-surgical treatments, commonly used medications cannot cure OLK, and topical medications have minimal efficacy. Therefore, effective intervention targeting specific markers associated with the pathogenesis of oral leukoplakia to support clinical treatment is of significant practical importance.

[0003] Glucose is the energy source for cells and the basis for the synthesis of many essential biomolecules. In normally differentiated cells, under aerobic conditions, glucose is mainly produced through oxidative phosphorylation, generating ATP via the tricarboxylic acid cycle and producing a small amount of pyruvate. Under anaerobic conditions, glucose is mainly produced through glycolysis, generating a large amount of pyruvate and a relatively small amount of ATP. However, to meet the energy demands of rapid growth, tumor cells tend to rely on glycolysis for energy, a phenomenon known as the Warburg effect or aerobic glycolysis. [4] Metabolomics analysis of OSCC and surrounding normal tissues revealed increased glucose consumption and lactate production in OSCC tissues, indicating the presence of the Warburg effect in OSCC as well. [5] A metabolomics analysis of precancerous lesions revealed increased pyruvate levels in oral precancerous cells and increased glucose uptake and lactate production in cervical precancerous lesions. These findings provide strong evidence for the presence of the Warburg effect in precancerous tissues as well. [6].

[0004] The pathogenesis of OLK / OSCC is complex, and there is an urgent need to address the issues of early and accurate diagnosis and improved treatment outcomes. The altered glucose metabolism phenotype in OLK / OSCC tissues offers a breakthrough for overcoming this challenge. Based on enhanced glycolysis and increased glucose uptake in tumor tissues, 18F-fluorodeoxyglucose-positron emission tomography (FDG-PET) has been widely used for staging and follow-up of various tumors, showing good detection results for lymph node metastasis and distant metastasis. It can serve as a supplement to MRI / enhanced CT for diagnosing bone infiltration caused by OSCC. [7] Furthermore, enhanced glycolysis is observed in OSCC cells resistant to the chemotherapeutic drug cisplatin, a phenotype that provides a novel target for chemosensitizing OSCC cells. [8,9] Therefore, targeted intervention in glycolysis holds promise as an effective strategy for disease treatment.

[0005] DIRAS2 belongs to the Ras family of small G proteins and shares 60% homology with RAS and RAP. It exhibits low GTPase activity and plays a regulatory role in cell cycle, proliferation, autophagy, and related signal transduction. Initially identified as being associated with ADHD and attention deficit disorder in neurological disorders, recent studies have shown that DIRAS2 also plays a crucial role in various solid tumors, including ovarian cancer, colorectal cancer, and cutaneous melanoma. Furthermore, the expression and function of DIRAS2 exhibit tissue- and tumor-specific characteristics. [10-12] . Summary of the Invention

[0006] The purpose of this invention is to provide the use of DIRAS2 inhibitors in the preparation of medicaments for the prevention and / or treatment of diseases characterized by enhanced glycolysis.

[0007] Studies have found that DIRAS2 expression in OLK tissues from clinical patients is significantly higher than in normal oral mucosa tissues. Furthermore, during the progression from normal mucosa and simple epithelial hyperplasia to leukoplakia with abnormal epithelial hyperplasia, DIRAS2 expression gradually increases with enhanced abnormal cell proliferation. In a 4NQO (4-nitroquinoline-1-oxide)-induced mouse model of precancerous lesions of the tongue, conditional knockout of DIRAS2 inhibited the proliferation of precancerous lesion cells. This suggests that DIRAS2 may be a novel target for intervening in the progression of precancerous lesions, but its mechanism of action remains unclear.

[0008] To investigate the role of DIRAS2 in oral precancerous lesions, this invention performed whole transcriptome sequencing on DOK cells with stable DIRAS2 knockdown and control cells to screen for differentially expressed genes. Bioinformatics analysis revealed that DIRAS2 is closely related to metabolic signaling pathways and glycolysis. These sequencing results were validated in in vitro cell experiments and in an oral leukoplakia model established using DIRAS2 knockout mice. In DOK and Leuk1 cells with stable DIRAS2 knockdown, the mRNA and protein expression levels of the rate-limiting glycolysis enzymes enolase 2 (ENO2), pyruvate kinase M2 (PKM2), and hexokinase 2 (HK2) were significantly reduced, along with decreased cellular glucose uptake and intracellular lactate levels. Epithelial DIRAS2 knockout also inhibited the protein expression of ENO2, PKM2, and HK2 in mouse oral leukoplakia tissue. The findings suggest that targeting and interfering with DIRAS2 expression inhibits glycolysis in oral precancerous lesions. These results further elucidate the mechanisms underlying the development and progression of oral precancerous lesions, provide a scientific basis for evaluating the adjuvant treatment of diseases by targeting DIRAS2 to interfere with cellular glycolysis, and offer important references and research ideas for the design and implementation of targeted intervention strategies based on this principle.

[0009] In order to achieve the objectives of the present invention, in a first aspect, the present invention provides the use of DIRAS2 inhibitors in the preparation of medicaments for the prevention and / or treatment of diseases characterized by enhanced glycolysis.

[0010] The reference sequence number of the human DIRAS2 gene in NCBI is NM_017594.5, and the reference sequence number of the mouse DIRAS2 gene in NCBI is NM_001024474.2.

[0011] Furthermore, the disease is a tumor or precancerous lesion.

[0012] Preferably, the precancerous lesion is oral leukoplakia, and the tumor is oral squamous cell carcinoma.

[0013] Furthermore, the drug inhibits glycolysis by downregulating the expression and / or activity of at least one rate-limiting glycolysis enzyme in cells.

[0014] The rate-limiting enzyme for glycolysis is selected from at least one of autologous glycokinase 2 (HK2), pyruvate kinase M2 subtype (PKM2), and enolase 2 (ENO2).

[0015] Furthermore, the drug inhibits glycolysis by reducing the cell's ability to take up glucose and / or produce lactate.

[0016] Furthermore, the inhibitor is a substance capable of inhibiting the expression level of the DIRAS2 gene or the activity of the DIRAS2 protein at the transcriptional or translational level.

[0017] The inhibitor may be selected from at least one of shRNA, siRNA, dsRNA, miRNA, cDNA, antisense RNA / DNA, low molecular weight compounds, peptides, antibodies, gene targeting vectors, or CRISPR-Cas systems.

[0018] In one specific embodiment of the present invention, the inhibitor is shRNA with the sequence 5'-GCUCAAGCCCAUCUACGAACA-3' (SEQ ID NO:1).

[0019] In a second aspect, the present invention provides a composition comprising a DIRAS2 gene inhibitor.

[0020] Furthermore, the composition further includes one or more pharmaceutically acceptable excipients, carriers, and / or solvents.

[0021] Thirdly, the present invention provides a method for screening candidate drugs for the prevention and / or treatment of diseases characterized by enhanced glycolysis, comprising the following steps: (1) Contact the cells expressing DIRAS2 or the DIRAS2 protein with the candidate drug to be tested; (2) To detect the effect of the candidate drug on the expression level of the DIRAS2 gene or the activity of the DIRAS2 protein; (3) Screen out candidate drugs that can reduce DIRAS2 gene expression level or inhibit DIRAS2 protein activity.

[0022] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects: This invention utilizes RNA-seq sequencing and cell and animal model experiments to investigate the effect of DIRAS2 expression on glycolysis in oral precancerous lesions. It clearly demonstrates that inhibiting DIRAS2 significantly suppresses cellular glycolysis, thereby interfering with cellular energy acquisition for survival. This invention can be applied to the treatment of all diseases involving altered glycolytic phenotypes by targeting and regulating DIRAS2 expression to interfere with cellular glycolysis, thereby improving treatment outcomes.

[0023] (I) Studies have found that the expression level of DIRAS2 is a factor highly associated with the progression of oral leukoplakia, and DIRAS2 is expected to become a new target for intervening in the progression of precancerous lesions. This invention obtains differentially expressed genes in DIRAS2-stable knockdown DOK cells through RNA-seq sequencing of cell models, and then performs GO, KEGG, and DO enrichment analysis on the differentially expressed genes to determine the pathogenic mechanisms related to DIRAS2. Among them, energy metabolism pathways, especially glycolysis, are closely related to DIRAS2, and the prediction results are highly reliable and efficient.

[0024] (ii) Glycolysis is a necessary process for glucose decomposition and metabolism in organisms. Tumor cells rely mainly on glycolysis to provide energy in order to meet their rapidly growing energy demands. Studies have shown that there are changes in glucose metabolism phenotypes in a variety of diseases, including OLK / OSCC. This provides a breakthrough for clinical search for new strategies to improve diagnostic efficiency and treatment effects.

[0025] (III) Based on sequencing and bioinformatics analysis results, this invention targets the close relationship between changes in glucose metabolism phenotype and DIRAS2 expression in diseases. Related experiments were conducted in cell and animal models to verify that inhibiting DIRAS2 expression can significantly inhibit cellular glycolysis, thereby preventing the occurrence and development of oral leukoplakia. This provides a new target for clinical intervention in the progression of oral leukoplakia and reducing the incidence of oral cancer from the perspective of developing targeted molecules, which has important scientific and practical significance. Attached Figure Description

[0026] Figure 1 In a preferred embodiment of the present invention, the interference effect of each candidate shRNA on DIRAS2 expression in DOK cells was detected (qRT-PCR and Western Blotting).

[0027] Figure 2 This invention provides a preferred embodiment for RNA-seq detection of differentially regulated genes. A. A heatmap illustrates the relationships and differences between samples. Light gray represents downregulated genes, and dark gray represents upregulated genes. The horizontal axis represents the fold change (FC) of gene differences, and the vertical axis represents the significance of gene differences (-Log10 P-value). B. Statistical analysis of the number of upregulated and downregulated genes in four different DOK cell samples.

[0028] Figure 3 This is a GO pathway enrichment analysis of differentially expressed genes present in each group in a preferred embodiment of the present invention.

[0029] The bar chart and scatter plot show the top 20 entries enriched in the GO pathway, respectively.

[0030] Figure 4This is a KEGG pathway enrichment analysis of differentially expressed genes present in each group in a preferred embodiment of the present invention.

[0031] The bar chart and scatter plot show the top 20 entries enriched in the KEGG pathway, respectively.

[0032] Figure 5 This is a DO enrichment analysis of differentially expressed genes present in each group in a preferred embodiment of the present invention.

[0033] The bar chart and scatter plot show the top 20 entries of the differentially expressed genes in the DO enrichment analysis.

[0034] Figure 6 In a preferred embodiment of the present invention, Western blotting was used to detect the protein level of the rate-limiting enzyme in glycolysis.

[0035] Figure 7 In a preferred embodiment of the present invention, qRT-PCR was used to detect the mRNA levels of the rate-limiting glycolysis enzymes ENO2, PKM2, and HK2.

[0036] Figure 8 This is a preferred embodiment of the present invention for detecting cellular glucose uptake capacity.

[0037] Figure 9 This invention relates to the detection of intracellular lactate content in a preferred embodiment of the present invention.

[0038] Figure 10 In a preferred embodiment of the present invention, immunohistochemical detection was performed on the expression of ENO2, PKM2, and HK2 proteins (200×) in oral leukoplakia tissue of mice. Detailed Implementation

[0039] Glycolysis is an essential process in the metabolism of glucose in living organisms. Tumor cells, to meet their rapidly increasing energy demands, tend to rely on glycolysis for energy, a process known as the Warburg effect or aerobic glycolysis. The pathogenesis of oral squamous cell carcinoma (OLK) / oral leukoplakia (OSCC) is complex, and early diagnosis and improved treatment outcomes are urgent problems to be solved. Studies have found alterations in glucose metabolism phenotypes in both OLK and OSCC, providing a breakthrough for overcoming this challenge. Effective intervention targeting glycolysis offers new insights for the intervention, diagnosis, and clinical treatment of oral squamous cell carcinoma and oral leukoplakia.

[0040] The small G protein DIRAS2 plays an important role in regulating cell cycle, proliferation, autophagy, and related signal transduction in various solid tumors. DIRAS2 expression in OLK tissues from clinical patients is significantly higher than in normal oral mucosa tissues, and its expression gradually increases with enhanced abnormal cell proliferation and disease progression. Conditional knockout of DIRAS2 in epithelial tissue can inhibit the proliferation of precancerous lesions of the mouse tongue. DIRAS2 holds promise as a new target for intervening in the progression of precancerous lesions, but its mechanism of action remains unclear, and no studies related to glycolysis have been reported.

[0041] Transcriptome sequencing (RNA-Seq, RNA sequencing) is a technique that uses high-throughput sequencing technology to sequence all transcripts (including mRNA, non-coding RNA, etc.) in an organism. Transcriptome sequencing can quantitatively detect gene expression, discover new transcripts, analyze gene structural variations, and identify gene expression regulatory networks, making it an important tool for revealing gene function and regulatory mechanisms. Using transcriptome sequencing to screen differentially expressed genes in DIRAS2-stable knockdown DOK cells (oral precancerous lesions) compared to control cells, and then using bioinformatics analysis to determine the pathogenic mechanisms related to DIRAS2, the predictive results are highly reliable and efficient. While it cannot completely replace experimental research, it can serve as a supplementary tool, helping researchers quickly screen and determine research directions at an early stage.

[0042] This invention, for the first time, utilizes RNA-seq high-throughput sequencing to screen differentially expressed genes after stable knockdown of DIRAS2 in oral precancerous lesions, preliminarily revealing the pathogenic mechanism related to DIRAS2. Based on this, targeting the disease characteristics of altered glucose metabolism phenotypes, cell and animal models were used to verify the close relationship between DIRAS2 expression and glycolytic phenotype. Interference with DIRAS2 expression inhibits cellular glycolysis, manifested as decreased expression of rate-limiting enzymes enolase 2 (ENO2), pyruvate kinase M2 (PKM2), and hexokinase 2 (HK2), as well as significantly reduced cellular glucose uptake and intracellular lactate levels. Our findings fill a research gap in this field, and this study is closely aligned with clinical practice. From the perspective of targeted molecule development, using DIRAS2 as a target to regulate glycolysis explores new strategies for disease intervention, laying a solid foundation for subsequent clinical translation.

[0043] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0044] The example demonstrates the application of targeting DIRAS2 to inhibit glycolysis based on transcriptome sequencing results in order to improve related diseases. I. Experimental Methods 1. shDIRAS2 sequence optimization experiment to construct DIRAS2 stably knocked-down DOK cells Shanghai Jiman Biotechnology Co., Ltd. was commissioned to synthesize DIRAS2 shRNA plasmids and package them to obtain the corresponding lentiviruses. The three candidate shRNA sequences were (1) 5'- GCUCAAGCCCAUCUACGAACA -3', (2) 5'- CUCAGCCAAGCUCAACCAUAA -3', and (3) 5'- GCCUGAGCAGAGUAACGAUUA -3'. The negative control sequence was 5'- UUCUCCGAACGUGUCACGU -3'. Logarithmic growth phase DOK cells were seeded in 6-well plates at a density of 2 × 10⁻⁶ cells / well. 5 DOK cells were infected with blank control shRNA and three types of DIRAS2 shRNA lentiviruses when cell fusion reached 50% of the well bottom area. At the same time, 10 μg / mL polybrene was added to infect DOK cells for 24 h. After 2 weeks of selection with 1.5 μg / mL puromycin, DOK cells with stable DIRAS2 knockdown were obtained. The knockdown efficiency of DIRAS2 was verified by qRT-PCR and Western blotting.

[0045] 2. RNA-seq high-throughput sequencing and analysis (1) Sample preparation: Control DOK cells and DOK cells stably knocked down by DIRAS2 (i.e., DOK cells transfected with shRNA(1)) were seeded and cultured for 12 h in 5% CO2, 37℃ incubators and 3% O2, 5% CO2, 92% N2, 37℃ hypoxic incubators, respectively. The groups were as follows: normoxic control group (NC-N), normoxic DIRAS2 knockdown group (shDIRAS2-N), hypoxic control group (NC-H), and hypoxic DIRAS2 knockdown group (shDIRAS2-H). The DMEM high-glucose cell culture medium was discarded, and the cells were gently washed 3 times with PBS. Total RNA was extracted from DOK cells using Trizol reagent, and the concentration and purity of total RNA were controlled by NamoDrop ND-1000. Sequencing analysis was performed by the RNA-seq platform of Lianchuan Biotechnology Co., Ltd. Three samples were repeated for each group, for a total of 12 samples.

[0046] (2) Data alignment: Filter according to Cutadapt to obtain high-quality sequencing data, align with Hisat2 reference genome, use StringTie to reconstruct transcripts and calculate the expression level of all genes in each sample, and perform gene expression quantification, gene differential analysis, Gene Ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment analysis, etc.

[0047] (3) Gene expression level analysis: Gene expression levels of protein-coding genes (mRNA) annotated by the genome were statistically analyzed. The FPKM value was used to measure the differentially expressed genes knocked down by DIRAS2 and clustered them to count the expression level of differentially expressed genes in each group. The threshold criteria were set as follows: fold change ≥ 2 or FC ≤ 0.5 (i.e., the absolute value of log2FC ≥ 1) and q < 0.05 (|log2fc| ≥ 1 & q < 0.05) (for comparisons of multiple groups with no fold change, genes with q < 0.05 were selected to identify differentially expressed genes).

[0048] (4) GO, KEGG, and DO enrichment analysis of differentially expressed genes: 1) GO enrichment analysis GO terms were divided into three non-overlapping ontology categories: molecular function (MF), biological process (BP), and cellular component (CC), facilitating the analysis of the main functions of differentially expressed mRNAs. Statistical analysis employed a two-tailed Fisher's exact test, with Benjamini-Hochberg correction for multiple tests (FDR used to adjust the p-value for multiple comparisons), and a threshold of p < 0.01.

[0049] 2) KEGG enrichment analysis In the KEGG enrichment analysis, a two-sided Fisher's exact test was used, and the Benjamini-Hochberg multiple test correction method (FDR was used to adjust the p-value for multiple comparisons) was employed, with the threshold set to p-value < 0.05.

[0050] 3) Disease ontology (DO) enrichment analysis DO enrichment analysis was performed on a per-DO-item basis, using hypergeometric tests to identify items that were significantly enriched in differentially expressed genes compared to the overall genomic background.

[0051] 2. Quantitative Real-time PCR (qRT-PCR) (1) RNA extraction 1) Add 1 mL of Trizol to each dish of cells for lysis and lyse on ice for 15 min.

[0052] 2) Collect cell lysates, aspirate the lysate into EP tubes, add 200 μL of chloroform to each tube, invert to mix, react at room temperature for 10 min, and centrifuge at 12000 rpm and 4℃ for 15 min.

[0053] 3) Transfer 400 μL of the supernatant to a new EP tube, add 400 μL of isopropanol, vortex to mix, and incubate at room temperature for 10 min. Centrifuge at 12000 rpm and 4℃ for 10 min.

[0054] 4) Discard the supernatant, retaining the white precipitate at the bottom of the tube. Add 1 mL of DEPC water and freshly prepared 75% ethanol (anhydrous ethanol) to wash the precipitate. Centrifuge at 12000 rpm and 4℃ for 5 min.

[0055] 5) Discard the supernatant, air dry at room temperature, and dissolve in 30-100 μL of DEPC water.

[0056] 6) Take 1 μL of RNA solution and measure the RNA concentration and A260 / 280 value using a spectrophotometer.

[0057] (2) Genomic DNA removal reaction 1) The following reaction system was prepared on ice.

[0058] 2) Mix the mixture using a vortex mixer and then briefly centrifuge.

[0059] 3) Incubate at room temperature for 30 min, then briefly centrifuge and cool on ice.

[0060] (3) Reverse transcription reaction 1) Prepare the reaction system on ice, mix well, and centrifuge briefly.

[0061] The reverse transcription reaction system is as follows: 2) Take 10 μL of the mixed system and add it to the reaction tube of step 1.

[0062] 3) Incubate at 37℃ for 15 min, then at 85℃ for 5 s; after the reaction is complete, briefly centrifuge and store in a -20℃ refrigerator.

[0063] (4) qRT-PCR 1) Synthesize the target gene according to the primer sequence of the target gene and prepare the reaction system.

[0064] The primer sequences (5'-3') for the target gene are as follows:

[0065] The qRT-PCR reaction system is as follows (total volume 20 μL): 2) Amplification reaction conditions: pre-denaturation at 95℃ for 10 min, denaturation at 95℃ for 15 s, annealing at 60℃ for 1 min, for a total of 40 cycles. Melting curve analysis: 95℃ for 15 s, 60℃ for 1 min, 95℃ for 15 s, 60℃ for 15 s.

[0066] 3) Statistical results of relative quantitative methods, calculate 2 -△△Ct value.

[0067] 3. Western blotting (1) Extraction of total cell protein: Discard the culture medium, wash three times with PBS, and prepare fresh protein lysis buffer according to the volume ratio of radioimmunoprecipitation lysis buffer (RIPA): benzyl sulfonyl fluoride (PMSF): protease inhibitor (PIC) = 100: 1: 1. Add 30-100 μL of lysis buffer to each dish, lyse on ice for 15 min, collect the lysed cell debris into EP tubes, vortex, centrifuge at 14000 rpm for 20 min, and aspirate the supernatant into a new EP tube.

[0068] (2) Measurement of cell protein concentration: 1) Freshly prepared Coomassie brilliant blue staining working solution.

[0069] 2) Plot the protein concentration standard curve.

[0070] 3) In a 96-well plate, add 200 μL of 1×Coomassie Brilliant Blue working solution and 1 μL of the protein solution to be tested to each well. Set up 3 replicates per group and 1 blank control group.

[0071] 4) Measure the absorbance (OD value) at a wavelength of 595 nm using an ELISA reader.

[0072] 5) Calculate the concentration of the protein to be tested according to the standard curve equation.

[0073] (3) Cell protein denaturation Prepare the reaction system by adding 1×PBS to complete the reaction at a total protein content of 20 μg / μL for denatured cell protein, and 5×Loading buffer. Seal the prepared EP tubes, centrifuge briefly, heat in a 100°C water bath for 5 min, let stand to room temperature, and store in a -20°C freezer.

[0074] (4) Protein loading Prepare electrophoresis gels of different concentrations as needed, add freshly prepared 1× electrophoresis buffer, remove the comb, add an appropriate amount of the protein sample to be tested to each well, add 8 μL of marker to the wells on both sides of each sample group, and add 1× loading buffer to the empty wells.

[0075] (5) Electrophoresis and membrane transfer (semi-dry transfer) 1) Set the electrophoresis tank to a constant voltage of 80 V for 30 min, then switch to 120 V for 1 h. When the bromophenol blue electrophoresis reaches the appropriate position, turn off the power.

[0076] 2) Carefully pry open the short plate of the electrophoresis gel and remove the excess electrophoresis gel.

[0077] 3) Activate the PVDF membrane by soaking it in methanol, and then wet the filter paper in the freshly prepared electroporation solution.

[0078] 4) Lay the wet filter paper, electrophoresis gel, PVDF membrane, and wet filter paper back onto the transfer plate in the order of top to bottom. Maintain a constant current of 2.5 mA and transfer the membrane for 5-12 minutes.

[0079] 5) Wash the transferred PVDF membrane in TBST for 5 min each time, 3 times.

[0080] (6) Closed Skim milk powder was mixed with 1×TBST to prepare 5% sealed milk. A PVDF membrane was placed in the sealed milk and shaken at room temperature for 1 h. The mixture was washed with 1×TBST for 10 min each time, for a total of 3 times.

[0081] (7) Primary antibody incubation Antibody concentrations: anti-ENO2 (1:5000, Proteintech), anti-HK2 (1:5000, Proteintech), anti-PKM2 (1:10000, Proteintech), anti-DIRAS2 (1:3000, Origene), anti-β-actin (1:80000, ABclonal). Immerse the PVDF membrane in the antibody incubation chamber and incubate overnight at 4°C on a shaker.

[0082] (8) Secondary antibody incubation The next day, the primary antibody was recovered, washed three times with 1×TBST for 10 min each time, and then incubated with the secondary antibody. Secondary antibody concentrations: HRP-labeled goat anti-rabbit IgG (H+L, heavy and light chains) (1:10000, ABclonal), HRP-labeled goat anti-mouse IgG (H+L) (1:5000, ABclonal). Incubation was performed at room temperature on a shaker for 2 h.

[0083] (9) Development Recover the secondary antibody, wash 3 times with 1×TBST, 10 min each time. Gently wipe the PVDF membrane dry, add an appropriate amount of ECL developer, and develop using the appropriate exposure time.

[0084] (10) Data statistics Using ImageJ software, select the corresponding strip, unify the background grayscale value, and read the grayscale values ​​of each group.

[0085] 4. Glucose intake The experiment used the Beyotime glucose uptake assay kit (DTNB method). Experimental steps: (1) When the cell confluence reaches 80%, wash the cells twice with PBS, add 100 μL of serum-free low-glucose / glucose-free medium to each well, and continue culturing for 4 h.

[0086] (2) Wash the cells three times with PBS, add 100 μL of KRPH Buffer to each well, and incubate at 37°C for 40 min.

[0087] (3) To exclude endogenous G6P, GSH, and NADP + To minimize interference, a background control group and an experimental group were set up. Each experimental group cell was prepared in triplicate, and 10 μL of 2-DG (10 mM) was added to each well, followed by incubation for 20 min. No 2-DG was added to the background control group.

[0088] (4) Wash the cells three times with PBS, add 100 μL of Glucose Uptake Lysis Buffer to each well, pipette appropriately, and place on ice for 5 minutes to fully lyse the cells.

[0089] (5) Take the lysis buffer, centrifuge at 14000g for 5 min at 4℃, and take the supernatant.

[0090] (6) Set up 2-DG6P standard curve: Dilute 1 mM 2-DG6P standard to 4 μM concentration with Glucose Assay Buffer, and add 0, 1.25, 2.5, 5, 10, 15, 20 and 25 μL to 96-well plate, and make up to 25 μL with Glucose Assay Buffer.

[0091] (7) Conduct a preliminary experiment to determine the sample dilution factor, and add 25 μL of sample to a 96-well plate.

[0092] (8) Prepare the Reaction Mix and Recycling Mix working solutions according to the instructions. Add 20 μL of Reaction Mix working solution to each well, mix well, and incubate at 37°C in the dark for 60 min.

[0093] (9) Add 5 μL of Stop Buffer to each well and mix well. Incubate at 70°C in the dark for 60 min. Add 5 μL of GR Buffer to each well and mix well. Add 25 μL of Reaction Mix working solution to each well and mix well. Add 20 μL of DTNB working solution to each well and mix well.

[0094] (10) React at 37℃ for 30-60 min, and measure OD every 5 min using an ELISA reader. 412nm The value is maintained until the signal value of the highest concentration standard well reaches 2.0.

[0095] (11) Establish a standard curve and calculate the concentration of 2-DG6P in the sample to reflect the glucose uptake level of the sample.

[0096] 5. Detection of intracellular lactate content The experiment used the Nanjing Jiancheng L-lactic acid content determination kit (enzymatic microplate method), and the experimental steps are as follows: (1) When the cell confluence reaches 80%, trypsin digestion is performed, and 3 dishes of each cell type are collected into 15 mL centrifuge tubes; centrifuge at 1100 rpm for 6 min, remove the culture medium, add 1 mL PBS to wash, centrifuge at 1100 rpm for 6 min, remove the supernatant, and repeat twice.

[0097] (2) Add 100 μL of PBS to every 1 million cells, mix by pipetting, and transfer the cell suspension to a 1.5 mL EP tube; sonicate the cells with the following parameters: power 20% or 200W, run for 5 seconds, interval 15 seconds, repeat 5-10 times, centrifuge at 12000 rpm for 10 min, and take the supernatant for testing.

[0098] (3) Bradford determined the protein concentration, consistent with the Western blot method; (4) Take a 96-well plate, add 2.5 μL of the sample to be tested, 2.5 μL of the standard, and 2.5 μL of distilled water to each well, then add 180 μL of reagent one, gently shake to mix, incubate at 37℃ for 1-3 min, and use an enzyme-linked immunosorbent assay (ELISA) reader to measure the OD value (A1) at 546 nm. (5) Add 60 μL of reagent II to each well, gently shake to mix, react at 37℃ for 5-10 min, and measure the OD value (A2) at 546 nm using an ELISA reader. The calculation formula is as follows (based on protein concentration): Where C standard = 3 mmol / L, and Cpr is the concentration of homogenate protein.

[0099] The experiment was repeated 3 times.

[0100] 6. Shanghai Southern Model Biotechnology Co., Ltd. was commissioned to construct C57BL / 6J-Diras2 em1 (flox) Smoc F1 generation CKO and KO mice. The F1 generation mice (DIRAS2) flox / + DIRAS2 gene-flox homozygous mice were obtained by mating DIRAS2 heterozygous mice with flox heterozygous mice. flox / flox ), heterozygous mice (DIRAS2) flox / + ) and wild-type mice. DIRAS2 gene flux homozygous mice (DIRAS2 flox / flox ) were mated with Cre mice to obtain flux homozygous and Cre positive mice (DIRAS2) flox / flox: Cre+ ), flox heterozygous and Cre negative mice (DIRAS2) flox / + ) and flux heterozygous and Cre positive mice (DIRAS2) flox / +: Cre+ The resulting flux-heterozygous and Cre-positive mice (DIRAS2) flox / +: Cre+ ) and flux homozygous mice (DIRAS2) flox / flox Mice were mated to obtain the experimental group mice (DIRAS2) that were homozygous for flux and positive for Cre. flox / flox: Cre+ ) and flux homozygous and Cre-negative control mice (DIRAS2) flox / flox ) DIRAS2 induced by 4NQO flox / flox and DIRAS2 conditional knockout mice (DIRAS2 flox / flox: Cre+ A mouse oral leukoplakia model was constructed. The experimental groups were as follows: DIRAS2 flox / floxTen mice were used as the control group, and DIRAS2 mice were treated with 4NQO. flox / flox Group 16 mice, DIRAS2 flox / flox: Cre+ The control group consisted of 16 mice, and DIRAS2 mice were treated with 4NQO. flox / flox: Cre+ Sixteen mice were used in the group. The control group mice were fed with distilled water for 24 weeks, while the 4NQO treatment group mice were fed with 50 μg / mL 4NQO aqueous solution for 16 weeks, then switched to distilled water and continued to be fed until 24 weeks. At the end of the observation period, the tongue tissue of the mice was taken.

[0101] 7. Immunohistochemistry (IHC) staining (1) Bake the slides at 65℃ for 1-2 h. Dewax and rehydrate, dewax with xylene 3 times, 10 min each time. Soak in anhydrous ethanol for 5 min, 95% ethanol for 5 min, 75% ethanol for 5 min; soak in tap water for 1 min, soak in distilled water for 1 min to remove residual dewaxing agent and water-soluble dye. Rinse with PBS 3 times, 5 min each time.

[0102] (2) Place the slices in the prepared citrate antigen retrieval solution (pH=6.0) or EDTA retrieval solution (pH=9.0), heat in a microwave oven to retrieve antigen (medium-high heat for 4 min, medium heat for 3 min, medium heat for 3 min), cool at room temperature, and rinse 3 times with PBS for 5 min each time.

[0103] (3) Add an appropriate amount of 3% hydrogen peroxide solution, incubate at room temperature in the dark for 15 min to remove endogenous catalase, and rinse with PBS 3 times, 5 min each time.

[0104] (4) Remove excess liquid from the slide, add an appropriate amount of 10% goat serum, and block at room temperature in the dark for 30 min.

[0105] (5) Aspirate the goat serum from the tissue section and add an appropriate amount of primary antibody directly. The concentrations are: anti-ENO2 (1:5000, Proteintech), anti-HK2 (1:250, Proteintech), and anti-PKM2 (1:500, Proteintech). Incubate overnight at 4°C in the dark.

[0106] (6) The next day, the primary antibody was aspirated from the slide, and an appropriate amount of universal goat anti-rabbit / mouse IgG was added. After incubation at 37°C in the dark for 30 min, the slide was washed with PBS 3 times, 5 min each time.

[0107] (7) Aspirate excess liquid around the tissue on the slide, prepare fresh DAB working solution according to the instructions, and add 20-50 μL of DAB working solution per tissue surface for color development.

[0108] (8) Add hematoxylin staining solution for counterstaining, and rinse with tap water.

[0109] (9) Place the sections in 95% ethanol twice, 2 min each time; place them in anhydrous ethanol twice, 5 min each time, to fix and stain them; place the sections in xylene three times, 10 min each time; mount them with neutral resin and air dry them in a ventilated place.

[0110] (10) Under high magnification, five fields of view were randomly selected from each slice for image acquisition. Image Pro Plus software was used to quantitatively analyze the optical density intensity and calculate the positive cell rate in the tongue epithelial tissue.

[0111] II. Experimental Results 1. Total RNA and total protein were extracted from DOK cells stably infected with three lentiviruses. The expression levels of DIRAS2 mRNA and protein were detected by qRT-PCR and Western blotting, respectively. Figure 1 The results showed that only shRNA(1) transfection significantly reduced both DIRAS2 mRNA and protein expression, while shRNA(2) and shRNA(3) had no significant effect on DIRAS2 expression. The final determined DIRAS2 shRNA sequence was 5'-GCUCAAGCCCAUCUACGAACA-3'.

[0112] 2. Using RNA-seq technology combined with bioinformatics analysis, differential gene screening was performed on DOK cells in normoxic and hypoxic induced control groups and DIRAS2 knockdown groups.

[0113] like Figure 2 As shown, compared with the normoxic control group (NC-N), the normoxic DIRAS2 knockdown group (shDIRAS2-N), the hypoxia control group (NC-H), and the hypoxia DIRAS2 knockdown group (shDIRAS2-H) all contained a large number of hypoxia and DIRAS2-related differentially expressed genes. Specifically, compared with NC-N, the shDIRAS2-N group had 44 upregulated genes and 15 downregulated genes, the NC-H group had 220 upregulated genes and 54 downregulated genes, and the shDIRAS2-H group had 440 upregulated genes and 94 downregulated genes. Compared with the NC-H group, the shDIRAS2-H group had 50 upregulated genes and 24 downregulated genes.

[0114] 3. Enrichment analysis of GO, KEGG and DO differentially expressed genes in DIRAS2-stable knockdown DOK cells.

[0115] For differentially expressed genes, we performed pathway enrichment analysis on gene expression in the four groups using the GO and KEGG databases. The GO and KEGG enrichment analysis results for the shDIRAS2-N and NC-N groups showed that the differentially expressed genes were mainly related to biological processes such as energy metabolism, immune system response, and cell proliferation regulation, including interactions between cell signaling factors and the JAK-STAT, TGF-beta, and HIF-1 signaling pathways. The differentially expressed genes between the shDIRAS2-H and NC-H groups were mainly related to biological processes such as apoptosis, ferroptosis, Gap binding, and autophagy, with pathway enrichment in the Rap1, MAPK, PI3K-AKT, and HIF-1 signaling pathways and signaling factor receptor interactions.

[0116] GO and KEGG enrichment analyses of the NC-H and NC-N groups showed that differentially expressed genes are involved in biological processes such as signal transduction, hypoxia response, and proliferation, and are enriched in signaling pathways such as p53, MAPK, HIF-1, and PI3K-AKT. Differentially expressed genes between the shDIRAS2-H and shDIRAS2-N groups are mainly involved in signal transduction, proliferation, apoptosis, necrosis, and autophagy, regulating the MAPK, p53, PI3K-AKT, HIF-1, and Rap1 signaling pathways.

[0117] GO analysis was performed on the four groups of overlapping differentially expressed genes, and the top 20 items were enriched by clustering according to BP, MF, and CC. BP was mainly enriched in regulation of hypoxia response, glycolysis, cell population proliferation, and angiogenesis; MF was mainly enriched in protein binding, oxidoreductase activity, enzyme activity, and binding of similar proteins; and CC was mainly enriched in the extracellular space, cytoplasm, and exosomes. Figure 3 ).

[0118] KEGG pathway enrichment analysis showed that the four overlapping differentially expressed genes were mainly associated with signaling pathways such as HIF-1, glycolysis, energy metabolism, p53, MAPK, and PI3K-AKT. Figure 4 The results suggest that differentially expressed genes in DOK cells with hypoxia-induced DIRAS2 knockdown primarily activate signaling pathways such as HIF-1, MAPK, and energy metabolism.

[0119] The differential gene enrichment analysis results showed that differentially expressed genes were mainly enriched in cancer, cardiovascular system and nervous system diseases. Figure 5 ).

[0120] 4. Cell model validation: DIRAS2 knockdown inhibits glycolysis in DOK and Leuk1 cells.

[0121] (1) Total protein was extracted from cells. Western blotting results showed that in cells stably knocked down by DIRAS2, the protein expression of the rate-limiting enzymes of glycolysis, enolase 2 (ENO2), pyruvate kinase M2 (PKM2), and hexokinase 2 (HK2), was significantly reduced. Figure 6 ).

[0122] (2) Total mRNA was extracted from cells, and qRT-PCR results showed that the mRNA levels of the glycolysis rate-limiting enzyme genes ENO2, PKM2, and HK2 were significantly reduced in DIRAS2 knockdown cells. Figure 7 ).

[0123] (3) DIRAS2 knockdown significantly reduced the cells' glucose uptake capacity. Figure 8 ).

[0124] (4) DIRAS2 knockdown also significantly reduced intracellular lactate levels. Figure 9 ).

[0125] 5. Verification of DIRAS2 conditional knockout inhibiting the expression of the rate-limiting enzyme of glycolysis in mouse oral leukoplakia tissue.

[0126] Immunohistochemical staining results showed that the protein expression of glycolysis rate-limiting enzymes ENO2, PKM2, and HK2 in 4NQO-induced leukoplakia tissue of the mouse tongue was significantly increased compared with that in normal tongue tissue; DIRAS2 conditional knockout inhibited the protein expression of ENO2, PKM2, and HK2 in mouse tongue epithelial tissue. Compared with control mice, after DIRAS2 conditional knockout, the expression of glycolysis rate-limiting enzymes ENO2, PKM2, and HK2 in leukoplakia tissue of the mouse tongue was significantly reduced. Figure 10 ).

[0127] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

[0128] References: [1] Müller S. Oral epithelial dysplasia, atypical verrucous lesionsand oral potentially malignant disorders: focus on histopathology. Oral SurgOral Med Oral Pathol Oral Radiol,2018, 125(6):591-602. [2] Warnakulasuriya S. Oral potentially malignant disorders: Acomprehensive review on clinical aspects and management. Oral Oncol. 2020,102:104550. [3] Villa A, Sonis S. Oral leukoplakia remains a challengingcondition. Oral Dis. 2018, 24(1-2):179-183. [4] Bose S, Le A. Glucose Metabolism in Cancer. Adv Exp Med Biol,2018;1063:3-12. [5] Ogawa T, Washio J, Takahashi T, Echigo S, Takahashi N. Glucoseand glutamine metabolism in oral squamous cell carcinoma: insight from aquantitative metabolomic approach. Oral Surg Oral Med Oral Pathol OralRadiol, 2014, 118(2):218-225. [6] Chen X, Yi C, Yang MJ, Sun X, Liu X, Ma H, Li Y, Li H, Wang C, HeY, Chen G, Chen S,Yu L, Yu D. Metabolomics study reveals the potentialevidence of metabolic reprogramming towards the Warburg effect inprecancerous lesions. J Cancer. 2021, 12(5):1563-1574. [7] Lin NC, Su IH, Hsu JT, Tsai KY, Chen MYC. FDG-PET predicts boneinvasion and prognosis in patients with oral squamous cell carcinoma. SciRep, 2021, 11(1):15153. [8] Xie L, Liao J, Liu W, Wang R, Li X, Li W, Zhou Z. Gastrodinovercomes chemoresistance via inhibiting Skp2-mediated glycolysis. Cell DeathDiscov. 2023, 9(1):364. [9] Cai Y, Gao Q, Meng JH, Chen L. Puerarin Suppresses Glycolysis andIncreases Cisplatin Chemosensitivity in Oral Squamous Cell Carcinoma viaFBXW7 / mTOR Signaling. Nutr Cancer, 2023, 75(3):1028-1037.

[10] Bonvicini C, Faraone SV, Scassellati C. Common and specific genesand peripheral biomarkers in children and adults with attention-deficit / hyperactivity disorder. World J Biol Psychiatry, 2018, 19(2): 80-100.

[11] Sutton MN, Yang H, Huang GY, Fu C, Pontikos M, Wang Y, Mao W,Pang L, Yang M, Liu J, Parker-Thornburg J, Lu Z, Bast RC Jr. RAS-relatedGTPases DIRAS1 and DIRAS2 induce autophagic cancer cell death and arerequired for autophagy in murine ovarian cancer cells. Autophagy, 2018, 14(4):637-653.

[12] Ying K, Wang C, Liu S, Kuang Y, Tao Q, Hu X. Diverse Ras-relatedGTPase DIRAS2, downregulated by PSMD2 in a proteasome-mediated way, inhibitscolorectal cancer proliferation by blocking NF-κB signaling. Int J Biol Sci,2022, 18(3):1039-1050.

Claims

1. The use of DIRAS2 inhibitors in the preparation of medicaments for the prevention and / or treatment of diseases characterized by enhanced glycolysis; in, The reference sequence number for human DIRAS2 in NCBI is NM_017594.5, and the reference sequence number for mouse DIRAS2 in NCBI is NM_001024474.

2.

2. The application according to claim 1, characterized in that, The disease in question is a tumor or a precancerous lesion.

3. The application according to claim 2, characterized in that, The precancerous lesion is oral leukoplakia, and the tumor is oral squamous cell carcinoma.

4. The application according to any one of claims 1-3, characterized in that, The drug inhibits glycolysis by downregulating the expression and / or activity of at least one rate-limiting enzyme in cells.

5. The application according to claim 4, characterized in that, The rate-limiting enzyme for glycolysis is selected from at least one of autologous glycokinase 2, pyruvate kinase M2 subtype, and enolase 2.

6. The application according to any one of claims 1-3, characterized in that, The drug inhibits glycolysis by reducing the cells' ability to take up glucose and / or produce lactate.

7. The application according to any one of claims 1-3, characterized in that, The inhibitor is a substance that can suppress the expression level of the DIRAS2 gene or the activity of the DIRAS2 protein at the transcriptional or translational level.

8. The application according to claim 7, characterized in that, The inhibitor is selected from at least one of shRNA, siRNA, dsRNA, miRNA, cDNA, antisense RNA / DNA, low molecular weight compounds, peptides, antibodies, gene targeting vectors, or CRISPR-Cas systems. Preferably, the inhibitor is shRNA with the sequence 5'-GCUCAAGCCCAUCUACGAACA-3'.

9. A composition, characterized in that, It contains a DIRAS2 gene inhibitor; Optionally includes one or more pharmaceutically acceptable excipients, carriers, and / or solvents.

10. A method for screening candidate drugs for the prevention and / or treatment of diseases characterized by enhanced glycolysis, characterized in that, Includes the following steps: (1) Contact the cells expressing DIRAS2 or the DIRAS2 protein with the candidate drug to be tested; (2) To detect the effect of the candidate drug on the expression level of the DIRAS2 gene or the activity of the DIRAS2 protein; (3) Screen out candidate drugs that can reduce DIRAS2 gene expression level or inhibit DIRAS2 protein activity.

Images