Influenza virus A Vero cell cold-adapted strain Vca-CPD and application thereof

Abstract

This invention discloses the Vero cell cold-adapted strain Vca-CPD of influenza A virus and its applications, relating to the fields of biotechnology and vaccinology. The Vca-CPD described in this invention has the accession number CCTCC NO: V202585. This strain was mainly obtained through codon pair optimization of the PB2, PA, and NP genes. In vitro and in vivo experiments confirmed that this strain exhibits significantly reduced replication capacity and improved safety in human cells and mammalian models; simultaneously, it can induce the production of high levels of specific serum protective antibodies and respiratory mucosal sIgA antibodies. Furthermore, the virus yield of this strain in production matrix cells is comparable to that of the parent strain, demonstrating good production suitability.

Description

Technical Field

[0001] This invention relates to the fields of biotechnology and vaccinology, and more specifically to the Vero cell cold-adapted strain Vca-CPD of influenza A virus and its applications. Background Technology

[0002] Influenza (flu) is an acute respiratory infectious disease caused by the influenza virus. It is widespread and highly pathogenic. Vaccination is the most effective means of preventing influenza. Currently, the influenza vaccines used clinically mainly include inactivated vaccines and live attenuated vaccines. Among them, live attenuated vaccines (LAIV) are administered intranasally to simulate natural infection, inducing broad systemic and mucosal immunity. They have advantages such as convenient administration, high immunization efficiency, and long-lasting protection.

[0003] Traditional live attenuated vaccines primarily rely on cold adaptation (Ca) technology, which involves continuously passaged the virus at low temperatures to select strains with attenuated phenotypes. However, this method has significant limitations: First, the attenuation process is lengthy, and the resulting attenuated mutations are random, often maintaining the phenotype only through a few amino acid mutations, leading to insufficient genetic stability and a high risk of virulence reversion. For example, the attenuated phenotype of the A / Ann Arbor / 6 / 60 ca strain is highly dependent on a single PB2-N265S site, and a reversion mutation at this site can directly lead to virulence recovery. Second, because the degree of attenuation is difficult to precisely control, some cold-adapted strains retain strong replication capacity in the human body, causing adverse reactions such as high fever. Therefore, the vaccination population is usually limited to healthy individuals aged 2-49 years, failing to cover infants, the elderly, and high-risk groups with underlying diseases such as asthma and immunosuppression.

[0004] Therefore, there is an urgent need in this field to develop a novel attenuated influenza virus vaccine strain. This strain should possess a clear and stable attenuated genetic basis, achieving sufficient attenuation to ensure high safety while still eliciting effective immune protection; furthermore, as a vaccine seed strain, its viral yield in the production matrix must meet the requirements for industrial-scale amplification. Summary of the Invention

[0005] In view of this, the present invention provides the Vca-CPD strain of influenza A virus adapted to Vero cells and its applications.

[0006] To solve the above-mentioned technical problems, this application adopts the following technical solution:

[0007] A cold-adapted Vero cell strain of influenza A virus, Vca-CPD, with accession number CCTCCNO:V202585, was deposited on November 20, 2025, at the China Center for Type Culture Collection, Wuhan University, Wuhan, China, and is classified and named as Influenza A virus Vca-CPD.

[0008] Preferably, the Vca-CPD is a recombinant virus, obtained by rescuing recombinant plasmids pHW2000-PB2-CPD, pHW2000-PA-CPD, pHW2000-NP-CPD, pHW2000-PB1, pHW2000-M, pHW2000-NS, pHW2000-HA, and pHW2000-NA using an 8-plasmid reverse genetics system;

[0009] The nucleotide sequence of PB2-CPD in pHW2000-PB2-CPD is shown in SEQ ID NO.1, the nucleotide sequence of PA-CPD in pHW2000-PA-CPD is shown in SEQ ID NO.2, and the nucleotide sequence of NP-CPD in pHW2000-NP-CPD is shown in SEQ ID NO.3.

[0010] Another object of the present invention is to provide the application of the above-mentioned Vca-CPD strain of influenza A virus Vero cell cold-adapted in the preparation of a vaccine for the prevention of influenza A virus.

[0011] Preferably, the vaccine is a live attenuated vaccine.

[0012] Another object of the present invention is to provide the application of the above-mentioned cold-adapted Vca-CPD strain of influenza A virus in Vero cells as a primary vaccine donor virus.

[0013] Another object of the present invention is to provide a method for constructing the above-mentioned cold-adapted strain of influenza A virus on Vero cells, Vca-CPD, comprising the following steps:

[0014] S1: Based on the parental strain A / Yunnan / 1 / 2005Vca (H3N2), the PB2, PA, and NP genes were de-optimized according to the codon pair bias of the human genome to obtain PB2-CPD, PA-CPD, and NP-CPD.

[0015] S2: The whole genomes of PB2-CPD, PA-CPD and NP-CPD were synthesized and cloned into the pHW2000 vector to obtain recombinant plasmids pHW2000-PB2-CPD, pHW2000-PA-CPD and pHW2000-NP-CPD.

[0016] S3: Based on the parental strain A / Yunnan / 1 / 2005Vca (H3N2), its PB1 gene, M gene and NS gene were amplified and cloned into the pHW2000 vector to obtain recombinant plasmids pHW2000-PB1, pHW2000-M and pHW2000-NS.

[0017] S4: Based on the vaccine strain A / Darwin / 9 / 2021 (H3N2), recombinant plasmids pHW2000-HA and pHW2000-NA were obtained from its HA and NA genes using the method in step S3.

[0018] S5: Co-transfect Vero cells with the recombinant plasmids pHW2000-PB2-CPD, pHW2000-PA-CPD and pHW2000-NP-CPD obtained in step S2, the recombinant plasmids pHW2000-PB1, pHW2000-M and pHW2000-NS obtained in step S3, and the recombinant plasmids pHW2000-HA and pHW2000-NA obtained in step S4, and collect the cell supernatant.

[0019] Another object of the present invention is to provide an influenza A vaccine comprising the above-mentioned cold-adapted strain of influenza A virus, Vca-CPD, from Vero cells.

[0020] Preferably, the vaccine also includes an adjuvant.

[0021] Another object of the present invention is to provide a kit comprising the above-described influenza A vaccine.

[0022] Preferably, the kit also includes tools for administering the vaccine.

[0023] As can be seen from the above technical solution, compared with the prior art, the present invention has the following beneficial effects:

[0024] This invention, based on previously reported cold-adapted influenza virus strains to Vero cells, further employs codon pair deoptimization technology to achieve rational and precise attenuation based on a dual mechanism. This strategy, by introducing numerous synonymous mutations, significantly enhances the genetic stability of the viral strain without altering the viral amino acid sequence, fundamentally reducing the risk of virulence reversion. The resulting novel strain exhibits significantly reduced replication capacity and high safety in both in vitro and in vivo experiments, while simultaneously inducing a potent immune response and maintaining high viral yields in vaccine production matrices. This strain can serve as a stable primary vaccine donor virus, enabling the rapid construction of safe and highly effective live attenuated influenza vaccines through reassortment with circulating strains, providing a new technical pathway and solution for influenza prevention and control. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0026] Figure 1 Schematic diagrams of the structures of the optimized genes PB2-CPD, PA-CPD, and NP-CPD;

[0027] Figure 2 Hemagglutination titer of recombinant virus Vca-CPD;

[0028] Figure 3 The viral load in the nasal turbinates and lung tissues of mice after infection with Vca-CPD and Vca-WT viruses;

[0029] Figure 4 Replication and growth curves of viral Vca-CPD and Vca-WT in KMB17 and MDCK cells;

[0030] Figure 5 The changes in viral yield of Vca-CPD and Vca-WT in Vero and MDCK cells;

[0031] Figure 6 The levels of hemagglutination inhibition antibodies and neutralizing antibodies in mice immunized with viral Vca-CPD and Vca-WT;

[0032] Figure 7 The mucosal sIgA antibody levels in mice immunized with viral Vca-CPD and Vca-WT. Detailed Implementation

[0033] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0035] Example 1: Construction and rescue of recombinant virus Vca-CPD

[0036] This embodiment relates to a recombinant virus, Vca-CPD, which is rescued using codon pair deoptimization (CPD) technology and a reverse genetics system. The CPD effectively reduces the virus's replication capacity in the human body by increasing the proportion of low-frequency codon pairs in the viral genome, without altering the viral amino acid sequence or RNA spatial structure, thereby achieving an attenuation effect.

[0037] The specific steps are as follows:

[0038] 1. Gene optimization design of recombinant virus Vca-CPD

[0039] Using influenza virus strain A / Yunnan / 1 / 2005Vca (H3N2) as a model, codon pair optimization was performed on parts of its polymerase protein gene PB2, PA and nucleoprotein gene NP.

[0040] By precisely positioning the codon pair deoptimization region in the middle segment of the gene, the packaging signal regions at both ends of the open reading frame (ORF) are fully preserved, thus ensuring that the deoptimized gene can be correctly packaged into the viral genome (see Table 1 and...). Figure 1 ).

[0041] Table 1. Distribution of mutation regions in PB2, PA, and NP genes

[0042]

[0043] Referring to the codon pair deoptimization algorithm reported by Coleman et al. (Virus attenuation by genome-scale changes in codonpair bias. Science. 2008 Jun 27;320(5884):1784-7. doi: 10.1126 / science.1155761), based on codon pair bias data from the human genome (GRCh38.P14 version), the following steps were completed:

[0044] ① Calculate the codon pair bias scores for wild-type genes PB2, PA, and NP;

[0045] ② With the goal of reducing codon pair bias score, a series of candidate sequences that are identical to wild-type amino acid sequences but have reduced codon pair bias to varying degrees are generated;

[0046] ③ Select the sequence with the lowest codon pair preference score from the candidate sequences as the final deoptimized genes PB2-CPD, PA-CPD, and NP-CPD (sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, where the underlined region indicates the CPD region).

[0047] The PB2-CPD gene sequence of the recombinant virus Vca-CPD is shown below:

[0048] GGGAGCAAAAGCAGGTCAATTATATTCAATATGGAAAGAATAAAAGAACTAAGAAATCTAATGTCGCAGTCTCGCACCCGCGAGATACTCACAAAAACCACCGTGGACCATATGGCCATAATCAAGAAGTACACATCAGGAAGACAGGAGAAGAACCCAGCACTTAGGATGAAATGGATGATGGCAATGAAATATCCAATTACAGCAGACAAGAGGATAACGGAAATGATTCCTGAGAGAAAT GAGCAAGGACAAACTTTATGGAGTAAAATGAATGATGCCGGATCAGACCGAGTGATGGTATCACCTCTGGCTGTGACATGGTGGAATAGGAATGGACCAATAACAAATACAGTTCATTATCCAAAAATCTACAAAACTTATTTTGAAAGAGTCGAAAGGCTAAAGCATGGAACCTTTTGGCCCTGTCCATTTTAGAAACCAAGTCAAAATACGTCGGAGAGTTGACATAAATCCTGGTCATGCA GATCTGTCAGCGAAGGAAGCGCAAGATGTGATAATGGA GGTGGTATTCCCTAACGAGGTAGGCGCACGCATTCTAACTAGCGAATCGCAACTAACCATTACGAAAGAGAAAAAA GAGGAACTGCAAGATTGCAAAATCAGTCCGCTTATGGTCGCTTATATGTTAGAGCGCGAGCTCGTTCGTAAGACTA GATTCTTGCCCGTAGCCGGCGGTACGTCTAGCGTGTATATTGAGGTGCTTCACTTAACCCAGGGAACTTGTTGGGA ACAGATGTATACACCCGGGGGGGAGGTACGAAATGACGACGTAGACCAATCTTTGATCATTGCAGCTAGGAATATC GTACGGCGCGCAGCAGTGTCCGCCGATCCCCTTGCCTCGTTGCTCGAAATGTGCCACTCAACGCAAATTGGCGGGA TTCGGATGGTTGACATCTTACGCCAAAATCCTACGGAGGAACAGGCCGTCGACATATGTAAAGCCGCAATGGGTCT TAGAATTAGCTCTAGTTTCTCATTCGGAGGGTTCACATTCAAACGGACGAGCGGTAGTAGCGTGAAACGTGAGGAA GAAGTGCTTACGGGTAACCTTCAGACACTGAAGATCAGGGTGCACGAAGGATACGAGGAATTTACGATGGTCGGTC 7GCAGGGCAACCGCGATACTCCGCAAGGCGACACGACGTCTAATCCAACTTATCGTATCGGGACGTGATGAACAGTC GATCGCCGAAGCGATAATCGTGGCTATGGTATTCTCTCAGGAGGATTGTATGATTAAGGCCGTACGGGGTGATCTG AATTTCGTAAACCGCGCAAATCAGAGACTCAACCCTATGCATCAATTGCTACGCCACTTTCAAAAGGACGCAAAGG TACTTTTCCAGAATTGGGGGGTTGAGCCGATAGATAATGTTATGGGGATGATAGGGATCTTACCCGATATGACACC TAGCATCGAAATGAGCATGCGAGGCGTTCGTATAAGTAAGATGGGGGTCGACGAGTATTCTTCTACAGAGCGCGTC GTCGTCAGTATAGATCGCTTTCTCCGCATTAGAGACCAACGGGGCAACGTGTTACTATCTCCCGAAGAGGTTTCCG AGACGCAAGGGACAGAAAAGCTTACGATTACGTACTCTTCAAGCATGATGTGGGAAATTAACGGGCCTGAATCCGT ACTGGTTAACACATATCAATGGATCATTCGAAATTGGGAAACTGTCAAAATCCAATGGAGTCAAAATCCGACTATG CTATACAATAAGATGGAATTCGAACCCTTTCAATCACTAGTACCTAAGGCTATTCGCGGACAATACTCAGGTTTTG TGCGAACACTATTCCAGCAAATGAGAGACGTATTGGGAACGTTTGATACGGCGCAAATTATA AAACTTCTTCCCTTCGCAGCCGCTCCACCAAAGCAAAGTAGAATGCAGTTCTCCTCATTTACTGTGAATGTGAGGGGATCAGGAATGAGAATACTTGTAAGGGGCAATTCTCCTGTATTCAACTATAACAAGGCCACGAAGAGACTCACAGTTCTCGGAAAGGATGCTGGCACTTTAACTGAAGACCCAGATGAAGGCACAGCTGGAGTGGAGTCCGCTGTTCTGAGGGGATTCCTCATTCTGGGCAAAGAAGACAAGAGATATGGGCCAGCACTAAGCATCAATGAACTGAGCAACCTTGCGAAAGGAGAGAAGGCTAATGTGCTAATTGGGCAAGGAGACGTGGTGTTGGTAATGAAACGGAAACGGGACTCTAGCATACTTACTGACAGCCAGACAGCGACCAAAAGAATTCGGATGGCCATCAATTAGTGTCGAATAGTTTAAAAACGACCTTGTTTCTACT, SEQ ID NO.1。

[0049] The PA-CPD gene sequence of the recombinant virus Vca-CPD is shown as follows:

[0050] GGGAGCAAAAGCAGGTACTGATCTAAAATGGAAGATTTTGTGCGACAATGCTTCAATCCGATGATTGTCGAGCTTGCGGAAAAAACAATGAAAGAGTATGGGGAGGACCTGAAAATCGAAACAAACAAATTTGCAGCAATATGCACTCACTTGGAAGTATGCTTCATGTATTCAGATTTTCACTTCATCAATGAGCAAGGCGAGTCAATAATCGTAGAACTTGGTGATCCAAATGCACTTTTGAAGCACAGATTTGAAATAATCGAGGGAAGAGATCGCACGATGGCCTGGACAGTAGTAAACAGTATTTGCAACACTACAGGGGCTGAGAAACCAAAGTTTCTACCAGATTTGTATGATTACAAGGAGAATAGATTCATCGAAATTGGAGTAACAAGGAGAGAAGTTCACATATACTATCTGGAAAAG GCGAACAAAATCAAGTCGG AAAAGACGCATATACATATTTTCTCGTTCACCGGGGAAGAGATGGCCACTAAAGCGGATTATACACTCGATGAGGA AAGTCGGGCTAGGATTAAGACACGTCTATTCACAATAAGACAGGAGATGGCTAGCCGGGGGCTATGGGATAGTTTT AGGCAATCTGAACGAGGAGAGGAAACGATCGAGGAACGTTTCGAAATAACCGGGACAATGCGAAAGTTGGCCGATC AATCCTTACCGCCTAACTTTTCATCACTCGAGAACTTTCGGGCTTACGTCGACGGGTTTGAACCGAACGGATACAT AGAGGGTAAACTCTCGCAAATGAGCAAGGAAGTTAATGCTAGGATCGAACCGTTCTTGAAGACGACCCCTAGACCA TTACGGTTGCCGAACGGACCGCCATGCTCGCAAAGATCCAAATTCTTACTTATGGACGCGTTGAAACTTAGCATAG AAGACCCATCGCATGAGGGCGAAGGCATACCCTTATACGATGCAATCAAATGCATGCGGACATTCTTCGGTTGGAA AGAACCGAACGTAGTTAAGCCGCATGAAAAGGGTATCAATCCGAATTACCTACTCAGTTGGAAACAGGTACTCGCC GAGTTGCAAGATTCTGAGAATGAGGAAAAGATTCCAAAAACGAAAAATATGAAAAAGACATCCCAATTGAAATGGG CACTGGGCGAAAATATGGCTCCGGAAAAGGTTGACTTCGACGATTGTAAGGACGTCGGCGACTTAAAACAGTACGA TTCCGATGAACCTGAGTTGAGATCGCTCGCAAGTTGGATCCAAAACGAATTTAACAAGGCTTGCGAATTAACCGAT AGCTCTTGGATCGAACTCGATGAGATAGGTGAGGACGTTGCACCCATAGAGCACATAGCTAGTATGCGTCGTAATT ATTTCACATCCGAAGTCTCGCATTGTCGAGCAACTGAATACATTATGAAGGGAGTATACATAAACACCGCTCTTCT GAACGCATCATGTGCCGCGATGGACGATTTCCAGTTAATACCAATGATCAGTAAGTGTCGGACTAAGGAGGGACGA CGAAAGACTAACTTATACGGCTTTATAATTAAAGGAAGGTCGCACCTTAGGAACGATACCGATGTAGTGAATTTCG TTAGCATGGAATTTAGTTTAACGGATCCGAGGTTGGAACCTCATAAGTGGGAAAAGTATTGCGTGCTCGAAATCGG AGATATGTTAATCCGATCCGCTATAGGTCAGGTATCTCGACCTATGTTCCTGTACGTACGGACTAACGGTACAAGT AAAATTAAGATGAAATGGGGGATGGAAATGAGACGATGCCTTTTGCAATCA CTTCAACAAATTGAGAGTATGATTGAAGCTGAGTCCTCTGTCAAAGAGAAAGACATGACCAAAGAGTTCTTTGAGAACAAATCAGAAACATGGCCCATTGGAGAGTCCCCCAAAGGAGTGGAGGAAAGTTCCATTGGGAAGGTCTGCAGGACTTTATTAGCAAAGTCGGTATTCAACAGCTTGTATGCATCTCCACAACTAGAAGGATTTTCAGCTGAATCAAGAAAACTGCTTCTTATCGTTCAGGCTCTTAGGGACAACCTGGAACCTGGGACCTTTGATCTTGGGGGGCTATATGAAGCAATTGAGGAGTGCCTGATTAATGATCCCTGGGTTTTGCTTAATGCTTCTTGGTTCAACTCCTTCCTTACACATGCATTGAGTTAGTTGTGGCAGTGCTACTATTTGCTATCCATACTGTCCAAAAAAGTACCTTGTTTCTACT, SEQ ID NO.2。

[0051] The NP-CPD gene sequence of the recombinant virus Vca-CPD is shown as follows:

[0052] GGGAGCAAAAGCAGGGTAGATAATCACTCACTGAGTGACATCAAAGTCATGGCGTCCCAAGGCACCAAACGGTCTTACGAACAAATGGAGACTGATGGGGAACGCCAGAATGCAACTGAAATCAGAGCATCCGTCGGAAAAATGATTGGTGGAATTGGGCGGTTCTACATCCAAATGTGCACCGAGCTTAAACTCAATGATTATGAGGGAAGACTGATCCAGAACAGCTTAACAATAGAGAGAATG GTACTGTCCGCCTTCGATGAACGTCGTAATAAATACCTCGAAGAACACCC TAGTGCAGGAAAAGACCCTAAGAAAACGGGCGGACCTATCTACAAACGAGTGAACGGTAAATGGGTACGCGAACTG GTACTGTACGATAAAGAGGAGATACGCAGAATTTGGCGTCAAGCTAATAATGGCGACGATGCGACAGCCGGACTGA CACACATAATGATCTGGCATTCTAATCTAAACGATACTACATACCAGCGGACACGGGCACTTGTGAGGACCGGAAT GGACCCACGTATGTGCTCTCTCATGCAAGGCTCAACGCTTCCTAGGCGGTCAGGTGCAGCCGGTGCGGCAGTTAAG GGCGTAGGCACAATGGTACTCGAGCTGATCAGAATGATTAAGCGGGGCATTAATGATCGCAATTTCTGGCGAGGGG AAAACGGTCGAAAGACGAAAATCGCGTACGAGCGTATGTGCAATATTCTAAAGGGGAAGTTTCAGACCGCAGCGCA GCGCGCGATGATGGACCAGGTCAGGGAATCAAGGAATCCGGGTAATGCTGAAATCGAAGATCTGACGTTCCTCGCA AGATCGGCCCTAATCTTAAGAGGCTCGGTTGCACACAAATCGTGTCTGCCAGCGTGCGTCTATGGGCCCGCAGTTG CGTCCGGTTACGATTTCGAAAAAGAGGGGTATTCTCTAGTCGGTATCGACCCGTTTAAACTGTTGCAGACGTCACA AGTGTATAGCTTAATCCGTCCAAACGAAAATCCGGCGCATAAAAGCCAATTGGTATGGATGGCCTGTAACTCCGCC GCGTTTGAGGATTTACGTGTGAGTAGTTTTATTCGGGGGACAAGGGTACTCCCCCGCGGTAAGTTGTCAACAAGGG GGGTCCAAATCGCTTCTAACGAGAATATGGACTCAATCGTATCGTCAACCCTCGAATTGCGGAGCCGGTATTGGGC GATTCGGACTAGATCGGGCGGTAATACCAATCAGCAACGTGCCTCTGCCGGTCAAATCTCTATACAACCGACGTTC GGGAATGCGGAGGGAAGAACATCAGACATGAGGGCAGAAATCATAAAGATGATGGAAAGTGCAAGACCAGAAGAAGTGTCCTTCCAGGGGAGGGGAGTCTTCGAGCTCTCGGACGAAAGGGCAACGAACCCGATCGTGCCCTCCTTTGACATGAGTAATGAAGGATCTTATTTCTTCGGAGACAATGCAGAGGAGTACGACAATTAATGAAAAATACCCTTGTTTCTACT, SEQ ID NO. 3.

[0053] After deoptimization, the codon pair bias (CPB) scores of the PB2-CPD, PA-CPD, and NP-CPD genes decreased by 0.271, 0.291, and 0.398, respectively (see Table 2). Alignment with wild-type nucleotide sequences revealed mutations of 375, 351, and 293 base sites in the PB2-CPD, PA-CPD, and NP-CPD genes, with sequence homology of 73.21%, 74.44%, and 73.32%, respectively.

[0054] Table 2. Comparison of codon pair bias (CPB) before and after deoptimization of PB2, PA, and NP genes.

[0055]

[0056] The designed PB2-CPD, PA-CPD, and NP-CPD gene sequences were synthesized in their entirety by Shanghai Jereh Biotechnology Co., Ltd., and cloned into the PUC57 vector to obtain recombinant plasmids pUC57-PB2-CPD, pUC57-PA-CPD, and pUC57-NP-CPD. Sanger sequencing confirmed that the inserted sequences in all plasmids were completely consistent with the design, and no unexpected mutations occurred.

[0057] 2. Rescue and Validation of Recombinant Virus Vca-CPD

[0058] (1) Construction of pHW2000 recombinant plasmids: Using the synthesized pUC57-PB2-CPD, pUC57-PA-CPD, and pUC57-NP-CPD recombinant plasmids as templates, PB2-CPD, PA-CPD, and NP-CPD gene fragments with homologous arms at both ends were amplified by polymerase chain reaction (PCR). After agarose gel electrophoresis analysis, the target bands of the correct size were recovered and purified. The purified products were ligated with the linearized pHW2000 vector through homologous recombination. The recombinant products were transformed into DH5α competent cells and screened on LB plates containing ampicillin. After single colonies were picked and expanded, the plasmids were extracted. After DNA sequencing verification, they were named pHW2000-PB2-CPD, pHW2000-PA-CPD, and pHW2000-NP-CPD, respectively, and stored at -80℃ for later use.

[0059] (2) Virus rescue and amplification: Virus rescue was performed using an 8-plasmid reverse genetics system. The three recombinant plasmids (pHW2000-PB2-CPD, pHW2000-PA-CPD, pHW2000-NP-CPD) constructed above, along with plasmids (pHW2000-PB1, pHW2000-M, pHW2000-NS) constructed from the other three internal genes of the parent strain A / Yunnan / 1 / 2005Vca (H3N2) and plasmids (pHW2000-HA, pHW2000-NA) constructed from the two surface genes of the WHO recommended vaccine strain A / Darwin / 9 / 2021 (H3N2), were co-transfected into Vero cells and cultured at 37°C and 5% CO2 for 72 hours. Cell supernatant was collected and inoculated into the allantoic cavity of 10-day-old SPF chicken embryos at a dose of 0.8 mL / egg. The embryos were then cultured at 34°C and 70% RH for 72 hours to amplify the virus. Finally, the allantoic fluid was harvested under aseptic conditions, centrifuged, filtered, aliquoted, and stored at -80°C.

[0060] The nucleotide sequences of the PB1, M, and NS genes of the parental virus A / Yunnan / 1 / 2005Vca (H3N2) are referenced in Yang Jinghui's doctoral dissertation (Yang Jinghui. Attenuation characteristics of cold-adapted strains of H3N2 subtype influenza virus in Vero cells and study on evaluation of pseudoviruses and neutralizing antibodies [D]. Peking Union Medical College, 2014).

[0061] The nucleotide sequences of the HA and NA genes of vaccine virus A / Darwin / 9 / 2021 (H3N2) are referenced from accession numbers OR567121.1 and OR567258.1 in the GenBank database.

[0062] (3) Virus identification and nomenclature: Hemagglutination tests were performed on the harvested allantoic fluid to detect virus viability. In a U-bottom 96-well plate, the virus solution was serially diluted 2-fold and mixed with an equal volume of 1% guinea pig erythrocyte suspension. The mixture was incubated at room temperature for 1 hour, and erythrocyte agglutination was observed. The results showed that the harvested chicken embryo allantoic fluid induced guinea pig erythrocyte agglutination, with a hemagglutination titer of 1:1024, preliminarily confirming that infectious virus particles had been successfully rescued and effectively amplified (see...). TCCGTTCAGCGAAACTTACCATTCGATAAGACTACGATTATGGCCGCTTTTACC Meanwhile, Sanger sequencing was performed on the PB2, PA, and NP gene fragments that rescued the virus, and the results confirmed that the viral genome stably carried the expected deoptimized sequence without any reversion mutations or other unexpected variations.

[0063] In summary, the successfully rescued recombinant virus was named Vca-CPD.

[0064] Vca-CPD was deposited at the China Center for Type Culture Collection (CCTCC) on November 20, 2025, at Wuhan University, Wuhan, China, with accession number CCTCC NO: V202585, and classified as Influenza A virus (Vca-CPD).

[0065] Example 2 Evaluation of the attenuation characteristics of recombinant virus Vca-CPD

[0066] The parent virus A / Yunnan / 1 / 2005Vca (H3N2) (Patent No.: CN103898066B, Accession No.: CCTCCNO.V201253) is a reported cold-adapted attenuated influenza virus strain. The recombinant virus Vca-CPD was constructed while retaining its complete amino acid sequence, and theoretically should inherit its cold-adaptation characteristics. To systematically verify whether Vca-CPD possesses the core phenotype of a candidate attenuated vaccine strain, this embodiment comprehensively evaluates its temperature sensitivity (ts), cold adaptation (ca), and attenuation characteristics (att) in animal models.

[0067] The recombinant virus Vca-CPD obtained in Example 1 was used as the experimental virus; the virus rescued by the same HA and NA genes from the parent strain under the same experimental conditions (named Vca-WT) was used as the control virus.

[0068] Vca-CPD and Vca-WT viruses were serially diluted 10-fold at a multiplicity of infection (MOI) of 1 and inoculated into 96-well plates containing dense monolayers of MDCK cells within 24 hours. Eleven dilutions were performed, with eight replicates per dilution. The virus maintenance medium was DMEM / F12 solution containing 2.0 μg / ml TPCK-trypsin. The inoculated cell culture plates were cultured in parallel at 25°C (cold acclimatization), 33°C (permissible temperature), and 39°C (limiting temperature). After 72 hours, cytopathic effects were observed, and the supernatant was collected. The number of positive wells was counted using a hemagglutination assay. Finally, the TCID of the virus was calculated using the Spearman-Kärber method. 50 The titers were measured, and the results are shown in Table 3.

[0069] Table 3. Infectivity titers and phenotypic analysis of Vca-CPD and Vca-WT viruses at different temperatures.

[0070]

[0071] An infection model was established using 4-6 week old female BALB / c mice. Mice were randomly divided into three groups (n=6 per group): a Vca-CPD experimental group, a Vca-WT control group, and a PBS blank control group. Each group was inoculated intranasally with 10 styrene precipitates of PBS. 7 PFU-containing virus or an equal volume of sterile PBS. Lung tissue from mice was collected on days 1 and 3 post-infection and treated with the aforementioned TCID. 50 The viral load in the lungs was determined by a method, and the results are shown in [the table]. Figure 2 .

[0072] Combined Table 3 and Figure 3 The results showed that the recombinant virus Vca-CPD exhibited a temperature-sensitive (ts), cold-adapted (ca), and (attenuated) att phenotype. Specifically, the viral titer at the limiting temperature of 39°C decreased by ≥2.0 Log compared to the permissible temperature of 33°C. 10 The virus titer meets the criteria for TS phenotype determination; under low-temperature adaptation conditions of 25℃, the viral titer decreases by only ≤2.0 Log compared to 33℃. 10 It meets the requirements of the CA phenotype; its replication is inhibited in the lower respiratory tract (lungs) of mice, but it can replicate effectively in the upper respiratory tract (nasal turbinates), showing a good Att phenotype. Notably, compared with the parent strain, Vca-CPD has a stronger and longer-lasting colonization and replication ability in the nasal mucosa of mice, which is the key to its ability to induce a more durable immune response.

[0073] Example 3: Evaluation of Replication Kinetics of Recombinant Virus Vca-CPD

[0074] This embodiment aims to evaluate the replication ability of recombinant virus Vca-CPD in human embryonic lung diploid cells (KMB17) and canine kidney cells (MDCK) at 25°C and 33°C, in order to clarify its replication restriction and cold adaptation characteristics in cell models.

[0075] Vca-CPD and Vca-WT viruses were inoculated into KMB17 and MDCK cells, respectively, at a multiplicity of infection (MOI) of 1, which had grown into dense monolayers within 24 hours. After adsorption for 3 hours, residual virus solution was removed, and virus maintenance medium was added. Infected cells were cultured at 25°C and 33°C, respectively, and samples were taken at different time points until complete cytopathic effect was achieved. Viral RNA was extracted from the collected samples, and viral copy number was detected by real-time quantitative PCR. Based on this, a one-step viral growth curve was plotted, as shown below. Figure 3 As shown.

[0076] The results showed that the replication ability of the recombinant virus Vca-CPD was significantly reduced in both cell lines and under both temperature conditions. In human KMB17 cells, Vca-CPD not only exhibited significant temperature sensitivity (replication was severely inhibited at 33℃), but its overall replication level was also much lower than that of Vca-WT virus, with the attenuated phenotype being the most pronounced. In MDCK cells, the replication efficiency of Vca-CPD was consistently lower than that of Vca-WT virus throughout the entire replication cycle.

[0077] Example 4: Evaluation of viral yield of recombinant virus Vca-CPD

[0078] This embodiment aims to evaluate the viral yield and dynamic accumulation process of recombinant virus Vca-CPD in Vero cells (emerging culture medium) and MDCK cells (standard culture medium) at 25°C and 33°C, providing a reference for optimizing vaccine production processes.

[0079] Vca-CPD and Vca-WT viruses were inoculated into Vero and MDCK cells, respectively, which had grown into dense monolayers within 24 hours, at a multiplicity of infection (MOI) of 1. After adsorption for 3 hours, residual virus solution was removed, and virus maintenance medium was added. Infected cells were cultured at 25°C and 33°C, respectively, and samples were taken at different time points until complete cytopathic effect was achieved. Samples were collected for hemagglutination assays. The hemagglutination titer (expressed as hemagglutination units / 50 μl) was calculated as the reciprocal of the highest dilution that caused complete agglutination. Results are shown below. Figure 4 As shown.

[0080] The results showed that the recombinant virus Vca-CPD possessed a stable viral particle production capacity. Under culture conditions of 25℃ or 33℃, Vca-CPD achieved a hemagglutination titer peak comparable to that of Vca-WT virus in both Vero and MDCK cells.

[0081] Example 5 Immunogenicity evaluation of recombinant virus Vca-CPD

[0082] This embodiment aims to evaluate the strength of the immune response induced by the recombinant virus Vca-CPD in order to clarify its potential as a live attenuated vaccine to stimulate systemic and local mucosal immunity.

[0083] Female BALB / c mice aged 4-6 weeks were randomly divided into three groups (n=8 per group): Vca-CPD experimental group, Vca-WT control group, and PBS blank control group. Each group was injected intranasally with 10 styrene precipitates. 7 The mice were given the corresponding virus of PFU or an equal volume of sterile PBS for primary immunization. After 21 days, serum, nasal lavage fluid and lung lavage fluid were collected from each group of mice for secondary immunization. After 42 days, the above samples were collected again.

[0084] The level of specific hemagglutination inhibitory antibodies in serum was detected using a hemagglutination inhibition assay. The specific method included: serum samples were treated with receptor-degrading enzymes, heat-inactivated, and adsorbed onto guinea pig erythrocytes to remove non-specific inhibitors. Subsequently, the samples were serially diluted twofold, mixed with viral antigen of 8 hemagglutination units, and then 1% guinea pig erythrocyte suspension was added. The HI antibody titer was determined by the reciprocal of the highest dilution that completely inhibited hemagglutination. Results were as follows: Figure 5 As shown.

[0085] The level of neutralizing antibodies in serum was detected using a viral micro-neutralization assay. The specific method included: serum treatment with receptor-destructive enzymes and heat inactivation, followed by 2-fold serial dilutions, and then reacting with 100 TCID50. 50 Co-incubation with 50 μl of live A / Darwin / 9 / 2021 (H3N2) virus was performed, followed by incubation in MDCK cells at 37°C for 72 h. Neutralizing antibody titers were calculated by observing cytopathic effects and measuring hemagglutination titers in the supernatant. Results are as follows: Figure 6 As shown.

[0086] The levels of virus-specific sIgA antibodies in nasal lavage fluid and bronchoalveolar lavage fluid were detected using enzyme-linked immunosorbent assay (ELISA). The specific method included: coating an ELISA plate with the recombinant HA protein of A / Darwin / 9 / 2021 (H3N2) virus (catalog number 40859-V08B); adding serially diluted wash samples (2-fold); and then sequentially adding biotin-labeled mouse anti-IgA antibody, streptavidin-HRP, and substrate for color development. Finally, the concentration of sIgA in the samples was calculated based on a standard curve. The results are shown below. Figure 6 Figure 7 As shown.

[0087] Experimental results showed that the recombinant virus Vca-CPD could effectively induce systemic and mucosal immune responses. Serological tests revealed that both primary and secondary immunizations elicited protective hemagglutination inhibition antibodies and neutralizing antibodies, with a significant increase in antibody levels after secondary immunization, indicating the formation of good immune memory. Notably, neutralizing antibody levels were consistently higher than hemagglutination inhibition antibody levels, suggesting that the antibody response induced by Vca-CPD has a broader functional scope and potential protective range. Regarding mucosal immunity, both upper and lower respiratory tract sIgA antibody levels significantly increased after secondary immunization, with a stronger response in the upper respiratory tract than in the lower respiratory tract, consistent with the characteristics of attenuated strains that exhibit limited replication in the upper respiratory tract and effectively elicit local immunity. These results indicate that Vca-CPD has good potential in inducing high-quality humoral immunity and effective mucosal immunity.

[0088] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0089] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A Vero cell-cold-adapted strain of influenza A virus, Vca-CPD, characterized in that, The accession number of the Vca-CPD is CCTCC NO:V202585.

2. The Vca-CPD strain of influenza A virus Vero cell cold-adapted according to claim 1, characterized in that, The Vca-CPD is a recombinant virus, which was rescued from recombinant plasmids pHW2000-PB2-CPD, pHW2000-PA-CPD, pHW2000-NP-CPD, pHW2000-PB1, pHW2000-M, pHW2000-NS, pHW2000-HA and pHW2000-NA using an 8-plasmid reverse genetics system. The nucleotide sequence of PB2-CPD in pHW2000-PB2-CPD is shown in SEQ ID NO.1, the nucleotide sequence of PA-CPD in pHW2000-PA-CPD is shown in SEQ ID NO.2, and the nucleotide sequence of NP-CPD in pHW2000-NP-CPD is shown in SEQ ID NO.

3. Furthermore, pHW2000-PB1, pHW2000-M, and pHW2000-NS are obtained by amplifying and cloning the PB1, M, and NS genes of the parental strain A / Yunnan / 1 / 2005Vca into the pHW2000 vector; pHW2000-HA and pHW2000-NA are obtained by amplifying and cloning the HA and NA genes of the vaccine strain A / Darwin / 9 / 2021 into the pHW2000 vector.

3. The use of the Vca-CPD strain of influenza A virus Vero cell cold-adapted as described in claim 1 or 2 in the preparation of a vaccine for the prevention of influenza A virus.

4. The application of the Vca-CPD strain of influenza A virus Vero cell cold-adapted according to claim 3 in the preparation of a vaccine for the prevention of influenza A virus, characterized in that, The vaccine in question is a live attenuated vaccine.

5. The use of the Vca-CPD strain of influenza A virus Vero cell cold-adapted as described in claim 1 or 2 in the preparation of vaccine donor viruses.

6. The method for constructing the Vca-CPD strain of influenza A virus Vero cell cold-adapted as described in claim 1 or 2, characterized in that, Includes the following steps: S1: Based on the parental strain A / Yunnan / 1 / 2005Vca, the PB2, PA, and NP genes were de-optimized according to the codon pair bias of the human genome to obtain PB2-CPD, PA-CPD, and NP-CPD. S2: The PB2-CPD, PA-CPD and NP-CPD were synthesized in their entirety and cloned into the pHW2000 vector to obtain recombinant plasmids pHW2000-PB2-CPD, pHW2000-PA-CPD and pHW2000-NP-CPD. S3: Based on the parental strain A / Yunnan / 1 / 2005Vca, its PB1 gene, M gene and NS gene were amplified and cloned into the pHW2000 vector to obtain recombinant plasmids pHW2000-PB1, pHW2000-M and pHW2000-NS. S4: Based on vaccine strain A / Darwin / 9 / 2021, recombinant plasmids pHW2000-HA and pHW2000-NA were obtained from its HA and NA genes using the method in step S3. S5: Co-transfect Vero cells with the recombinant plasmids pHW2000-PB2-CPD, pHW2000-PA-CPD and pHW2000-NP-CPD obtained in step S2, the recombinant plasmids pHW2000-PB1, pHW2000-M and pHW2000-NS obtained in step S3, and the recombinant plasmids pHW2000-HA and pHW2000-NA obtained in step S4, and collect the supernatant.

7. A type A influenza vaccine, characterized in that, It includes the Vca-CPD strain of influenza A virus Vero cell cold-adapted as described in claim 1 or 2.

8. The influenza A vaccine according to claim 7, characterized in that, It also includes adjuvants.

9. A reagent kit, characterized in that, It includes the influenza A vaccine as described in claim 7 or 8.

10. The reagent kit according to claim 9, characterized in that, It also includes the tools used for vaccination.

Images