Application of ZmCASPL11 gene in improving plant heat tolerance

By overexpressing the ZmCASPL11 gene in plants, the problem of heat tolerance under high temperature stress was solved, and the heat tolerance of plants was significantly improved and the damage caused by high temperature was reduced.

CN121825993BActive Publication Date: 2026-07-07SANYA INST OF HENAN UNIV +1

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SANYA INST OF HENAN UNIV
Filing Date
2026-03-12
Publication Date
2026-07-07

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively improve the high-temperature tolerance of plants, especially under high-temperature stress conditions in the context of global warming, leading to reduced crop yields and hindered plant growth and development.

Method used

By overexpressing the ZmCASPL11 gene in plants, the heat tolerance of plants can be improved by utilizing the protein it encodes. A recombinant vector was constructed and transformed into plants using Agrobacterium-mediated transformation to enhance their tolerance to high-temperature stress.

Benefits of technology

It significantly improved the plant's high-temperature tolerance, reduced leaf damage, maintained high photochemical efficiency, reduced ion leakage rate and oxidative damage to cell membranes, and enhanced the plant's overall heat resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121825993B_ABST
    Figure CN121825993B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biotechnology and relates to a... ZmCASPL11 The application of genes in improving plant heat tolerance. ZmCASPL11 The gene encodes a protein belonging to the Casparian band structure family of membrane proteins (CASPL), whose expression level is significantly upregulated under high temperature stress. Mutants of this gene... ZmCASPL11 It exhibits a high-temperature sensitive phenotype. The present invention describes... ZmCASPL11 Genes were transformed into Arabidopsis thaliana and their function was validated. Compared with wild-type Arabidopsis thaliana, overexpression of [the gene] showed [significant improvement]. ZmCASPL11 The gene significantly enhances the tolerance of Arabidopsis thaliana plants to heat stress. This invention provides more theoretical basis for research on heat resistance in maize, and offers genetic resources and biotechnological means for the subsequent breeding of new heat-resistant maize lines and the innovation of germplasm resources.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically involving ZmCASPL11 Its application in improving plant heat resistance involves, more specifically, improving... ZmCASPL11 Application of gene expression in improving plant heat tolerance. Background Technology

[0002] Ambient temperature is a major factor affecting agricultural and forestry production. High-temperature stress affects plant growth and development, ultimately leading to reduced crop yields. Under high-temperature stress, plants typically exhibit low seed germination rates and delayed growth in both vegetative and reproductive stages, and in severe cases, leaf wilting and death. Global warming is currently one of the world's major ecological and environmental problems. The assessment report of the Intergovernmental Panel on Climate Change (IPCC) of the United Nations indicates that global temperatures are projected to rise by 2.6°C to 4.8°C by the end of this century. The annual increase in ambient temperature will have a significant impact on crop yields. Understanding the high-temperature stress tolerance mechanism of maize is beneficial for the scientific breeding of heat-resistant crops, enabling crops to effectively adapt to temperature changes and thus alleviating the increasing pressure on food production.

[0003] The CASPL protein, located on the cell membrane and approximately 570 bp in size, mediates the formation of Casparian strips in the endodermis. This allows plants to precisely control the types and amounts of substances entering their vascular system through selective transport mechanisms on the endodermal cell membrane, ensuring effective nutrient absorption, isolation of harmful substances, maintenance of ion balance, and root pressure formation. Currently, no research has shown... CASPL11 Genes are related to a plant's tolerance to temperature. Summary of the Invention

[0004] The purpose of this invention is to provide ZmCASPL11 Genes in maize ( Zea mays L. Applications to improve plant heat resistance.

[0005] To achieve the above objectives, the technical solution adopted by this invention is summarized as follows:

[0006] Based on the maize whole genome sequence published on the MaizeGDB website (http: / / www.maizegdb.org / ), maize... ZmCASPL11 Nucleotide sequence information for (Sequence number: GRMZM2G056329). ZmCASPL11 The gene coding region has a nucleotide length of 570 bp, and the nucleotide sequence is shown in SEQ ID NO.1. It consists of 189 amino acids, and the amino acid sequence is shown in SEQ ID NO.2. The sequence can be obtained by searching the MaizeGDB official website.

[0007] The present invention also constructs a series of plant expression vectors, and the functions of overexpression vectors, recombinant vectors or transgenic plant lines containing the above-mentioned genes, as well as host cells containing the vectors, in improving plant heat resistance also fall within the protection scope of the present invention.

[0008] The gene functions protected by this invention include not only those described above. ZmCASPL11 Genes, including those related to ZmCASPL11 The function of homologous genes with high homology (such as above 80%; more preferably above 90%; more preferably above 95%; more preferably above 98%) in high-temperature tolerance.

[0009] This invention is based on ZmCASPL11 Primers were designed based on the CDS sequence of the gene, and a recombinant vector driven by the 35S promoter was constructed. The vector was then obtained via Agrobacterium infection. ZmCASPL11 Gene overexpression lines were analyzed. ZmCASPL11 The biological functions of overexpressed gene lines in response to high-temperature stress can provide genetic resources for molecular breeding of crop heat tolerance.

[0010] This invention discloses ZmCASPL11 The biological function of genes in improving heat resistance in maize is specifically manifested in: under high temperature stress, ZmCASPL11 Compared to the wild type, the loss-of-function mutant exhibited more severe leaf curling and wilting, as well as greater leaf damage. Specifically, its maximum photochemical efficiency (Fv / Fm) was significantly lower than that of the wild type, while its leaf damage area, ion leakage rate, proline, and malondialdehyde content were all higher. Overexpression... ZmCASPL11 The Arabidopsis thaliana plants with the gene showed significantly reduced leaf damage, significantly higher Fv / Fm values ​​than the wild type, and significantly lower ion leakage rate, proline and malondialdehyde content, as well as significantly improved heat resistance.

[0011] The above application draws conclusions by simulating high-temperature stress experiments in a temperature-controlled incubator.

[0012] Specifically, it will be driven by the 35S starter. ZmCASPL11 The recombinant gene vector p35S-ZmCASPL11-GFP was introduced into Arabidopsis thaliana using Agrobacterium-mediated transformation.

[0013] Based on its function, heat-resistant plants can be obtained through genetic modification. ZmCASPL11 Genes are introduced into plant cells, tissues, or organs, and the transformed plant material is then cultivated into complete plants, with selection based on improved heat resistance. Specifically, this can be achieved by increasing... ZmCASPL11 Gene expression in the target plant yields a transgenic plant, which exhibits higher heat resistance than the target plant.

[0014] In one embodiment of the present invention, a polynucleotide is cloned into the pCAMBIA-1300-GFP vector using conventional methods, and the recombinant vector carrying the exogenous gene is introduced into Arabidopsis thaliana to enhance the performance of Arabidopsis thaliana. ZmCASPL11 The level of gene expression, thereby improving its heat resistance.

[0015] This invention also discloses a method for improving the heat resistance of plants, by increasing the amount of heat in the plant... ZmCASPL11 The expression of genes and / or the activity of proteins they encode can enhance the heat tolerance of plants.

[0016] In addition, a plant breeding method is disclosed, wherein the method is as follows (1) or (2):

[0017] (1) By enhancing the activity of ZmCASPL11 protein in the target plant, plants with stronger heat resistance than the target plant were obtained.

[0018] (2) By increasing the content of the target plant ZmCASPL11 Gene expression was used to obtain plants with greater heat resistance than the target plant.

[0019] Preferably, the target plant is maize or Arabidopsis thaliana.

[0020] The term "plant" as used in this invention includes the whole corn plant, its parent and offspring plants, and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots, flowers, and other tissues and organs. ZmCASPL11 Both genes and nucleic acids were edited.

[0021] This invention also extends to the harvestable parts of the plants as described above, but is not limited to seeds, leaves, fruits, flowers, stems, roots, and other tissues and organs. It further relates to other derivatives of the plant after harvest, such as dried granules or powders, oils, fats and fatty acids, starches, or proteins. This invention also relates to foods or food additives obtained from the relevant plants.

[0022] Advantages of this invention:

[0023] This invention has identified a maize species using molecular biology techniques. ZmCASPL11 Genes, experiments have shown that high-temperature treatment significantly induced ZmCASPL11 Gene expression was analyzed, and then mutant materials of that gene were compared with wild-type materials. The high-temperature treatment significantly reduced the tolerance of each mutant material to high-temperature stress. Then, maize was constructed... ZmCASPL11 Gene overexpression vectors were used to transform wild-type Arabidopsis thaliana using an Agrobacterium-mediated transformation method. High-temperature stress experiments simulated in an incubator revealed the effects of overexpression. ZmCASPL11 Genes can enhance the heat resistance of plants, providing genetic resources for heat-resistant molecular breeding of maize. Attached Figure Description

[0024] Figure 1 Wild-type maize after high-temperature treatment ZmCASPL11 Gene expression levels.

[0025] Figure 2 For maize mutants ZmCASPL11 Image showing the sequencing results of the gene amplification product.

[0026] Figure 3 Wild-type maize after high-temperature treatment and zmcaspl11 Growth phenotype.

[0027] Figure 4 Wild-type maize after high-temperature treatment and zmcaspl11 Statistical results of maximum photochemical efficiency (Fv / Fm), leaf damage area, ion leakage rate, proline content, and malondialdehyde content. In the figure, A is the statistical graph of maximum photochemical efficiency (Fv / Fm); B is the statistical graph of ion penetration rate; C is the statistical result of leaf damage area; D is the statistical result of proline content; and E is the statistical result of malondialdehyde content.

[0028] Figure 5 For Arabidopsis wild type (Col-0) and ZmCASPL11 Gene overexpression lines ZmCASPL11-OE1 and ZmCASPL11-OE2 middle ZmCASPL11 Gene expression level detection.

[0029] Figure 6 For high-temperature treatment of Arabidopsis thaliana wild-type (Col-0) and ZmCASPL11 Gene overexpression lines ZmCASPL11- OE1 and ZmCASPL11-OE2 The growth phenotype.

[0030] Figure 7 For high-temperature treatment of Arabidopsis thaliana wild-type (Col-0) and ZmCASPL11 Gene overexpression lines ZmCASPL11- OE1 and ZmCASPL11-OE2 Statistical results of maximum photochemical efficiency (Fv / Fm), ion leakage rate, proline content, and malondialdehyde content. In the figure, A is the statistical graph of maximum photochemical efficiency (Fv / Fm); B is the statistical graph of ion permeability; C is the statistical graph of proline content; and D is the statistical graph of malondialdehyde content. Detailed Implementation

[0031] The principles and features of the present invention will now be described in detail with reference to the accompanying drawings. These embodiments will provide a more thorough explanation of the invention and fully convey its scope to those skilled in the art.

[0032] Unless otherwise specified, the techniques used in the embodiments are conventional methods well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used are commercially available.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0034] Unless otherwise stated, the present invention will be practiced using conventional botanical techniques, microbiological techniques, tissue culture techniques, molecular biology techniques, chemical techniques, biochemical techniques, DNA recombination techniques, and bioinformatics techniques that are readily apparent to those skilled in the art. These techniques are fully explained in the published literature, and except for the methods used in the embodiments described below, all methods disclosed in the prior art can be employed.

[0035] The wild-type Arabidopsis materials used in this experiment were all of the Arabidopsis (Arabidopsis thaliana (L.) Heynh.) Columbia-0 (Col-0) ecotype.

[0036] The wild-type maize materials used in this experiment were all maize ( zea mays.L ) Inbred line B73.

[0037] As used herein, the terms “nucleic acid,” “nucleic acid sequence,” “nucleotide,” “nucleic acid molecule,” or “polynucleotide” mean, but are not limited to, isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), naturally occurring, mutant, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, and single-stranded or double-stranded structures. These nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. “Gene” or “gene sequence” is broadly used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include coding sequences in cDNA, and / or include cDNA and its regulatory sequences. In particular embodiments, such as concerning isolated nucleic acid sequences, cDNA is preferred by default.

[0038] In addition, to provide a more intuitive understanding of the technical solution of this invention, some technical terms involved in this invention are explained as follows:

[0039] A "mutant" is an individual that has undergone a mutation and has phenotypic characteristics that differ from the wild type.

[0040] "Overexpression vector" refers to a DNA vector that uses a cloning vector as its basic framework and integrates highly efficient expression elements such as strong promoters, ribosome binding sites (RBS), and terminators to achieve overexpression of target genes in host cells.

[0041] Example 1: High Temperature Stress ZmCASPL11 Gene expression status

[0042] The cells were cultured under 12 h light / 12 h dark conditions at 25 °C and 50% relative humidity until the two-leaf-one-heart stage, then subjected to a high-temperature treatment at 45 °C. Roots were collected at 0 h, 2 h, 4 h, 6 h, 8 h, 10 h, 12 h, and 24 h, with three biological replicates at each time point. The collected leaf tissues were rapidly cryopreserved in liquid nitrogen for subsequent RNA extraction. After reverse transcription to obtain cDNA, real-time quantitative PCR (qPCR) analysis was performed. The results showed that high-temperature treatment significantly induced... ZmCASPL11 Gene expression ( Figure 1 ).according to ZmCASPL11 The cDNA sequence of the gene was used to design specific real-time quantitative PCR primers qZmCASPL11PCR-F and qZmCASPL11PCR-R. The internal reference gene was maize. ubiquitin Gene (primers used: Ubiq-F and Ubiq-R). Detected by qPCR. ZmCASPL11 The expression levels of the gene in maize inbred line B73, and the primer sequences are as follows:

[0043] qZmCASPL11PCR-F:TGTGATGTCCGAGAAGCCAAAC

[0044] qZmCASPL11PCR-R:CCGAGATGAGCGACAGAACC

[0045] Ubiq-F: TGGTTGTGGCTTCGTTGGTT

[0046] Ubiq-R:GCTGCAGAAGAGTTTTGGGTACA.

[0047] Example 2 Wild-type maize and zmcaspl11 Comparison of heat resistance of mutant strains

[0048] 2.1 zmcaspl11 Identification and Acquisition of Mutants

[0049] In order to investigate ZmCASPL11The function of the gene in maize's response to high-temperature stress was determined based on the whole genome sequence of maize published on the MaizeGDB website (http: / / www.maizegdb.org / ). ZmCaspl11 The nucleotide sequence information of the gene. Purchase EMS-mutated genes from maizeEMSDB (http: / / maizeems.qlnu.edu.cn / ). zmcaspl11 The mutant plants were identified using primers (CAGCCATCTACCTACAGGTC and CGTAGGGCATTCAGTTGAC), and homozygous seeds were obtained. Sequencing analysis revealed that the mutant had a base change from G to A at position 230226400, resulting in the replacement of glutamic acid with lysine. Figure 2 ).

[0050] 2.2 High-Temperature Treatment Method

[0051] Under conditions of 16 h light / 8 h darkness, 25 °C, 50% relative humidity, and 250 μmolm light intensity. -2 s -1 After being cultured to the two-leaf-one-heart stage under specific conditions, the plants were subjected to a 45℃ high-temperature treatment (light intensity, photoperiod, and humidity were the same as above) for 2 days, and then returned to the 25℃ incubation room for recovery for 2 days. After recovery, phenotypic images were taken, the maximum photochemical efficiency of photosystem II (Fv / Fm) was measured, the leaf damage area was counted, and the ion leakage rate, proline, and malondialdehyde content were measured.

[0052] 2.3 Phenotype after high temperature treatment

[0053] like Figure 3 As shown, after high treatment, the leaves of wild-type B73 still maintained relatively good spread and condition, with only slight curling and damage at the leaf tips; while the mutant strains... zmcaspl11 Compared to the wild type, the leaves of the cultivar exhibited more severe curling, wilting, and greater leaf damage, all showing a clear high-temperature sensitivity phenotype.

[0054] Physiological parameters were measured before and after heat stress treatment. Before treatment at 45℃, the mutant... zmcaspl11 There was no significant difference in Fv / Fm between the mutant and the wild type. After treatment at 45℃, the mutant... zmcaspl11 The Fv / Fm ratio is significantly lower than that of B73. Figure 4 (A) The leaf damage area and ion leakage rate of mutant zmcaspl11 are greater than those of wild-type B73. Figure 4 (B and C in the text). Furthermore, after high-temperature treatment, the contents of proline and malondialdehyde were both higher than in B73, which is due to the stronger cell damage experienced by the mutant after high-temperature treatment. Figure 4 (D and E in the text).

[0055] Example 3 Overexpression ZmCASPL11 Genes enhance the heat tolerance of Arabidopsis plants

[0056] 3.1 ZmCASPL11 Cloning of genes

[0057] Based on the maize whole genome sequence published on the MaizeGDB website (http: / / www.maizegdb.org / ), maize... ZmCASPL11 Nucleotide sequence information of the gene. Using cDNA from maize inbred line B73 as a template, specific amplification primers (F1: ACACGGGGGACTGAGCTCGGTACCATGTACTCATCCAGCTGCCA and R1: CACCATGTCGACTCTAGAGGATCCGTAGTAGTCGCCTGATTCCG) were designed without a stop codon. The nucleotide sequence encoding the gene was obtained by amplification using KOD1 high-fidelity enzyme. The pCAMBIA1300-GFP vector was linearized by restriction endonucleases KpnI and BamHI. The PCR product and linear vector were separated by agarose gel electrophoresis, and purified by gel extraction using a Nanjing Novizan agarose gel extraction kit. Finally, the purified... ZmCASPL11 The gene coding fragment was ligated to the linearized pCAMBIA1300-GFP vector using cloning methods. The ligation product was transformed, and the positive clones were sequenced. The recombinant plasmid with correct sequencing was named p35S-ZmCASPL11-GFP.

[0058] 3.2 Overexpression ZmCASPL11 Obtaining transgenic Arabidopsis thaliana plants

[0059] The p35S-ZmCASPL11-GFP vector was transformed into Agrobacterium GV3101 competent cells using the heat shock method. The cells were plated on solid LB medium containing 50 mg / L ampicillin and 50 mg / L kanamycin and incubated at 28°C for 2 days. Positive clones were then screened by PCR amplification using primers F1 and R1. The obtained positive clones were inoculated into liquid LB medium containing 50 mg / L ampicillin and 50 mg / L kanamycin and cultured at 28°C with shaking for 24 hours. One mL of the bacterial culture was then collected and preserved for Arabidopsis transformation.

[0060] Add 20 μL of the bacterial culture obtained in the above steps to 5 mL of liquid LB medium containing 50 mg / L ampicillin and 50 mg / L kanamycin, and incubate at 28°C with shaking until the bacterial concentration reaches OD500. 600=2.0. Then, 2 ml of the bacterial culture was transferred to 50 mL of liquid LB medium containing 50 mg / L ampicillin and 50 mg / L kanamycin, and incubated at 28°C with shaking until the bacterial concentration reached OD200. 600 =0.8-1.0. Centrifuge 50 mL of the obtained bacterial culture at 5000 rpm for 10 min, discard the supernatant, and resuspend the bacterial cells in 50 mL of infection buffer (MS powder 2.2 g / L, 5% sucrose, Silwet L-77 200 μL / L). Select healthy Arabidopsis plants that have bolted for one to two weeks, remove the siliques and open flowers, leaving the apical meristem and flower buds, immerse the treated inflorescences in the resuspended bacterial culture for 10 min, and then incubate in the dark for 12 h before proceeding with light culture.

[0061] After the Arabidopsis plants continued to grow until their leaves and branches turned completely yellow, mature seeds were collected. Plump seeds were selected, disinfected with 1 ml of 2% sodium hypochlorite solution for 10 min, the sodium hypochlorite solution was poured off, and the seeds were washed 5-7 times with sterile water. The seeds were then sown on 1 / 2 MS solid medium (50 mg / L hygromycin), vernalized at 4°C in the dark, and then placed at 22°C with a 16-hour light / 8-hour dark cycle and a light intensity of 100 μmol / m². -2 s -1 The positive seedlings that grow normally on the resistant culture medium will then be transplanted into the soil.

[0062] Genetic segregation ratio method for identifying insertion copy number: Based on genetic principles, self-crossing after a single copy insertion will produce a 3:1 segregation ratio in the offspring. Combined with statistical methods, the number of resistant and non-resistant seedlings on antibiotic culture media was counted. The segregation ratio method was used to identify transgenic plants that were lines with a single copy insertion (single copy). ZmCASPL11 Transgenic Arabidopsis thaliana can be used for screening homozygotes.

[0063] To obtain homozygous transgenic material for subsequent analysis, this study used the single-copy samples identified above. ZmCASPL11 Two transgenic Arabidopsis thaliana lines (T1 generation) were randomly selected and numbered as follows: ZmCASPL11-OE1 and ZmCASPL11-OE2 Seeds were sown for two consecutive generations on 1 / 2 MS medium containing 50 mg / L hygromycin for resistance selection. The final selection yielded parental plants whose self-pollinated progeny all exhibited hygromycin resistance, i.e., homozygous lines. This yielded the T3 generation. ZmCASPL11-OE1 and ZmCASPL11-OE2 The homozygous single-copy strain was used as material for subsequent experiments.

[0064] 3.3 Transgenic Arabidopsis plants ZmCASPL11 Detection of gene expression levels

[0065] To verifyZmCASPL11 To investigate gene expression in transgenic Arabidopsis thaliana, this study used leaves from positive transgenic plants as material. Total RNA was extracted and reverse transcribed into cDNA. qPCR was used for detection, with the Arabidopsis thaliana endogenous gene AtUBC as an internal control. Primers used included... ZmCASPL11 The sequence information of the gene-specific primers (qZmCASPL11PCR-F and qZmCASPL11PCR-R) and the internal reference gene AtUBC primers (AtUBC-F and AtUBC-R) is as follows:

[0066] qZmCASPL11PCR-F:TGTGATGTCCGAGAAGCCAAAC

[0067] qZmCASPL11PCR-R:CCGAGATGAGCGACAGAACC

[0068] AtUBC-F: CTGCGACTCAGGGAATCTTCTAA

[0069] AtUBC-R:TTGTGCCATGAATTGAACCC

[0070] qPCR analysis results showed that ZmCASPL11 The gene was not detected in the wild type (Col-0), but was expressed in both overexpressing transgenic lines. ZmCASPL11-OE1 and ZmCASPL11-OE2 Significant expression was observed in all samples ( Figure 5 The above results indicate that... ZmCASPL11 The gene has been successfully expressed in the transgenic lines, providing effective materials for subsequent analysis of heat resistance phenotypes.

[0071] 3.4 Overexpression ZmCASPL11 Analysis of heat tolerance phenotypes in Arabidopsis thaliana plants

[0072] To investigate Arabidopsis thaliana ZmCASPL11 The effect of gene overexpression on heat tolerance was investigated in this study on wild-type (Col-0) and two independent homozygous overexpression lines (Col-0 and Col-0). ZmCASPL11-OE1 and ZmCASPL11-OE2 A systematic phenotypic analysis of high temperature stress was conducted.

[0073] Arabidopsis seeds were sown on 1 / 2 MS solid medium and vernalized at 4°C in the dark for 3 days. Then, they were transferred to a light incubator (22°C, 16 h photoperiod / 8 h dark, light intensity 100 μmol·m⁻²·s⁻¹) for 7 days. The seedlings were then transplanted to potting soil and continued to grow under the same conditions for 3 weeks. Afterward, the plants were divided into two groups: a control group was grown under normal conditions; the treatment group was subjected to high-temperature stress (45°C, 48 h), followed by a return to 22°C for 2 days to observe phenotypic changes.

[0074] like Figure 6 As shown, under normal growth conditions, wild type and ZmCASPL11 Overexpression lines ( ZmCASPL11-OE1 and ZmCASPL11-OE2 There was no significant difference in growth among the wild-type plants. After high-temperature treatment, the wild-type plants exhibited severe leaf curling, wilting, yellowing and whitening, and extensive damage, demonstrating a clear high-temperature sensitivity phenotype. In contrast, the overexpression lines showed significantly less leaf damage and a better overall phenotype than the wild-type, indicating stronger heat tolerance. Before high-temperature treatment, there was no significant difference in Fv / Fm values ​​among the lines; after high-temperature treatment, the Fv / Fm values ​​of all lines decreased, but the Fv / Fm values ​​of the overexpression lines were significantly higher than those of the wild-type. Figure 7 In addition, the ion leakage rate, proline content, and malondialdehyde content of the overexpression lines under high temperature stress were significantly lower than those of the wild type (A). Figure 7 (B, C, and D) indicate that their cell membranes suffered less damage from high temperatures. These results suggest that overexpression... ZmCASPL11 It can effectively reduce leaf damage in Arabidopsis thaliana under high temperature stress, maintain high photosystem II efficiency, reduce membrane lipid peroxidation, and thus significantly enhance the heat resistance of the plant.

[0075] The above description is only a preferred embodiment of the present invention and is used only to explain the present invention. It is not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. All changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. Overexpression ZmCASPL11 The application of genes in improving plant heat tolerance is characterized by, The ZmCASPL11 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the plant is Arabidopsis thaliana.

2. The application according to claim 1, characterized in that, By constructing the p35S-ZmCASPL11-GFP expression vector and using the 35S promoter to drive... ZmCASPL11 Overexpression of genes results in transgenic plants with improved heat resistance.

3. The application according to claim 1, characterized in that, The application specifically includes: [the following is a description of the application]. ZmCASPL11 Genes are introduced into plant cells, tissues, or organs, and the transformed plant material is then cultivated into a complete plant, with plant material that exhibits improved heat resistance being screened.

4. The application according to claim 1, characterized in that, The improved heat resistance is manifested in the following way: under high temperature stress, overexpression of... ZmCASPL11 The genetically modified plants showed significantly reduced leaf damage, significantly higher maximum photochemical efficiency than the wild type, and significantly lower ion leakage rate, proline and malondialdehyde content.

5. A method for improving the heat resistance of plants, characterized in that, By increasing the plant ZmCASPL11 The expression of genes and / or the activity of their encoded proteins enhance the heat tolerance of plants. ZmCASPL11 The nucleotide sequence of the gene is shown in SEQ ID NO.1, the amino acid sequence of the protein is shown in SEQ ID NO.2, and the plant is Arabidopsis thaliana.

6. A plant breeding method, characterized in that, The method is as follows (1) or (2): (1) By enhancing the activity of ZmCASPL11 protein in the target plant, plants with stronger heat resistance than the target plant were obtained. (2) By increasing the content of the target plant ZmCASPL11 Gene expression was used to obtain plants with greater heat resistance than the target plant. The ZmCASPL11 The nucleotide sequence of the gene is shown in SEQ ID NO.1, the amino acid sequence of the ZmCASPL11 protein is shown in SEQ ID NO.2, and the target plant is Arabidopsis thaliana.