Fritillaria cirrhosa cholesterol 22 (R)-hydroxylase FcircCYP90B27 gene and application thereof

Abstract

The invention relates to a fritillaria cirrhosa cholesterol 22 (R)-hydroxylase FcircCYP90B27 gene and application thereof, and belongs to the technical field of biology. The nucleotide sequence of the fritillaria cirrhosa cholesterol 22 (R)-hydroxylase FcircCYP90B27 gene is as shown in SEQ ID NO. 1, and the amino acid sequence of the encoded protein is as shown in SEQ ID NO. 2. The fritillaria cirrhosa cholesterol 22 (R)-hydroxylase FcircCYP90B27 gene disclosed by the invention can be used as a biosynthesis regulation gene of 22 (R)-hydroxycholesterol, is applied to preparation of 22 (R)-hydroxycholesterol, and is remarkable in application prospect and easy to popularize and apply.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biotechnology, and particularly relates to a Fritillaria cirrhosa D. Don cholesterol 22(R)-hydroxylase FcirCYP90B27 gene and application. BACKGROUND

[0002] Fritillaria cirrhosa D. Don belongs to a perennial herbaceous plant of the genus Fritillaria in Liliaceae. Fritillaria cirrhosa D. Don is a famous Chinese medicinal material, which has the effects of clearing heat and moistening lung, reducing phlegm and relieving cough, and resolving nodules and abscesses. Steroidal alkaloids are the main components of Fritillaria cirrhosa D. Don, which have the effects of clearing heat and reducing phlegm, moistening lung and relieving cough. In addition, Fritillaria cirrhosa D. Don also contains other compounds, such as pinozocimine, pinozocimine, fritillarine, and xibeisin. Steroidal alkaloids are secondary metabolites of plants, which are involved in the regulation of plant communication and defense, and are also the main bioactive components of some traditional Chinese medicines. For example, xibebinine isolated from Fritillaria cirrhosa D. Don is a new type of anticancer drug that can inhibit the proliferation of human tumor cells. However, the acquisition of steroidal alkaloids such as xibebinine in Fritillaria cirrhosa D. Don mainly depends on plant extraction and chemical synthesis. However, due to the low content, difficulty in extraction, and complex chemical structure, the efficiency of chemical synthesis is also low. This leads to the shortage of xibebinine, and the consumption of wild resources is extremely large.

[0003] Due to the rapid development of metabolic engineering, the important role of yeast cells in the synthesis of plant secondary metabolites is further demonstrated, providing a new way for the heterologous production of high-value chemical drugs. Yeast has the advantages of rapid growth, maturity, easy genetic manipulation, and food-grade safety, and is widely used in various chemical research. At present, it has been used to synthesize terpenes and steroids. Cholesterol, as one of the earliest discovered steroids, is a direct precursor of various steroidal compounds, such as plant-derived steroidal saponins and steroidal alkaloids. Cholesterol is one of the most common compounds in plants and animals, but its synthesis in plants and animals is different. In animals, the precursor of cholesterol synthesis is lanosterol generated by lanosterol synthase (LAS) catalysis of 2,3-oxidized squalene, while in plants, the precursor is cycloartenol generated by cycloartenol synthase (CAS) catalysis. The hydroxylation product of C-22 of cholesterol is one of the important intermediates of steroidal alkaloid biosynthesis, and therefore is of great concern. Synthetic biology is a key way to produce pharmacological monomers. Using synthetic biology to obtain isosteroidal alkaloids not only can alleviate the shortage of wild resources of Fritillaria cirrhosa D. Don, promote the sustainable development of its industry, but also can greatly improve its yield.

[0004] Therefore, how to overcome the shortcomings of the prior art is a problem that needs to be solved in the field of biotechnology at present. SUMMARY

[0005] The present application aims at solving the problems of the prior art, and provides a FcirCYP90B27 gene of Fuzhuanbeimu cholesterol 22(R)-hydroxylase and application thereof.

[0006] To achieve the above object, the present application adopts the following technical scheme: The present application provides a FcirCYP90B27 gene of Fuzhuanbeimu cholesterol 22(R)-hydroxylase in the first aspect, and the nucleotide sequence of the FcirCYP90B27 gene of Fuzhuanbeimu cholesterol 22(R)-hydroxylase is shown in SEQ ID NO. 1.

[0007] The present application provides a coding protein of the FcirCYP90B27 gene of Fuzhuanbeimu cholesterol 22(R)-hydroxylase in the second aspect, and the amino acid sequence of the coding protein is shown in SEQ ID NO. 2.

[0008] The present application provides a recombinant plasmid containing the FcirCYP90B27 gene of Fuzhuanbeimu cholesterol 22(R)-hydroxylase in the third aspect.

[0009] Further, the FcirCYP90B27 gene of Fuzhuanbeimu cholesterol 22(R)-hydroxylase is homologously recombined with a YCplac33 vector to obtain a Y33-FcirCYP90B27 recombinant plasmid.

[0010] The present application provides a genetically engineered bacterium containing the recombinant plasmid or having the exogenous FcirCYP90B27 gene of Fuzhuanbeimu cholesterol 22(R)-hydroxylase integrated in the genome in the fourth aspect.

[0011] Further, the genetically engineered bacterium is an Escherichia coli DH5α strain and a cholesterol yeast strain Vg13.

[0012] The present application provides a cholesterol 22(R)-hydroxylase encoded by the FcirCYP90B27 gene of Fuzhuanbeimu cholesterol 22(R)-hydroxylase in the fifth aspect.

[0013] The present application provides an application of the FcirCYP90B27 gene of Fuzhuanbeimu cholesterol 22(R)-hydroxylase in the preparation of 22(R)-hydroxycholesterol in the sixth aspect.

[0014] Further, the hydroxylation reaction is carried out on the C-22 position of cholesterol under the catalysis of the cholesterol 22(R)-hydroxylase encoded by the FcirCYP90B27 gene of Fuzhuanbeimu cholesterol 22(R)-hydroxylase, and 22(R)-hydroxycholesterol is generated.

[0015] The FcirCYP90B27 gene of the Fritillariae cirrhosae cholesterol 22(R)-hydroxylase FcirCYP90B27 gene is identified from Fritillariae cirrhosae through transcriptome sequencing and bioinformatics technology after a large number of experiments screening; the RNA of Fritillariae cirrhosae is extracted by using an RNA kit, and the cDNA is reversely converted and then subjected to PCR amplification to obtain the FcirCYP90B27 gene. 5'F: atggcactagagctgcttct; 3'R: ttagttgatggcacggacct; In addition, when homologous recombination is carried out with the YCplac33 vector, the FcirCYP90B27 gene needs to be amplified and recovered by using a primer with a homologous arm, and the primer with a homologous arm is as follows: 5'F: cagtcgacctcgaatctagaatggcactagagctgcttct; 3'R: atgatgcggccctctagattagttgatggcacggacct; The FcirCYP90B27 gene isolated and identified from Fritillariae cirrhosae can be used as an important marker gene for molecular assisted breeding of Fritillariae cirrhosae, and can also be used as an important candidate gene for production of 22(R)-hydroxycholesterol in a yeast chassis cell construction.

[0016] Compared with the prior art, the present application has the following beneficial effects: (1) The function of the FcirCYP90B27 gene is determined, the gene can hydroxylate the C22 position of cholesterol to produce 22(R)-hydroxycholesterol, which is an important precursor for the synthesis of sinomine, and the key precursor 22(R)-hydroxycholesterol for biosynthesis of steroids alkaloids may be a key step for biological mass synthesis of sinomine; (2) Compared with the difficulty of directly extracting from Fritillariae cirrhosae plants, the method of synthetic biology can not only improve the production efficiency of the required compounds, increase the yield, and reduce the production cycle, but also lay an important foundation for analyzing the complete pathway of Fritillariae cirrhosae isosteroids alkaloids; (3) Yeast can integrate key enzyme genes of plant secondary metabolites, and can reconstruct a complete synthesis pathway. Compared with prokaryotes (such as Escherichia coli), the yeast used in the present application has a post-translational modification system of eukaryotes, which can ensure the activity of plant-derived enzymes; the metabolic background is clear, the reproduction speed is fast, and the secondary metabolites can be greatly improved in yield through large-scale fermentation. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 Diagram of the biosynthetic pathway of 22(R)-hydroxycholesterol; Figure 2 This is a schematic diagram of the construction of the Y33-FcirCYP90B27 recombinant plasmid (used to express the gene encoding Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27). Figure 3 Gel electrophoresis images of FcirCYP90B27 gene amplification and its recombinant vector detection; A is the gel electrophoresis image of FcirCYP90B27 gene amplification, where M: DNA Marker, Markers (from bottom to top): 100bp, 250bp, 500bp, 750bp, 1000bp, 1500bp, 2000bp, 3000bp, 5000bp; Lane 1 is the FcirCYP90B27 gene amplification band, all with a length of 1000-1500bp; B is a PCR gel electrophoresis image of positive bacteria selected by the Y33-FcirCYP90B27 recombinant plasmid; where M: DNA Marker, Marker (from bottom to top): 100bp, 250bp, 500bp, 750bp, 1000bp, 1500bp, 2000bp, 3000bp, 5000bp; lanes 1 to 8 are 8 positive transformed colonies of the selected Y33-FcirCYP90B27 recombinant plasmid, all of which are 1000-1500bp.

[0018] Figure 4 The following are LC-MS analyses of the chemical composition of the fermentation products converted from lithium acetate by Y33-FcirCYP90B27: A is the LC-MS mass spectrum, where 22(R)-hydroxycholesterol is the LC-MS peak time of the standard 22(R)-hydroxycholesterol, Vg13+Y33 is the LC-MS peak time of the empty control group, and Vg13+FcirCYP90B27 is the LC-MS peak time of the shake-flask fermentation products of the Y33-FcirCYP90B27 recombinant plasmid lithium acetate-transformed strain; B is the mass spectrum characteristic of the standard 22(R)-hydroxycholesterol; C is the mass spectrum characteristic of the shake-flask fermentation products of the Y33-FcirCYP90B27 recombinant plasmid lithium acetate-transformed strain. Detailed Implementation

[0019] The present invention will now be described in further detail with reference to the embodiments.

[0020] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in the field or according to the product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be obtained by purchase.

[0021] The culture medium used in this invention: LB liquid medium: 10 g / L tryptone + 5 g / L yeast extract + 10 g / L sodium chloride; LB solid medium: 10 g / L tryptone + 5 g / L yeast extract + 10 g / L sodium chloride + 15 g / L agar powder; SC-His-Leu-Ura Deficient Liquid Culture Medium: 6.7 g / L yeast basal nitrogen source (YNB) + 0.1 g / L arginine + 0.1 g / L cysteine ​​+ 0.1 g / L lysine + 0.1 g / L threonine + 0.05 g / L aspartic acid + 0.05 g / L isoleucine + 0.05 g / L phenylalanine + 0.05 g / L proline + 0.05 g / L serine + 0.05 g / L tyrosine + 0.05 g / L valine + 0.05 g / L methionine + 0.1 g / L tryptophan + 0.2 g / L adenine + 2% v / v glucose, pH=5.6; SC-His-Leu-Ura Deficit Solid Medium: 6.7 g / L yeast basal nitrogen source (YNB) + 0.1 g / L arginine + 0.1 g / L cysteine ​​+ 0.1 g / L lysine + 0.1 g / L threonine + 0.05 g / L aspartic acid + 0.05 g / L isoleucine + 0.05 g / L phenylalanine + 0.05 g / L proline + 0.05 g / L serine + 0.05 g / L tyrosine + 0.05 g / L valine + 0.05 g / L methionine + 0.1 g / L tryptophan + 0.2 g / L adenine + 2% v / v glucose + 20 g / L agar powder, pH=6.5.

[0022] Based on previous transcriptome sequencing data, open reading frames (ORFs) and sequence analysis were performed on candidate CYP90B subfamily genes in Fritillaria cirrhosa using the NCBI online tool (https: / / www.ncbi.nlm.nih.gov / orffinder / ). Primers specific for the full-length coding region of the gene were designed using the sequence analysis software SnapGene 3.2.1 and introduced into the homologous arm of the YCplac33 vector. Following a series of procedures including cDNA preparation, candidate gene amplification and recovery, homologous recombination, yeast transformation, bacterial water detection, shake-flask fermentation and product extraction, and LC-MS detection, the gene was finally identified as catalyzing the hydroxylation reaction at the C-22 position of cholesterol to generate 22(R)-hydroxycholesterol (C-22). Figure 1 The FcirCYP90B27 is used. The operating steps for each stage are as follows: (1) Preparation of cDNA template Bulbs of Fritillaria cirrhosa were collected, sliced, and flash-frozen in liquid nitrogen for RNA extraction. Total RNA was extracted using the HiPure HP Plant RNA Mini Kit from Guangzhou Meiji Biotechnology Co., Ltd. RNA was extracted according to the kit's instructions. After passing quality tests, the RNA was reverse transcribed into cDNA using the TAKARA reverse transcription kit and stored at -20ºC for later use.

[0023] (2) Gene amplification and recovery The ORF (open reading frame) of candidate CYP genes from Fritillaria cirrhosa was identified using the NCBI online tool (https: / / www.ncbi.nlm.nih.gov / orffinder). The recombinant FcirCYP90B27 gene expression vector Y33-FcirCYP90B27 was designed using the sequence analysis software SnapGene 3.2.1. Figure 2 Primers for specific amplification of the full-length coding region of the gene were designed and introduced into the homologous arm of the YCplac33 vector. Specific primer information: Upstream primer 5'F: cagtcgacctcgaatctagaatggcactagagctgcttct; (SEQ ID NO.3) Downstream primer 3'R: atgatgcggccctctagattagttgatggcacggacct. (SEQ ID NO.4) Using the previously reverse transcribed cDNA as a template, the gene was amplified using DNA polymerase (phanta enzyme).

[0024] The amplification system consisted of: 2 μL cDNA, 25 μL 2×phantaMax Master mix, 2 μL each of upstream and downstream primers (10 μmol / L), and ddH2O to a final volume of 50 μL. The amplification program was as follows: 95ºC, 3 min; 95ºC, 15 s; 58ºC, 15 s; 72ºC, 50 s; 30 cycles; 72ºC, 5 min.

[0025] After the PCR amplification procedure, the amplified gene band and the target gene band were checked for consistency using 1.2% w / v agarose gel electrophoresis. After agarose gel electrophoresis, a clear and bright band appeared at approximately 1500 bp using the DNA marker as a scale, which was similar in length to the target gene band (1452 bp). Figure 3 (A) indicates good amplification effect. The target gene fragment was recovered and purified using a gel extraction kit from GenStar. The concentration of the recovered fragment was determined using a NanoDrop 2000 instrument and stored at -20°C.

[0026] (3) Construction and identification of gene recombination vectors A. Vector linearization: The YCplac33 vector was linearized by single-enzyme digestion with XbaⅠ restriction endonuclease. The reaction conditions were 37℃ for 1 h, and then terminated by heating at 65℃ for 5 min.

[0027] Enzyme digestion system: 2 μL XbaⅠ restriction endonuclease; 2 μL 10×CutSmart Buffer; 5 μL YCplac33 vector; 11 μL ddH2O.

[0028] After verification by agarose gel electrophoresis, the enzyme digestion products were purified and recovered using the OMEGA EZNA® Cycle Pure Kit. The DNA concentration was measured using the NanoDrop2000 instrument and stored at -20°C for long-term storage.

[0029] B. Gene Recombination: Using the Seamless Cloning MasterMix kit from Sangon Biotech (Shanghai) Co., Ltd., the amplified target gene fragment was ligated into the YCplac33 linearized vector at the recommended molar ratio (3:1) according to the reagent instructions. The reaction system is shown in Table 1. After incubation at 50℃ for 30 min, the recombinant plasmid was constructed, yielding the Y33-FcirCYP90B27 recombinant plasmid.

[0030] Table 1

[0031] The conversion steps at the end of the reaction are as follows: Thaw DH5α competent cells stored at -80℃ in an ice bath, add 5 μL of homologous recombination ligation reaction solution, gently mix, and incubate on ice for 30 min; quickly transfer the centrifuge tube to a 42℃ metal bath for heat shock for 40-90 s, precisely control the time, and immediately return it to the ice bath for 3 min; add 450 μL of LB liquid medium to the centrifuge tube, shake at 37℃ and 200 r / min for 60 min, centrifuge at 5000×g for 1 min to collect the cells, discard 400 μL of supernatant, and spread the remaining bacterial suspension evenly on LB solid medium containing 100 ug / mL ampicillin and incubate upside down in a 37℃ incubator.

[0032] Recombinant screening and validation: Colony PCR identification: In a clean bench, eight single colonies were randomly picked from a transformation plate using a sterile pipette tip and inoculated into PCR tubes containing 20 μL of ddH2O. The colonies were repeatedly pipetted to ensure complete suspension. 3 μL of the bacterial suspension was transferred to a new sterile PCR tube as a template for PCR identification. The PCR identification used was 2×Taq Master Mix enzyme from Nanjing Novizan Biotechnology Co., Ltd. The reaction system consisted of: 12.5 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers (10 μmol / L), 3 μL of bacterial suspension as template, and ddH2O to a final volume of 25 μL.

[0033] Identification primer sequences: 5'F: ctggcacgacaggtttccc; (SEQ ID NO.5) 3'R: gagaaaataccgcatcaggcgc; (SEQ ID NO.6) The PCR program was 95℃ for 3 min; 95℃ for 30 s, 58℃ for 15 s, 72℃ for 50 s, 30 cycles; 72℃ for 5 min.

[0034] After the reaction procedure, the length of the PCR products was determined by 1% w / v agarose gel electrophoresis. The 1% w / v agarose gel electrophoresis showed a clear and bright band at approximately 1500 bp in lanes 1-8, using the DNA marker as a scale. Clones matching the expected target fragment (1452 bp) were identified as positive recombinants. Figure 3 (B) The sequencing of the PCR reaction stock solution corresponding to the positive band was performed by Sangon Biotech Co., Ltd. The sequencing results were compared and analyzed with the target gene sequence using DNAMAN software. The results showed that the gene ligation was successful, there were no mutations, and the selected single colonies were positive bacteria, indicating that the assembly was successful.

[0035] The remaining 17 μL of bacterial solution from the PCR-verified positive colonies was added to 5 mL of LB broth containing 100 μg / mL ampicillin and incubated overnight at 37°C and 220 rpm for 12–16 h on a shaker. After the bacterial suspension became turbid, 4 mL of the suspension was taken for plasmid extraction in a clean bench. The plasmid extraction kit used was the ready-to-use Steadure plasmid extraction kit from Wuhan Aireco Biotechnology Co., Ltd. The extracted plasmids were stored at -20°C. The remaining 1 mL of bacterial suspension was added to 1 mL of 50% v / v sterile glycerol and stored at -80°C for later use.

[0036] (4) Conversion of lithium acetate in yeast chassis The recombinant plasmid Y33-FcirCYP90B27 was transformed into *Saccharomyces cerevisiae* strain Vg13 using the lithium acetate transformation method. A blank control group was also established, in which the empty vector YCplac33 was transformed into *Saccharomyces cerevisiae* strain Vg13. The transformed cells were then plated onto SC-His-Leu-Ura deficient solid medium and incubated at 30°C inverted for 2-3 days until transformants appeared. Single colonies were picked and incubated overnight for 12-16 hours until turbidity was achieved, followed by screening for positive transformants.

[0037] (5) Shake flask fermentation The bacterial culture (1 mL) of the positive transformants screened by lithium acetate conversion in the previous step was inoculated into 50 mL of SC-His-Leu-Ura deficient liquid medium and cultured on a shaker at 30℃ and 220 r / min for 5-7 days. The bacterial cells were collected by centrifugation at 4℃ and 5000×g for 15 min.

[0038] (6) Extraction of fermentation products The bacterial cells collected in the previous step were resuspended in 10 mL of methanol and sonicated in an ice bath for 30 min. The lysate was centrifuged at 5000 g for 20 min at 4 °C, and the supernatant was collected to obtain the methanol extract. The methanol extract was transferred to a separatory funnel, an equal volume of ethyl acetate was added, and the mixture was shaken and extracted for 10 min. After standing and separating the layers, the organic phase was collected. The extraction was repeated 3 times, and the organic phases were combined to obtain the extract.

[0039] The extract was rotary evaporated to dryness at 40°C, and the residue was dissolved in 2 mL of methanol, filtered through a 0.22 μm organic filter membrane, and then used for LC-MS analysis.

[0040] (7) Product testing The LC-MS detection conditions are as follows: The analysis was performed using an Agilent 1290 UPLC / 6540 Q-TOF liquid chromatography-mass spectrometry system, with the following specific parameters: Mass spectrometry detection conditions: Ion source: electrospray positive ion mode (ESI+); Spray voltage: 3.5 kV; fragmentation voltage: 135 V; cone voltage: 60 V; radio frequency capillary voltage: 750 V; scan range: 100–1000 m / z; scan mode: selected reaction monitoring (SRM); column: Waters XBridge C18 (4.6 × 150 mm, 5 μm); column temperature: 30 °C.

[0041] Chromatographic separation conditions: Column: Waters XBridge C18 reversed-phase column (4.6 mm × 150 mm, 5 μm); Column temperature: 25℃; UV absorption peak: 203 nm; Mobile phase: Phase A: pure water, Phase B: methanol (chromatographic grade); Elution program: 0~45 min, 80%–20% A; 45~70 min, 95%–5% A; During elution, the gradient change was linear; Flow rate: 0.3 mL / min; Injection volume: 15 μL.

[0042] The shake-flask fermentation products were analyzed by LC-MS, and the results are as follows: Figure 4 As shown. Analysis revealed that the elution time of the product from shake-flask fermentation of the Y33-FcirCYP90B27 recombinant plasmid transformed into the cholesterol yeast strain Vg13 (13.34 min) was consistent with that of the standard 22(R)-hydroxycholesterol (13.34 min), while no new product peak was detected in the blank control group. Figure 4 (A). Further determination of the molecular weight of the new product revealed that an engineered strain transformed with the Y33-FcirCYP90B27 recombinant plasmid using the cholesterol yeast strain Vg13 as the chassis strain detected a characteristic chromatographic peak at a mass-to-charge ratio of 425.3395 [M+Na]+. Figure 4 The LC-MS spectrum of the 22(R)-hydroxycholesterol standard was positive (C), while no corresponding signal was detected in the blank control group. Furthermore, this mass spectrometry characteristic perfectly matched the LC-MS spectrum of the 22(R)-hydroxycholesterol standard. Figure 4 B, Figure 4 (C)

[0043] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A gene for FcirCYP90B27, a cholesterol 22(R)-hydroxylase from Fritillaria cirrhosa, characterized in that... The nucleotide sequence of the Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene is shown in SEQ ID NO.

1.

2. The protein encoded by the Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene as described in claim 1, characterized in that, The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. A recombinant plasmid containing the Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene as described in claim 1.

4. The recombinant plasmid containing the Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene according to claim 3, characterized in that, The FcirCYP90B27 gene of cholesterol 22(R)-hydroxylase from Fritillaria cirrhosa was homologously recombined with the YCplac33 vector to obtain the Y33-FcirCYP90B27 recombinant plasmid.

5. A transgenic engineered bacterium containing the recombinant plasmid as described in claim 3, or wherein the genome of the transgenic engineered bacterium is integrated with an exogenous Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene as described in claim 1.

6. The genetically engineered bacteria according to claim 5, characterized in that, The genetically engineered bacteria are Escherichia coli DH5α strain and Cholesterol Yeast strain Vg13.

7. The cholesterol 22(R)-hydroxylase encoded by the Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene as described in claim 1.

8. The use of the Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene as described in claim 1 in the preparation of 22(R)-hydroxy cholesterol.

9. The application of the Fritillaria cirrhosa cholesterol 22(R)-hydroxylase FcirCYP90B27 gene according to claim 8 in the preparation of 22(R)-hydroxycholesterol, characterized in that: Using cholesterol as a substrate, 22(R)-hydroxylase encoded by the cholesterol 22(R)-hydroxylase gene of Fritillaria cirrhosa is used to hydroxylate cholesterol at the C-22 position to generate 22(R)-hydroxy cholesterol.

Images