Recombinant vector for expressing nano antibody, recombinant plant lactobacillus and application of recombinant vector and recombinant plant lactobacillus
By constructing a recombinant vector containing the PY3 promoter and SP signal peptide in *Lactobacillus plantarum*, stable expression of PD-L1 and CTLA-4 nanobodies was achieved, solving the problems of weak targeting and unstable expression in existing technologies, enhancing anti-tumor efficacy and improving safety.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-12
- Publication Date
- 2026-04-14
AI Technical Summary
In existing technologies, *Lactobacillus plantarum* as a tumor therapy carrier has limitations such as weak targeting, high cost, and strong toxic side effects. Furthermore, nanobodies are not easily expressed in bacterial genomes, making it difficult to express multiple nanobodies simultaneously and efficiently.
A recombinant vector was constructed and integrated into the bsh site of *Lactobacillus plantarum*. The vector contained a PY3 promoter, an SP signal peptide, a nanobody encoding gene, and a terminator. The nanobody expression cassette was integrated into the genome via homologous recombination to ensure stable expression of PD-L1 and CTLA-4 nanobodies. Plasmids and resistance genes were removed.
Stable secretory expression of PD-L1 and CTLA-4 nanobodies was achieved, enhancing the anti-tumor effect. It has high safety, is suitable for human treatment, and is convenient to use by injection or feeding.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the fields of genetic engineering and bioengineering technology, and in particular to a recombinant vector for expressing nanobodies, recombinant Lactobacillus plantarum, and their uses. Background Technology
[0002] Cancer treatment is expensive, with low cure rates and short survival times, posing a major challenge to the medical community. Tumor cells grow and metabolize rapidly, but their internal environment is relatively hypoxic, creating favorable conditions for the selective colonization of anaerobic bacteria. *Lactobacillus plantarum*, an anaerobic bacterium with high safety for humans, can serve as a carrier for targeting tumors and producing cancer-treating immune genes.
[0003] In recent years, immune checkpoint blockade therapy has achieved remarkable results in the treatment of tumors, and the combination therapy of programmed death-ligand-1 (PD-L1) and cytotoxic T-lymphocyte-associated protein-4 antibody (CTLA-4) has been approved for clinical use. However, this therapy has limitations such as high cost, strong toxic side effects, and weak targeting.
[0004] Therefore, there is an urgent need to construct recombinant plant milk stem strains that can synthesize antibodies and automatically target tumors. Summary of the Invention
[0005] In view of the shortcomings of the prior art, the purpose of this invention is to provide a recombinant vector for expressing nanobodies, recombinant Lactobacillus plantarum and its uses, in order to solve the problems in the prior art.
[0006] To achieve the above and other related objectives, a first aspect of the present invention provides a recombinant vector for expressing nanobodies in *Lactobacillus plantarum*, the recombinant vector being targeted and integrated into the bsh site of *Lactobacillus plantarum*, the recombinant vector comprising a nanobodies expression cassette having the following elements: a PY3 promoter, an SP signal peptide, a gene encoding a first nanobodies, RBS, an SP signal peptide, a gene encoding a second nanobodies, and a terminator.
[0007] Another aspect of the present invention provides a recombinant Lactobacillus plantarum expressing nanobodies, wherein the recombinant Lactobacillus plantarum genome has a bsh site integrated with a nanobodies expression cassette as described above.
[0008] Another aspect of the present invention provides a method for constructing recombinant *Lactobacillus plantarum* as described above, the method comprising: converting a recombinant vector into a substrate culture to obtain the recombinant *Lactobacillus plantarum*.
[0009] Another aspect of the present invention provides the use of the recombinant vector as described above or the recombinant Lactobacillus plantarum as described above in the preparation of nanobody delivery vectors.
[0010] Another aspect of the present invention provides a product comprising at least one of the following:
[0011] A1) Microbial agents, said microbial agents including recombinant Lactobacillus plantarum as described above;
[0012] A2) The composition comprises recombinant Lactobacillus plantarum as described above and / or the bacterial agent as described in A1).
[0013] Another aspect of the present invention provides the use of recombinant Lactobacillus plantarum as described above and / or the product as described above in the preparation of antitumor drugs.
[0014] As described above, the recombinant carrier for expressing nanobodies, recombinant *Lactobacillus plantarum*, and their uses according to the present invention have the following beneficial effects:
[0015] 1) The PD-L1 and CTLA-4 nanobody genes of the recombinant Lactobacillus plantarum of the present invention are integrated into the chromosome of Lactobacillus plantarum. There are no plasmids or resistance genes. The secretion expression is stable, the safety is high, and it can be used for human treatment.
[0016] 2) The recombinant plant lactobacillus of the present invention can enter the tumor by injection or feeding, which is convenient to use.
[0017] 3) The metabolites of the recombinant Lactobacillus plantarum of the present invention can cooperate with nanobodies expressing PD-L1 and CTLA-4 to enhance the anti-tumor effect. Attached Figure Description
[0018] Figure 1 The diagram shown is a schematic representation of the construction process of the integrated expression principle diagram of the present invention.
[0019] Figure 2 The image shown is a Western blotting result of the recombinant *Lactobacillus plantarum* of the present invention.
[0020] Figure 3 The results show the antitumor effect of the recombinant Lactobacillus plantarum of the present invention in a colon cancer model mouse.
[0021] Figure 4 The image shown is a Western blotting result of Comparative Example 1 of this invention.
[0022] Figure 5 The image shown is a Western blotting result of Comparative Example 2 of this invention. Detailed Implementation
[0023] In recent years, bacterial therapy has been widely studied as an emerging anti-tumor therapy. *Lactiplantibacillus plantarum* possesses the ability to target tumors and kill tumor cells, making it a highly promising tumor treatment vector. However, *Lactiplantibacillus plantarum* alone cannot completely inhibit tumor growth.
[0024] Nanobodies are antibody fragments found in camels that contain only the variable region (VHH) of a heavy chain antibody (HCAb). They are characterized by their small molecular weight, simple structure, high antigen-binding affinity, and high stability even under extreme conditions. Therefore, nanobodies have attracted widespread attention in numerous research fields, particularly in disease diagnosis and treatment, and are also widely used in bacterial therapy.
[0025] Currently, the reported methods for releasing nanobody drugs in bacterial therapies involve the lysis of genetically engineered bacteria. Although nanobodies have small molecular weights and simple structures, the simultaneous integration of multiple nanobody genes into the bacterial genome can lead to interference between genes, such as competition for transcriptional regulatory elements and mutual influence on gene expression levels. This can result in insufficient or unstable expression of some nanobodies, or even the inability to express multiple nanobodies simultaneously.
[0026] Promoters are crucial genomic regulatory elements that directly influence gene expression levels. In bacteria, RNA polymerases and related Sigma factors recognize promoters and are recruited by regulating the binding of proteins to specific sites within the promoter. Besides promoters, elements such as ribosome-binding sites (RBSs) and signal peptides also affect protein expression. Therefore, further optimization of these elements is necessary for nanobody expression.
[0027] A first aspect of the present invention provides a recombinant vector for expressing nanobodies in *Lactobacillus plantarum*, the recombinant vector being targeted and integrated into the bsh site of *Lactobacillus plantarum*, the recombinant vector comprising a nanobodies expression cassette having the following elements: a PY3 promoter, an SP signal peptide, a gene encoding a first nanobodies, RBS, an SP signal peptide, a gene encoding a second nanobodies, and a terminator.
[0028] The applicant has screened and optimized promoters and signal peptides. They studied nanobody expression cassettes formed with PY3, P32, PFRL, and PG as promoters and SP as the signal peptide, respectively, to express the first and second nanobodies. The results showed that when the promoters were P32, PFRL, and PG, the first nanobody was not expressed; only when the promoter was PY3 could the first nanobody be correctly expressed. Furthermore, they studied nanobody expression cassettes formed with SP, SP3, and USP45 as signal peptides and PY3 as the promoter, respectively, to express the first and second nanobodies. The results showed that when the signal peptides were SP3 and USP45, the second nanobody was not expressed; only when the signal peptide was SP could the second nanobody be correctly expressed. Only by constructing nanobody expression cassettes with PY3 as the promoter and SP as the signal peptide can recombinant *Lactobacillus plantarum* stably secrete and express the first and second nanobodies.
[0029] The recombinant vector of this invention uses the PY3 promoter as the core element for transcription initiation, which can be specifically recognized and bound by RNA polymerase, efficiently driving the transcription of the first and second nanobodies. During translation, the host ribosome recognizes and binds to RBS, synthesizing the first and second nanobodies precursor proteins with their respective N-terminal SP signal peptides. The N-terminal SP signal peptide of each precursor protein is recognized by signal recognition particles during translation, guiding the ribosome-nascent peptide chain complex to the Sec translocation channel on the cell membrane, achieving co-translational transport. After the nanobodies precursor proteins cross the cell membrane and enter the periplasmic space, their signal peptides are specifically cleaved by signal peptidase, releasing correctly folded, biologically active mature first and second nanobodies, thereby achieving their accumulation and secretion.
[0030] In this invention, the method for achieving targeted integration of the recombinant vector into the bsh site of *Lactobacillus plantarum* is not limited to homologous recombination. In addition, the Cre / loxP system, transposon systems, and other methods can also be used. Those skilled in the art can choose the appropriate method from the above-mentioned methods based on actual needs.
[0031] In some embodiments, the nucleotide sequence of the PY3 promoter comprises the sequence shown in SEQ ID NO: 1. The PY3 promoter is derived from *Lactiplantibacillus plantarum* ST-III.
[0032] CGTTGAAGTGTCATTAGATAAGTTGAATGAAGAAATTTCATTCAAGTAATCATGGCATGTTAGTTCTTATTTTAATTTGATAAAAATGACGTTAATGTCTTTTTATAAAAACTTTCAAGGGAGAGATTTTTCTT (SEQ ID NO: 1)
[0033] In some embodiments, the nucleotide sequence of the SP signal peptide comprises the sequence shown in SEQ ID NO: 2. The SP signal peptide is derived from *Lactiplantibacillus plantarum* ST-III.
[0034] ATGAAGATCAAAAACCTTGTATTATCATCAACTGCTGCATTAGCTTTATTCGCTATCTCAACAACGGTTGCCAACGCTGATACTTATACT (SEQ ID NO: 2)
[0035] In some embodiments, the first nanobody is a PD-L1 nanobody.
[0036] In some embodiments, the encoding gene of the PD-L1 nanobody includes the sequence shown in SEQ ID NO: 3.
[0037] ATGgCGCAAGTGCAGCTGGTTGAAACCGGTGGTGGTCTGGTTCAACCAGGCGGCAGCTTGCGTTTAAGCTGTACCGCGAGCGGCTTTACCTTTAGCATGCATGCGATGACCTGGTATCGTCAAGCGCCAGGCAAACAGCGTGAACTGGTTGCGGTTATTACCAGCCATGGCGATCGCGCGAACTATAC CGATAGCGTTCGTGGTCGCTTTACCATTAGCCGTGACAACACCAAAAACATGGTCTATCTGCAGATGAACAGCCTGAAACCGGAAGATACCGCGGTGTATTATTGTAATGTCCCGCGCTATGATAGTTGGGGTCAGGGTACCCAGGTTACCGTTAGCAGCGGTGGTTTGCCAGAAACCGGTGGC (SEQ ID NO: 3)
[0038] In some embodiments, the nucleotide sequence of the ribosome binding site (RBS) comprises the sequence shown in SEQ ID NO: 5.
[0039] AAATTATAGGAGAGTGTATTAATTATT (SEQ ID NO: 5)
[0040] In some embodiments, the encoding gene of the first nanobody and the ribosome binding site (RBS) also include the encoding gene of a first tag protein.
[0041] In some embodiments, the first tag protein is a FLAG tag protein, and the nucleotide sequence of the FLAG tag protein includes the sequence shown in SEQ ID NO: 4.
[0042] GACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACGATGACAAGTGA (SEQ ID NO: 4)
[0043] In some embodiments, the second nanobody is a CTLA4 nanobody.
[0044] In some embodiments, the encoding gene of the CTLA4 nanobody includes the sequence shown in SEQ ID NO: 6.
[0045] ATGGCCCAAGTTCAATTAGTGGAGAGTGGCGGTGGCCTGGCGCAACCGGGCGGCAGCCTGCGTTTAAGCTGTGCGGCGAGCGGCAGCACCATTAGCAGCGTTGGCGGTGGGCTGGTATCGTCAGACCCCGGGCAATCAGCGCGAATGGGTGGCGACGAGCAGCACGAGCAGCACCACCGCCACCTAT GCGGATAGCGTGAAAGGCCGCTTTACCATTAGCCGCGATAACGCGAAAAACACCATTTATCTGCAGATGAACAGCCTGAAACCGGAAGATACCGCGGTGTATTATTGCAAAACCGGCCTGACCAACTGGGGCCGCGGCACCCAAGTGACCGTGAGCAGCGGCGGCCTGCCGGAAACCGGCGGC(SEQ ID NO:6)
[0046] In some embodiments, the encoding gene of the second nanobody is included between the encoding gene of the second tag protein and the terminator.
[0047] In some embodiments, the second tag protein is an HA tag protein. The nucleotide sequence of the HA tag includes the sequence shown in SEQ ID NO: 7.
[0048] TACCCATACGATGTTCCAGATTACGCTtaa (SEQ ID NO: 7)
[0049] In some embodiments, the terminator is a T7 terminator. The nucleotide sequence of the T7 terminator comprises the sequence shown in SEQ ID NO: 8.
[0050] GGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG (SEQ ID NO: 8)
[0051] In some embodiments, the recombinant vector further comprises an upstream homologous arm and a downstream homologous arm, wherein the upstream homologous arm is a homologous arm homologous to the 5′ end of the sequence of the bsh site, and the downstream homologous arm is a homologous arm homologous to the 3′ end of the sequence of the bsh site. The upstream homologous arm of the recombinant vector of the present invention can undergo a first homologous recombination with the upstream sequence of the *Lactobacillus plantarum* bsh site, integrating the recombinant vector containing the nanobody expression cassette into the genome of *Lactobacillus plantarum*; subsequently, in antibiotic-free culture medium, the downstream homologous arm of the recombinant vector and the downstream sequence of the *Lactobacillus plantarum* bsh site undergo a second homologous recombination, removing the backbone of the recombinant vector and the resistance marker gene subsequently linked to the downstream homologous arm. The recombinant vector of the present invention achieves the integration of the nanobody expression cassette into the genome of *Lactobacillus plantarum* through two-step homologous recombination, thereby obtaining plasmid-free and antibiotic-free recombinant *Lactobacillus plantarum*.
[0052] In some embodiments, the nucleotide sequence of the upstream homologous arm comprises the sequence shown in SEQ ID NO: 10.
[0053] In some embodiments, the nucleotide sequence of the downstream homologous arm comprises the sequence shown in SEQ ID NO: 11.
[0054] In some specific embodiments, a resistance marker gene is attached downstream of the downstream homologous arm. Preferably, the resistance marker gene is a chloramphenicol resistance gene (CAT), and the nucleotide sequence of the chloramphenicol resistance gene (CAT) includes the sequence shown in SEQ ID NO: 9.
[0055] TTATGTTTAACTTTAATAGTTTGTGGTTTATTTACAAAATCGATTTCGGCCGGCCAGTGGGCAAGTTGAAAAATTCACAAAAATGTGGTATAATATCTTTGTTCATTAGAGCGATAAACTTGAATTTGAGAGGGAACTTAGATGGTATTTGAAAAAATTGATAAAAATAGTTGGAACAGAAAAGAGTATTTTGACCACTACTTTGCAAGTGTACCTTGTACCTACAG CATGACCGTTAAAGTGGATATCACACAAATAAAGGAAAAGGGAATGAAACTATATCCTGCAATGCTTTATTATATTGCAATGATTGTAAACCGCCATTCAGAGTTTAGGACGGCAATCAATCAAGATGGTGAATTGGGGATATATGATGAGATGATACCAAGCTATACAATATTTCACAATGATACTGAAACATTTTCCAGCCTTTGGACTGAGTGTAAGTCTGACTT TAAATCATTTTTAGCAGATTATGAAAGTGATACGCAACGGTATGGAAACAATCATAGAATGGAAGGAAAGCCAAATGCTCCGGAAAACATTTTTAATGTATCTATGATACCGTGGTCAACCTTCGATGGCTTTAATCTGAATTTGCAGAAAGGATATGATTATTTGATTCCTATTTTTACTATGGGGAAATATTATAAAGAAGATAACAAAATTATACTTCCTTTGGCAATTCAAGTTCATCACGCAGTATGTGACGGATTTCACATTTGCCGTTTTGTAAACGAATTGCAGGAATTGATAAATAGTTAACTTCAGGTTTGTCTGTAACTAAAAAACAAGTATTTAAGCAAAAACATCGTAGAAATACGGTGTTTTTTGTTACCCTAAGTTTAAACTCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTC (SEQ ID NO:9)
[0056] In a specific embodiment, the recombinant vector sequentially comprises an upstream homologous arm of bsh, a PY3 promoter, an SP signal peptide, a PD-L1 nanobody gene, a FLAG tag, a ribosome binding site (RBS), an SP signal peptide, a CTLA4 nanobody gene, an HA tag, a T7 terminator, a downstream homologous arm of bsh, and a chloramphenicol resistance gene (CAT). The recombinant vector contains the nucleotide sequence shown in SEQ ID NO: 12.
[0057] In some embodiments, the backbone of the recombinant vector is selected from pMD. TM One or both of 19-T and pUCm-T Vectors. The pUCm-T Vector is available from Sangon Biotech (Shanghai) Co., Ltd., catalog number: B522214. In one specific example, the nanobody expression cassette is integrated into the pMD backbone. TM After 19-T, the recombinant vector pPY3-bsh was obtained.
[0058] Another aspect of the present invention provides a method for constructing a recombinant vector as described above, comprising: ligating the nanobody expression cassette described above to a linearized starting plasmid using a seamless cloning method to obtain the recombinant vector.
[0059] Another aspect of the present invention provides a recombinant *Lactobacillus plantarum* expressing nanobodies, wherein the *Lactobacillus plantarum* genome integrates the nanobodies expression cassette as described above at the bsh site. The recombinant *Lactobacillus plantarum* of the present invention does not contain the backbone sequence of the recombinant vector.
[0060] In some embodiments, the substrate bacteria of the recombinant *Lactobacillus plantarum* are selected from one or both of *Lactobacillus plantarum* ST-III and *Lactobacillus plantarum* WCFS1.
[0061] Another aspect of the present invention provides a method for constructing recombinant *Lactobacillus plantarum* as described above, the method comprising: converting the recombinant vector into a substrate culture to obtain the recombinant *Lactobacillus plantarum*.
[0062] In some implementations, the construction method includes:
[0063] The recombinant vector was transformed into *Lactobacillus plantarum* to achieve integration of the nanobody expression cassette into the upstream of the bsh site of the *Lactobacillus plantarum*; positive clones were obtained by screening; the positive clones were inoculated into antibiotic-free medium to remove the backbone sequence in the recombinant vector, thereby obtaining the recombinant *Lactobacillus plantarum*. In this invention, the recombinant vector can achieve integration of the nanobody expression cassette into the bsh site of *Lactobacillus plantarum* through homologous recombination.
[0064] In some embodiments, the process is converted to electroporation, wherein the electroporation conditions are 2.5 kV for 5 ms. Specifically, 200 μL of competent bacterial suspension and 2 μg of recombinant vector DNA are mixed in an electroporation cuvette, electroporated at 2.5 kV for 5 ms, and then liquid MRS medium is added and anaerobic culture is carried out for 4 h.
[0065] In some implementations, chloramphenicol is used to screen for positive clones.
[0066] In some specific implementations, the use of chloramphenicol to screen for positive clones involves screening the products after anaerobic culture on MRS agar plates containing 20 μg / mL chloramphenicol for positive clones.
[0067] In some embodiments, inoculating the positive clone into antibiotic-free medium specifically involves: inoculating the positive clone into antibiotic-free MRS liquid medium and culturing it continuously for 20 generations. In this invention, the positive clone, after being continuously cultured in antibiotic-free MRS liquid medium for 20 generations, achieves chloramphenicol resistance and pMD-free properties through spontaneous homologous recombination of the downstream homologous arm. TM Recombinant Lactobacillus plantarum with 19-T plasmid.
[0068] Another aspect of the present invention provides the use of the recombinant vector as described above or the recombinant Lactobacillus plantarum as described above in the preparation of nanobody delivery vectors.
[0069] Another aspect of the present invention provides a product comprising at least one of the following:
[0070] A1) Microbial agent, said microbial agent comprising recombinant Lactobacillus plantarum as described above;
[0071] A2) The composition comprises recombinant Lactobacillus plantarum as described above and / or the bacterial agent described in A1).
[0072] In some embodiments, the microbial agent can be in various dosage forms, such as liquid, emulsion, suspension, powder, granules, wettable powder, or water-dispersible granules. In one specific embodiment, the microbial agent is in the form of powder or liquid.
[0073] In some embodiments, the effective viable count of recombinant *Lactobacillus plantarum* in the bacterial agent is at least 1 × 10⁻⁶. 8 CFU / g; can also be 1×10 8 CFU / g ~ 1×10 9 CFU / g; can also be 6×10 8 CFU / g, 1×10 9 CFU / g. In the usual sense within this field, CFU / g represents the number of microbial colonies contained in a g of sample being tested. CFU stands for colony-forming unit.
[0074] In some embodiments, the microbial agent further includes a carrier. The carrier may be a solid carrier or a liquid carrier. In some embodiments, the solid carrier includes mineral materials, plant materials, and / or polymeric compounds; the mineral materials may be at least one selected from clay, talc, maifanite, kaolin, montmorillonite, white carbon, zeolite, silica, and diatomaceous earth; the plant materials may be at least one selected from corn flour, soybean flour, rice husk powder, and starch; the polymeric compounds may be polyvinyl alcohol and / or polyethylene glycol. In some embodiments, the liquid carrier may be an organic solvent, vegetable oil, mineral oil, or water; the organic solvent may be decane and / or dodecane. Depending on the requirements, surfactants (such as Tween 20, Tween 80, etc.), binders, stabilizers (such as antioxidants), pH adjusters, etc., may also be added to the microbial agent.
[0075] In some embodiments, the culture of the recombinant Lactobacillus plantarum described above may be present in the microbial agent as cultured live cells, fermentation broth of live cells, filtrate of cell culture, or a mixture of cells and filtrate.
[0076] Another aspect of the present invention provides the use of recombinant Lactobacillus plantarum as described above and / or the product as described above in the preparation of antitumor drugs.
[0077] In some embodiments, the tumor is selected from one or more of the following: bladder cancer, liver cancer, colon cancer, rectal cancer, colorectal cancer, endometrial cancer, biliary tract cancer, leukemia, lymphoma, pancreatic cancer, small cell lung cancer, non-small cell lung cancer, breast cancer, urethral cancer, head and neck cancer, gastrointestinal cancer, stomach cancer, esophageal cancer, ovarian cancer, kidney cancer, melanoma, prostate cancer, and thyroid cancer.
[0078] The present invention further provides a method for treating tumors, comprising: administering an effective amount of the recombinant Lactobacillus plantarum as described above or the product as described above to a target subject.
[0079] In some embodiments, the target is a mammal, including but not limited to humans, primates, livestock, pets, laboratory animals, or captured wild animals. Primates are preferred. Humans are most preferred. The target may be a patient with a tumor or an individual seeking tumor prevention. The proliferator or the composition may be administered to the target before, during, or after tumor treatment.
[0080] In some implementations, the recombinant Lactobacillus plantarum or the product described above can be administered orally or by injection.
[0081] The recombinant *Lactobacillus plantarum* of the present invention can stably secrete and express first nanobodies (especially PD-L1) and second nanobodies (especially CTLA-4), and can inhibit tumors better than the *Lactobacillus plantarum* control group and better than the group receiving combined administration of PD-L1 nanobodies and CTLA-4 nanobodies, indicating that the metabolites of recombinant *Lactobacillus plantarum* can cooperate with the expressed PD-L1 and CTLA-4 nanobodies to enhance the anti-tumor effect.
[0082] Furthermore, after the recombinant vector of the present invention is transformed into *Lactobacillus plantarum*, the backbone of the recombinant vector and the resistance gene contained in the recombinant vector can be removed through homologous recombination to obtain antibiotic-free and plasmid-free recombinant *Lactobacillus plantarum*, thus having high safety and being suitable for human bacterial therapy.
[0083] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.
[0084] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention; in the specification and claims of the present invention, unless otherwise expressly stated in the text, the singular forms "a", "an" and "this" include the plural forms.
[0085] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.
[0086] In the following embodiments of this application, the first nanobody is PD-L1 nanobody and the second nanobody is CTLA4 nanobody, to illustrate the construction of recombinant vectors and recombinant Lactobacillus plantarum.
[0087] Example 1 Construction of recombinant vector and recombinant Lactobacillus plantarum
[0088] according to Figure 1 Recombinant vectors expressing the PD-L1 nanobody gene and the CTLA4 nanobody gene were constructed, and then... Figure 2 As shown in Figure A, the recombinant vector was transformed into *Lactobacillus plantarum*, integrating the PD-L1 nanobody gene and the CTLA4 nanobody gene into the *Lactobacillus plantarum* genome. This includes the following:
[0089] 1.1 Construction of the recombinant vector
[0090] The recombinant vector includes two homologous arms of the upstream and downstream gene sequences of the bsh_ gene, each about 1 kb in length, and one chloramphenicol resistance gene (CAT).
[0091] The primers and templates used are shown in Table 1.
[0092] Table 1
[0093]
[0094] PCR reaction system: 1 μmol / L primers, 0.5 mmol / L dNTPs, 1.5 mmol / L magnesium ions, 0.05 U / μL DNATaq polymerase and 10 ng / μL template DNA.
[0095] Reaction conditions: (1) 98℃, denaturation for 3 min; (2) 98℃, denaturation for 10 s; (3) 50℃, annealing for 30 s; (4) 72℃, extension for 2 min, wherein steps (2)-(4) are repeated for 30 cycles; (5) 72℃, extension for 5 min.
[0096] Insert pMD TM The expression cassette of the 19-T backbone includes the following elements: upstream homologous arm of bsh, PY3 promoter, SP signal peptide, PD-L1 nanobody gene, FLAG tag, ribosome binding site (RBS), SP signal peptide, CTLA4 nanobody gene, HA tag, T7 terminator, downstream homologous arm of bsh, and chloramphenicol resistance gene (CAT). The nucleotide sequence of the expression cassette is shown in SEQ ID NO: 12.
[0097] bsh-up:
[0098] (SEQ ID NO: 10)
[0099] bsh-down:
[0100] AAGCCACTACTGTAATAGTTAAAATTGTTTAAAAGAGGAAATCAGTTTGTTATCAGTTGATTTCCTCTTTTATGTATCACTGTTTTCAGAGTAAGTTCCAATGGCTGGCATTGCTGTTAATATGACACTAGATGATATAAGTTATCATGTTAAGCTCGATGGTAAGTTGGGTTTAATTGATAGAAAACATAATAGTTATGAGATGCTTGAAACACCTACTAAAATACATTTTTACCAAAATTTTATATGATCATGTTTTGAATAAGGGGATTAATTTGAGCGACTGGATAGACATTAAGATATTACTGACAAGTTTTATTTAGGAAAAGAGCACGTTAATATATGGCAGATTGCAAGAAATAACTTGAACGAATTTAATGACGTAAATTAAGCAAGAAGATCTCGATTGGTGTATGCCAATTAAGACATTTAAGTGGCCGTGAATTCAAATACCAGTTGATTTGAACCAGTTGGTGATCA CTTAGTTCTTCAATGGCTTGGCCTTTGGGAATAAAGCGCCGCAAAACTCGGTTACGGTTCTCATTACTGCCTCTTTCATGCGGTGAATAGGCATGTGCAAAATAAACCTGTGTACCAGTTCGCCGTTCAATTGTCTGATAGTTAGCGAACTCTTTACCATGATCTACGGTAAGCGTCTTGAGCTTGTCTTGAAGTTGACTAGCTAGTTCAAGTACGGCTTGAGTCATGGACTGACTGTCGCGACCATGGAGCCGTTTAACAATTGTCAGGCGACTCTTACGCTCCACAAAAGTAGCCACAGCTTGACCTTTACGTTTACCAGAAAGTACGGTATCAGCTTCAAAGTGGCCGAATTCCTGGCGAGTTTTGACTTTATGAGGCCGCTCCTCAATGGAGCGGCCGTGATTGAACGTACCACGCTTTTCTTTAGCACGATGACGACGAATTCCATGATCAGGCAAATCGGGCAACTGTATATC (SEQ ID NO:11)
[0101] Using the In-Fusion HD Cloning Plus Kit (Beijing Baori Medical Biotechnology Co., Ltd., catalog number: 638911), the PCR amplified fragments were combined with linearized pMD... TM The 19-T vector (Beijing Baori Medical Biotechnology Co., Ltd., catalog number: 6013) was assembled.
[0102] The obtained construct was transformed into E. coli DH5α competent cells, and the specific steps are as follows:
[0103] 100 μL of *E. coli* DH5α competent cells (Beijing Baori Medical Biotechnology Co., Ltd., catalog number: 9057) prepared by the CaCl2 method were added, and In-Fusion ligation reactant was added. The cells were then incubated on ice for 30 min. A heat shock at 42℃ for 90 s was performed, followed immediately by an ice bath for 2 min. 900 μL of antibiotic-free LB medium was added, and the cells were incubated at 37℃ with shaking at 150 rpm for 60 min. 100-200 μL of the bacterial culture was spread onto LB agar plates containing 20 μg / mL chloramphenicol and 200 μg / mL ampicillin. The plates were incubated aerobically at 37℃ for 12-16 h. Positive clones were selected, and the resulting recombinant vector was named pPY3-bsh.
[0104] 1.2 Transformation of the recombinant vector into the chassis bacteria
[0105] The recombinant vector pPY3-bsh constructed in step 1.1 was electroporated into competent Lactobacillus plantarum ST-III, and recombinants were screened on chloramphenicol resistance plates.
[0106] The preparation of competent Lactobacillus plantarum cells was as follows: cells were grown in MRS liquid medium supplemented with 2% glycine until they reached OD... 600 0.6-0.8. The cells were then cooled on ice for 10 min and centrifuged at 6000×g for 5 min to obtain bacterial cells. The precipitated bacterial cells were then resuspended in ice-cold 30% (m / v) PEG1500 and centrifuged again under the same conditions; the cells were then washed once more with PEG. Finally, the obtained competent bacteria were resuspended in PEG.
[0107] Electroporation: 200 μL of competent bacterial suspension was mixed with 2 μg of recombinant vector DNA and transferred to an electroporation cuvette with a 2 mm gap. Electroporation was performed using a Bio-Rad electroporator at 2.5 kV for 5 ms. Liquid MRS medium was added, and the mixture was anaerobically cultured for 4 h. Then, positive clones containing integrated expression of PD-L1 and CTLA-4 nanobody genes were selected on MRS agar plates containing 20 μg / mL chloramphenicol.
[0108] The recombinant vector pPY3-bsh underwent homologous recombination via homologous arms and integrated into the chromosome of *Lactobacillus plantarum* ST-III (integration site: bsh_ gene locus: *Lactobacillus plantarum* ST-III (GenBank: CP002222, 3103803–3104779, gene="bsh")). (See...) Figure 1 ).
[0109] The obtained integrative recombinants were cultured for 20 generations in antibiotic-free MRS liquid medium (MRS Broth, Merck, Cat#1.10661.0500). Through spontaneous homologous recombination under antibiotic-free conditions, chloramphenicol-free and pMD-free recombinants were obtained. TM Recombinant Lactobacillus plantarum (labeled Syn Lp) expressing only PD-L1 and CTLA-4 nanobodies via 19-T plasmid.
[0110] Meanwhile, using the pMD™19-T vector (without the PD-L1 and CTLA4 nanobody genes, but containing the upstream homologous arm of bsh, PY3 promoter, SP signal peptide, FLAG tag, ribosome binding site (RBS), SP signal peptide, HA tag, T7 terminator, downstream homologous arm of bsh, and chloramphenicol resistance gene (CAT)) as a control, it was transformed into *Lactobacillus plantarum* ST-III, and the operation was the same as that for recombinant *Lactobacillus plantarum*. The resulting recombinant bacteria was labeled Lp-vector.
[0111] Example 2: Western Blot Verification of Nanobody Expression
[0112] In Example 2, Western blotting was used to verify the recombinant *Lactobacillus plantarum* (Syn Lp) and recombinant bacteria (Lp-vector) obtained in Example 1, to examine whether the two nanobodies were correctly expressed. Details are as follows:
[0113] Two single colonies (labeled Syn Lp-1 and Syn Lp-2, respectively) of the recombinant Lactobacillus plantarum obtained in Example 1 were selected from the plate using an inoculation loop and cultured anaerobically at 37°C for 16 h in liquid MRS medium. After centrifugation, the supernatant of the culture medium was collected and Western blot was performed to detect the expression of anti-PD-L1 and anti-CTLA4.
[0114] Centrifuge at 12000 g for 5 min and collect the supernatant. Remove substances with a molecular weight below 10000 Da through a centrifuge dialysis tube and concentrate the expressed protein at 20×.
[0115] The concentrated expressed protein was added to the sample electrophoresis buffer and subjected to SDS-PAGE electrophoresis. After transfer and blocking, hybridization was performed and the membrane was developed. Results are shown below. Figure 2 .
[0116] Meanwhile, the recombinant strain Lp-vector constructed in Example 1 was used as a control.
[0117] from Figure 2 As shown in B, recombinant Lactobacillus plantarum (Syn Lp) secretes and expresses anti-PD-L1 and anti-CTLA4, while the recombinant Lp-vector does not express anti-PD-L1 and anti-CTLA4.
[0118] Example 3: In vivo antitumor test
[0119] Construction of a mouse model of colon cancer: 1×10 6 CT26 cells were resuspended in 100 µL PBS and subcutaneously injected into the right back of 6-8 week old BALB / c mice; tumors were palpable after 7 days, and the tumor volume reached 100-300 mm² after 10-14 days. 3 A successful tumor-bearing mouse model of colon cancer was constructed. Six mice were in each group.
[0120] PBS group (G1:PBS group): 200 μL PBS was administered by gavage.
[0121] Control group (Lactobacillus plantarum ST-III) (G2:Lp group): 200 μL of Lactobacillus plantarum ST-III 1×10⁻⁶ via gavage 8 CFU / each.
[0122] PD-L1+ CTLA-4 nanobody group (G3: anti-PD-L1+ anti-CTLA4 group): PD-L1nb nanobody (Catalog no. BE0101; BioXCell), 100 μg / animal intraperitoneal injection; CTLA-4nb nanobody (Catalog no. BE0164; BioXCell), 200 μg / animal intraperitoneal injection.
[0123] Recombinant Lactobacillus plantarum group (G4: Syn LP): 200 μL of the recombinant Lactobacillus plantarum obtained in Example 1 was administered by gavage. 8 CFU / each.
[0124] The preparation method of *Lactobacillus plantarum* ST-III used for gavage in the control group was as follows: *Lactobacillus plantarum* ST-III was inoculated into MRS liquid culture overnight, centrifuged, counted, and then diluted. Details are as follows:
[0125] Single colonies of *Lactobacillus plantarum* ST-III were selected using an inoculation loop and placed in a 10 mL sterile tube containing 5 mL of MRS liquid medium (purchased from Merck Co., Germany), and incubated at 37°C for 18 h. Then, a 3% (w / v, i.e., g / mL) inoculation was added to 150 mL of MRS liquid medium, and incubated at 37°C for another 18 h. Finally, a 3% (w / v) inoculation was added to 1 L of MRS liquid medium, and incubated at 37°C for 20 h. After centrifugation, the *Lactobacillus plantarum* ST-III culture broth was obtained, with a viable count of 2.6 × 10⁻⁶. 8 CFU / g.
[0126] Tumor volume was measured on days 3, 6, 9, 12, 15, and 18, and tumor weight was measured on day 18. The results are shown below. Figure 3 And Table 2.
[0127] from Figure 3 As shown in A, compared with groups G1 and G2, the tumor volume of groups G3 and G4 decreased significantly, and the tumor volume of group G4 was even smaller.
[0128] from Figure 3 As shown in B, compared with groups G1, G2 and G3, the tumor weight in group G4 was significantly reduced.
[0129] Table 2
[0130] As shown in Table 2, compared with group G1, the average tumor weight in group G4 decreased by 87.4%; compared with group G2, the average tumor weight in group G4 decreased by 88.0%; and compared with group G3, the average tumor weight in group G4 decreased by 87.4%. In summary, the recombinant *Lactobacillus plantarum* constructed in this invention exhibits better tumor-inhibiting effects than either PD-L1 or CTLA-4 nanobodies alone, and is also superior to *Lactobacillus plantarum* administered by gavage alone.
[0131] Comparative Example 1: Screening of different promoter elements
[0132] In Comparative Example 1, different promoter elements were screened to obtain elements capable of stably secreting and expressing PD-L1 nanobodies. Specifically, these included the following:
[0133] Insert pMD TM The expression cassette of the 19-T backbone includes the following elements: upstream homologous arm of bsh, four different promoters, SP signal peptide, PD-L1 nanobody gene, FLAG tag, T7 terminator, downstream homologous arm of bsh, and chloramphenicol resistance gene (CAT).
[0134] The four different promoters are: PY3, P32, PFRL, and PG.
[0135] Recombinant *Lactobacillus plantarum* containing different promoters were constructed using the same steps as in Example 1, and then Western blotting was performed using the same method as in Example 2. The results are shown in [Figure 1]. Figure 4 .
[0136] promoter P32
[0137] AGATTAATAGTTTTAGCTATTAATCTTTTTTATTTTTATTTAAGAATGGCTTAATAAAGCGGTTACTTTGGATTTTTGTGAGCTGGACTAGAAAAAAACTTCACAAAATGCTATACTAGGTAGGTAAAAAAATATTCGGAGGAATTTTGAAATGGCAATCGTTTCAGCAGAAAAATTCGTAATTCGAGCTCGCCCGGGGATCGATCCTCTAGA (SEQ ID NO: 29)
[0138] PFRL promoter
[0139] GCTGCGCTGTAAACAACCACCCTCGCGTTTTCATCTATCAATGGCTGTTTATTAATAGTCGATGGTTATCTGTTATATAACTTAATGAAACGTGAACAAATGTATATTTGTCGGCGAATAAATAGCATTCTTTGACGCCGATAGCACCAGCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACC (SEQ ID NO: 30)
[0140] Promoter PG
[0141] TTACAAGCACCCCCTAAAAACGTAATGTTCTGATTATTGCACTGCAACACTCACTAGTTATACTAGTCACTGTTGATTGGTTGAGACATCAACTGCTCGACCAATAGAAAATATATGTAAATAATCGAACACACGCAAATTATAGGAGAGTGTATTAATTATT (SEQ ID NO: 31)
[0142] from Figure 4 It can be seen that the recombinant strain constructed only expresses anti-PD-L1 nanobodies when the promoter is PY3, while the strains constructed using other promoters such as P32, PFRL, and PG do not express anti-PD-L1 nanobodies.
[0143] Comparative Example 2: Screening of different signal peptide elements
[0144] In Comparative Example 2, different signal peptide elements were screened to obtain elements capable of stably secreting and expressing CTLA4 nanobodies. Specifically, these included the following:
[0145] The expression cassette inserted into the pMD™19-T backbone includes the following elements: upstream homologous arm of bsh, PY3 promoter, three different signal peptides, CTLA4 nanobody gene, HA tag, T7 terminator, downstream homologous arm of bsh, and chloramphenicol resistance gene (CAT).
[0146] The three different signal peptides include: SP, SP3, and USP45.
[0147] Recombinant *Lactobacillus plantarum* containing different signal peptides were constructed using the same steps as in Example 1, and then Western blotting was performed using the same method as in Example 2. The results are shown in [Figure 1]. Figure 5 .
[0148] Signal peptide SP3
[0149] ATGAAAATATCATCATTTATTTCTACATCACTGCCCCTGCCCGACA (SEQ ID NO: 32)
[0150] Signal peptide usp45
[0151] ATGAAAAAAAAGATTATCTCAGCTATTTTAATGTCTACAGTGATACTTTCTGCTGCAGCCCCGTTGTCAGGTGTTTACGCT (SEQ ID NO: 33)
[0152] from Figure 5 It can be seen that the recombinant strain constructed only expresses anti-CTLA4 nanobodies when the signal peptide is SP, while the strains using other signal peptides such as SP3 and USP45 do not express anti-CTLA4 nanobodies.
[0153] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications and variations of the methods listed herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention.
Claims
1. A recombinant vector for expressing nanobodies in *Lactobacillus plantarum*, characterized in that, The recombinant vector is targeted and integrated into the bsh site of *Lactobacillus plantarum*, and the recombinant vector contains a nanobody expression cassette with the following elements: a PY3 promoter, an SP signal peptide, a gene encoding a first nanobody, RBS, an SP signal peptide, a gene encoding a second nanobody, and a terminator.
2. The recombinant vector as described in claim 1, characterized in that, The nucleotide sequence of the PY3 promoter comprises the sequence shown in SEQ ID NO: 1; And / or, the nucleotide sequence of the SP signal peptide comprises the sequence shown in SEQ ID NO: 2; And / or, the first nanobody is a PD-L1 nanobody; preferably, the encoding gene of the PD-L1 nanobody contains the sequence shown in SEQ ID NO: 3; And / or, the nucleotide sequence of the RBS comprises the sequence shown in SEQ ID NO: 5; And / or, the second nanobody is a CTLA4 nanobody; preferably, the encoding gene of the CTLA4 nanobody contains the sequence shown in SEQ ID NO: 6; And / or, the terminator is a T7 terminator; preferably, the nucleotide sequence of the T7 terminator comprises the sequence shown in SEQ ID NO: 8; And / or, the encoding gene of the first nanobody and the RBS also contain the encoding gene of a first tag protein; preferably, the first tag protein is a FLAG tag protein. And / or, the encoding gene of the second nanobody and the terminator further include the encoding gene of a second tag protein; preferably, the second tag protein is an HA tag protein; And / or, the recombinant vector further comprises an upstream homologous arm and a downstream homologous arm, wherein the upstream homologous arm is a homologous arm that is homologous to the 5′ end of the sequence of the bsh site, and the downstream homologous arm is a homologous arm that is homologous to the 3′ end of the sequence of the bsh site.
3. The recombinant vector as described in claim 2, characterized in that, The downstream homologous arm is also connected to an anti-resistance marker gene; preferably, the anti-resistance marker gene is a chloramphenicol resistance gene; And / or, the nucleotide sequence of the recombinant vector comprises the sequence shown in SEQ ID NO: 12; And / or, the backbone of the recombinant vector is one or both of pMD™19-T and pUCm-T Vector.
4. A recombinant Lactobacillus plantarum expressing nanobodies, characterized in that, The recombinant Lactobacillus plantarum genome integrates a nanobody expression cassette as described in any one of claims 1-3 at the bsh site.
5. The recombinant *Lactobacillus plantarum* as described in claim 4, characterized in that, The recombinant *Lactobacillus plantarum* basal strain is selected from one or both of *Lactobacillus plantarum* ST-III and *Lactobacillus plantarum* WCFS1.
6. The method for constructing recombinant *Lactobacillus plantarum* as described in claim 4 or 5, characterized in that, The construction method includes: The recombinant vector was transformed into the chassis bacteria to obtain the recombinant plant lactobacillus.
7. The construction method as described in claim 6, characterized in that, The recombinant vector is constructed by linking the nanobody expression cassette to the backbone via homologous recombination.
8. Use of the recombinant vector as described in any one of claims 1-3 or the recombinant Lactobacillus plantarum as described in claim 4 or 5 in the preparation of nanobody delivery vectors.
9. A product characterized in that, The product comprises at least one of the following: A1) Microbial agent, said microbial agent comprising recombinant Lactobacillus plantarum as described in claim 4 or 5; A2) The composition comprises the recombinant Lactobacillus plantarum as described in claim 4 or 5 and / or the bacterial agent as described in A1).
10. The use of the recombinant *Lactobacillus plantarum* as described in claim 4 or 5 and / or the product as described in claim 9 in the preparation of antitumor drugs; Preferably, the tumor is selected from one or more of the following: bladder cancer, liver cancer, colon cancer, rectal cancer, colorectal cancer, endometrial cancer, biliary tract cancer, leukemia, lymphoma, pancreatic cancer, small cell lung cancer, non-small cell lung cancer, breast cancer, urethral cancer, head and neck cancer, gastrointestinal cancer, stomach cancer, esophageal cancer, ovarian cancer, kidney cancer, melanoma, prostate cancer, and thyroid cancer.