Application of a receptor-like cytoplasmic kinase gene, StRLCK185a, in improving plant resistance to late blight.

Abstract

This invention discloses the application of a receptor-like cytokinase gene, StRLCK185a, in enhancing plant resistance to late blight, belonging to the field of plant genetic engineering. The nucleotide sequence of the StRLCK185a gene is shown in SEQ ID No. 1, and its encoded amino acid sequence is shown in SEQ ID No. 2. This invention, by overexpressing the StRLCK185a gene in plants (especially potatoes), can significantly activate the plant's defense response, thereby enhancing potato resistance to late blight. This invention also provides specific primer pairs for cloning this gene, the protein encoded by it, and the application of recombinant overexpression vectors containing this gene and engineered bacteria in disease-resistant breeding. This invention provides effective genetic resources and biotechnological means for breeding new varieties of potatoes and other Solanaceae crops resistant to late blight.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and plant disease resistance breeding, specifically to the application of a receptor-like cytoplasmic kinase StRLCK185a gene in improving plant resistance to late blight. Background Technology

[0002] Late blight is caused by the pathogenic fungus Phytophthora ( Phytophthora infestans Late blight is a devastating plant disease that poses a serious threat to the production of solanaceous crops such as potatoes and tomatoes. It was the culprit behind the infamous Irish famine. Currently, control of late blight relies primarily on chemical pesticides, including preventative measures and spraying at the initial stage of disease development. However, this chemical-based strategy not only significantly increases production costs but may also lead to increased pesticide resistance in pathogens due to long-term, high-volume use, resulting in environmental pollution, pesticide residues, and other food safety issues. This clearly deviates from the direction of sustainable agricultural development. Therefore, identifying and cultivating disease-resistant varieties through genetic engineering is the fundamental way to achieve green and sustainable agricultural development.

[0003] Through long-term co-evolution, plants and pathogens have developed a complex immune system, primarily consisting of two major immune pathways: PTI (Pathogen-associated molecular patterns (PAMP) and PAMP-triggered immunity) and ETI (Effector-triggered immunity). Plants first trigger PTI by recognizing conserved PAMP molecules in pathogens through surface pattern recognition receptors (PRRs). Pathogens, for their own survival, secrete toxic effector proteins to interfere with and disrupt the plant's PTI, producing effector-triggered susceptibility (ETS). Subsequently, plants have cleverly evolved specific resistance proteins (R proteins) that directly or indirectly recognize avirulence factors (Avr) secreted by pathogens, thereby triggering ETI. Both host plants and pathogens evolve in ways that benefit themselves, creating an "arms race" between them.

[0004] Receptor-like cytoplasmic kinases (RLCKs) lacking extracellular domains are an important class of receptor kinase proteins in plants, involved in regulating a series of key signal transduction pathways and responding to biotic and abiotic stresses. Many RLCKs play a crucial role in linking PRRs to key downstream signaling modules. In Arabidopsis, the RLCK subfamily includes VII BIK1 (botrytis-induced kinase and some PBS1-like (PBL) kinases) and subfamily II BSK1 (brassinosteroid signaling kinase 1). Several members of RLCK VII can directly act downstream of CERK1, phosphorylating the C-terminus of MAPKKK5 and MEKK1 and activating two disease resistance cascades, suggesting that RLCKs play a vital role in plant disease resistance. However, research on the disease resistance mechanisms of RLCKs in potato remains limited.

[0005] As late blight pathogen races continue to mutate and evolve, the area affected by potato late blight is expanding, making the development of new varieties resistant to the pathogen a pressing issue for the potato industry. Receptor-like cytokines, proteins with serine / threonine protein kinase domains, play a crucial role in plant immune signal transduction in rice and Arabidopsis thaliana, but their specific functions and applications in potato resistance to late blight remain limited.

[0006] Therefore, this research field urgently needs to discover and identify novel potato late blight resistance genes. These genes should have clearly defined functions, especially those key genes that may regulate basic plant immunity and possess the potential to confer durable resistance. Based on this, using genetic engineering techniques to elucidate their biological functions and further integrating them into breeding programs will lay a solid genetic foundation and open up practical technical pathways for overcoming the challenges of potato late blight control and breeding superior new varieties with durable resistance. Summary of the Invention

[0007] The purpose of this invention is to overcome the shortcomings of the prior art and provide an application of the receptor-like cytoplasmic kinase StRLCK185a gene in improving plant resistance to late blight.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] In a first aspect, the present invention provides the application of a receptor-like cytokinase StRLCK185a gene in improving plant resistance to late blight, wherein the receptor-like cytokinase StRLCK185a gene is any one of the following 1)-3):

[0010] 1) It has a nucleotide sequence as shown in SEQ ID No. 1;

[0011] 2) Possesses a polynucleotide encoding a receptor-like cytokinase StRLCK185a as shown in SEQ ID No. 2;

[0012] 3) Has at least 80% homology with the nucleotide sequence defined in 1) or 2), and encodes a protein that has the same anti-late blight function as the receptor-like cytoplasmic kinase StRLCK185a shown in SEQ ID No. 2.

[0013] Preferably, the application is achieved by overexpressing the receptor-like cytokinase StRLCK185a gene in plants.

[0014] Preferably, the plant is a plant of the Solanaceae family, and more preferably, it is a potato.

[0015] In a second aspect, the present invention provides a primer pair for cloning the aforementioned receptor-like cytokinase StRLCK185a gene, the primer pair comprising an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer being shown in SEQ ID No. 3, and the nucleotide sequence of the downstream primer being shown in SEQ ID No. 4.

[0016] A third aspect of the invention provides the application of a protein encoded by the aforementioned receptor-like cytoplasmic kinase StRLCK185a gene in enhancing plant resistance to late blight.

[0017] Preferably, the protein is any one of a)-b) below:

[0018] a) A receptor-like cytoplasmic kinase StRLCK185a consisting of an amino acid sequence as shown in SEQ ID No. 2;

[0019] b) A protein with the same function as the protein shown in SEQ ID No. 2 obtained by substituting, deleting or inserting 1-20 amino acids into the amino acid sequence shown in SEQ ID No. 2.

[0020] In a fourth aspect, the present invention provides the application of the aforementioned receptor-like cytokinase StRLCK185a gene or a recombinant expression vector containing the gene, transgenic cell lines, and genetically engineered bacteria in the cultivation of plants resistant to late blight.

[0021] Preferably, the expression vector is pRI101. Those skilled in the art can also select other suitable expression vectors according to the host cell type, such as the pCAMBIA series, pBI121 and other plant expression vectors.

[0022] Preferably, the transgenic cell line is a plant cell, and more preferably a potato cell line;

[0023] Preferably, the genetically engineered bacterium is Agrobacterium.

[0024] In a fifth aspect, the present invention provides a method for breeding potatoes resistant to late blight, characterized in that the receptor-like cytokinase StRLCK185a gene is introduced into potato plants and the gene is expressed to enhance their resistance to late blight.

[0025] In a sixth aspect, the present invention provides the application of the aforementioned receptor-like cytokinase StRLCK185a gene or a recombinant expression vector containing the gene, transgenic cell lines, and genetically engineered bacteria in regulating plant resistance to late blight.

[0026] The regulation of plant resistance to late blight involves upregulating the expression of the receptor-like cytokinase StRLCK185a gene in the plant genome to increase plant resistance to late blight, and inhibiting or downregulating the expression of the receptor-like cytokinase StRLCK185a gene to decrease plant resistance to late blight.

[0027] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0028] This invention reveals for the first time the specific function of the receptor-like cytoplasmic kinase StRLCK185a gene in enhancing plant resistance to late blight, providing a new gene resource for plant disease-resistant breeding. Overexpression of the StRLCK185a gene in plants (such as potatoes) can significantly activate the potato's defense response, enhance its resistance to late blight, and reduce the disease index.

[0029] This invention not only provides applications for the gene itself, but also extends to the protein it encodes, related genetic tools (such as specific primers and expression vectors), and engineered bacteria and transformants carrying the gene, forming a complete biotechnology solution that can be widely applied to the discovery of disease-resistant genes in potatoes and other crops, laying a theoretical foundation for the cultivation of new disease-resistant plant varieties.

[0030] This gene originates from the potato itself, and its overexpression product is a protein naturally present in the plant. Compared with exogenous insecticides / fungicides, it has higher biosafety and environmental safety. Attached Figure Description

[0031] Figure 1 for StRLCK185a Identification results of potato overexpression lines, where A represents qRT-PCR identification. StRLCK185aThe transcriptional level of the gene in the overexpression material, B is the Western blot (WB) detection analysis of two overexpression potato lines, StRLCK185a-OE-1 and StRLCK185a-OE-3.

[0032] Figure 2 For potatoes StRLCK185a The results of late blight resistance identification of overexpressed materials are shown in Figure A, which is a comparison of leaves 7 days after late blight inoculation; Figure B shows the relative lesion area of ​​the leaves in Figure A 7 days after late blight inoculation; and Figures C and D represent the resistance marker genes. StPR1 and StPR3 In potatoes StRLCK185a Relative expression level in overexpressed materials.

[0033] Figure 3 The results of Western blotting (WB) assays for StRLCK185a kinase activity are shown in Figure A, where in vitro phosphorylation is used to verify the kinase activity of StRLCK185a, and MBP serves as an empty vector negative control. Figure B shows in vivo phosphorylation to verify the kinase activity of StRLCK185a, with 2×GFP serving as an empty vector negative control. K115E It is a mutant of the kinase active site, where K represents lysine and E represents glutamic acid. Detailed Implementation

[0034] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments, but this does not limit the present invention in any way. Any modifications or improvements made based on the teachings of the present invention shall fall within the protection scope of the present invention.

[0035] The processes, conditions, reagents, and experimental methods used in implementing this invention, except as specifically mentioned below, are all common knowledge and general knowledge in the field, and this invention does not have any particular limitations. Experimental methods in the embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the manufacturer.

[0036] Unless otherwise stated, all technical terms and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. However, in the event of any conflict, the specification containing the definitions shall prevail.

[0037] The following is information on the source and specifications of some of the main raw materials and reagents used in the examples:

[0038] Wild-type potato (Des), provided by Wuhan Boyuan Biotechnology Co., Ltd.; Late blight pathotype 88069, donated by Professor Wang Hongyang of Yunnan Normal University; Kanamycin, purchased from Solarbio, specification 50 mg / mL.

[0039] Example 1: Cloning of the potato disease resistance gene StRLCK185a

[0040] RNA was extracted from the leaves of wild-type potato Desiree (Des), reverse transcribed into cDNA, and used as a template for PCR amplification. The primers used are as follows:

[0041] StRLCK185a-F:CTGTACAAGCCCGGGGGTACCATGGGTTGCTTCTCCTGTT (SEQ ID No. 3);

[0042] StRLCK185a-R:AGAGTTGTTGATTCAGAATTCTTCGTTACCCCCATCAAAACT (SEQ ID No. 4).

[0043] Specifically, the following steps are included:

[0044] RNA was extracted from leaves of four-week-old wild-type potato (Des) using the Trizol extraction method. The procedure was described in the instructions for the Tiangen brand polysaccharide and polyphenol plant RNA extraction kit. RNA was then extracted using (TransGen). EasyScript ® The One-Step gDNA Removal and cDNA Synthesis SuperMix kit reverse transcribes RNA into cDNA. Refer to the kit instructions for operation steps.

[0045] Using StRLCK185a-F and StRLCK185a-R as primers and cDNA as a template, PCR was performed according to the amplification system. The PCR system consisted of 40 μL of cDNA. StRLCK185a The PCR reaction system for the gene is as follows:

[0046]

[0047] The reaction procedure is as follows:

[0048]

[0049] After the procedure, the band size was detected by 1% agarose gel electrophoresis, and the product was recovered and purified.

[0050] Example 2: Potato disease resistance gene StRLCK185a Obtaining overexpression materials

[0051] (1) The result obtained in Example 1 StRLCK185a The gene is ligated into the pRI101-GFP vector, specifically including the following steps: the pRI101-GFP vector is subjected to restriction endonuclease... Kpn I and EcoRThe cells were double-digested with enzymes I, reacted at 37°C for 3 h, and the band size was detected by 1% agarose gel electrophoresis. The product was then recovered and purified. The PCR product StRLCK185a gene obtained in Example 1 was ligated to the double-digested pRI101-GFP vector using the Novizan recombinant kit to obtain the overexpression vector pRI101-StRLCK185a-GFP. This vector was transformed into E. coli DH5α, plated on LB agar plates supplemented with kanamycin (50 μg / mL) for screening, and incubated overnight at 37°C until single colonies grew. Single colonies were picked for PCR and enzyme digestion verification. Positive clones were sent to Qingke Biotechnology (Kunming) Co., Ltd. for DNA sequencing verification.

[0052] Sequencing results showed that potatoes StRLCK185a The full-length CDS of the gene is 1407 bp, encoding a protein of 468 amino acids. The expression vector pRI101-StRLCK185a-GFP encoding the potato receptor cytokinase StRLCK185a gene was successfully constructed, and subsequent positive plasmids were extracted and transformed into Agrobacterium GV3101.

[0053] The sequencing primers used were pRI101-F and pRI101-R, and their sequences are as follows:

[0054] pRI101-F: CACTACCAGCAGAACACC(SEQ ID No.5)

[0055] pRI101-R: GAACGATCGGGGAAATTCG (SEQ ID No. 6)

[0056] (2) The positive vector pRI101-StRLCK185a-GFP was transformed into wild-type potato Des using Agrobacterium-mediated transformation to obtain stably expressed overexpression. StRLCK185a Transgenic plants. The specific steps are as follows:

[0057] After sterile preservation of potato shoot tips (Des) on basal medium for 3 weeks, shoot segments were used as explants and pre-cultured on pre-medium for 2 days to activate Agrobacterium tumefaciens GV3101 positive transformant strain. The culture was then shaken to OD200. 600Approximately 0.5 μL of mycelium was used to suspend the bacteria in liquid culture medium, which was then used to infect the pre-cultured explants for 10 min. The explants were then spread evenly on the culture medium and co-cultured in the dark at 24°C for 2 days. After 2 days, the explants were evenly transferred to the culture medium for callus induction. The culture medium was changed every two weeks until sprouting. After sprouting, when the sprouts reached about 1 cm in length, they were cut off and inserted into rooting medium for rooting treatment. The seedlings were cultured at 28°C under light until most adventitious roots had developed. Finally, the rooted seedlings were removed, the culture medium was washed off, and the seedlings were transplanted into seedling trays. After 7 days of growth in a greenhouse, they were transplanted into the field to obtain potatoes. StRLCK185a Genetically modified materials are used for subsequent disease resistance identification.

[0058] Example 3: Potato Disease Resistance Gene StRLCK185a Identification of overexpression materials

[0059] 1. Transcription level identification

[0060] Wild-type potato Des, overexpression StRLCK185a RNA was extracted from transgenic potato leaves (obtained in Example 2) using the Trizol extraction method, following the instructions for the Tiangen Polysaccharide and Polyphenol Plant RNA Extraction Kit. RNA was then obtained using (TransGen). EasyScript ® The One-Step gDNA Removal and cDNA Synthesis SuperMix kit reverse transcribed RNA into cDNA, followed by quantitative real-time PCR using a full-size gold dye premix to identify the expression level of StRLCK185a. The total reaction...

[0061] The system volume is 20 μL, and the system composition is as follows:

[0062]

[0063] The primer sequences used for qRT-PCR are shown below:

[0064] qRT-StACTIN-F: GGGATGGAGAAGTTTGGTGGTGG (SEQ ID No. 7);

[0065] qRT-StACTIN-R: CTTCGACCAAGGGATGGTGTAGC(SEQ ID No.8);

[0066] qRT-StRLCK185a-F: CCGCTAATTGGGGATGTGGT(SEQ ID No.9);

[0067] qRT-StRLCK185a-R: GTCTCTCCAATTCTCGCCCC (SEQ ID No. 10).

[0068] See results Figure 1 A. Two lines of the overexpression material were identified with significantly upregulated StRLCK185a gene transcription levels, which were significantly higher than those of wild-type potatoes. These were StRLCK185a-OE-1 and StRLCK185a-OE-3.

[0069] 2. Protein level identification

[0070] Total protein extraction: Extraction of wild-type potato Des and genetically modified potatoes. StRLCK185a After grinding potato leaves of OE-1 and OE-3 with liquid nitrogen, the powder was placed in a 1.5 mL centrifuge tube, and 200 μL of protein extraction buffer was added. The mixture was vortexed and placed on ice for 60 min, then centrifuged at 12,000 rpm and 4 °C for 10 min. 60 μL of the supernatant was transferred to a new centrifuge tube, and 20 μL of 4×SDS loading buffer was added. The tube was then incubated in a 98 °C metal bath for 10 min as the sample for subsequent Western blotting.

[0071] Western blot hybridization: After electrophoresis at 80 V for 30 min, the voltage was adjusted to 120 V and electrophoresis continued for 1 h. Then, membrane transfer was performed at 90 V for 90 min. After transfer, the PVDF membrane was blocked with 5% skim milk for 2 h, followed by incubation at room temperature with primary antibody containing 3% GFP (1:5000 dilution) for 2 h. The membrane was washed three times with PBST for 5 min each time. After washing, the secondary antibody (mouse antibody) was diluted 1:5000 with 3% skim milk and incubated at room temperature for 1 h. Finally, the membrane was washed three times with PBST for 5 min each time, and chemiluminescence detection was performed.

[0072] See results Figure 1 B. The results showed that obvious GFP fusion protein was detected in the overexpression materials StRLCK185a-OE-1 and StRLCK185a-OE-3.

[0073] Example 4: Detection of late blight resistance in transgenic potatoes overexpressing StRLCK185a

[0074] The overexpressing plants StRLCK185a-OE-1, StRLCK185a-OE-3, and wild-type potato Des identified in Example 3 were grown for one month.

[0075] Used Phytophthora infestansThe late blight strain, 88069, was grown on rye agar in a 10°C incubator under a 24-hour dark-light cycle for long-term preservation. For infection assays, strain 88069 was grown on rye agar at 18°C ​​for 14 days for inoculation experiments. The 14-day-old 88069 strain was scraped with 4 mL of 0.05% Tween water to release sporangia. The sporangium suspension was filtered through a magic cloth. The number of sporangia was counted under a microscope and adjusted to 100 sporangia per microliter, then placed on ice for two hours to release zoospores.

[0076] Ten microliters of spores were inoculated onto the back of detached potato leaves (inoculating both sides of each leaf), placed in a dish with moist filter paper, and sealed with plastic wrap to keep moist. The disease incidence was observed and recorded 7 days after inoculation, and the lesion area of ​​the transgenic material was compared with that of the control leaf.

[0077] like Figure 2 Figure A shows the disease incidence on leaves of wild-type potatoes and transgenic overexpressing potato lines 7 days after in vitro inoculation with late blight. Seven days after inoculation with late blight, overexpression was observed... StRLCK185a Potato leaf lesions were significantly smaller than those in wild-type potatoes. The lesion areas after in vitro inoculation of all wild-type and overexpression materials were statistically analyzed, and graphs were plotted using GraphPad Prism 8.0.1 to obtain the relative lesion areas, as shown below. Figure 2 As shown in B, the results indicate overexpression. StRLCK185a The overall area of ​​potato lesions was smaller than that of wild-type potatoes, further proving that... StRLCK185a Gene overexpression significantly improved potato resistance to late blight.

[0078] Example 5 Potato disease resistance marker gene StPR1 , StPR3 In overexpression StRLCK185a Expression changes in potato plants

[0079] The specific steps are as follows: Take wild-type potato Des, overexpress... StRLCK185a RNA was extracted from transgenic potato leaves (positive plants identified in Example 3) using the Trizol extraction method, following the instructions for the Tiangen Polysaccharide and Polyphenol Plant RNA Extraction Kit. RNA was then reverse transcribed into cDNA using a full-gold dye assay kit, following the kit's instructions. The disease resistance marker gene in the StRLCK185a overexpression material was identified by qRT-PCR using a full-gold dye-based quantitative real-time reagent. StPR1 and StPR3 The expression level was determined, and the total reaction volume was 20 μL, as follows:

[0080]

[0081] The primer sequences used for qRT-PCR are shown below:

[0082] qRT-StACTIN-F: GGGATGGAGAAGTTTGGTGGTGG (SEQ ID No. 7);

[0083] qRT-StACTIN-R: CTTCGACCAAGGGATGGTGTAGC(SEQ ID No.8);

[0084] qRT- StPR1-F: CTGGTGCTGTGAAGATGTGG(SEQ ID No.11);

[0085] qRT- StPR1-R: ACAACCAAGACGTACCGAGT(SEQ ID No.12);

[0086] qRT- StPR3-F: GTGATCCGCATAAACCCCCA(SEQ ID No.13);

[0087] qRT- StPR3-R: GAGTGGCTATCCTTCGGTGG (SEQ ID No. 14).

[0088] See results Figure 2 C-2D results showed that overexpressing plants StRLCK185a-OE-1, StRLCK185a-OE-3 middle StPR1 and StPR3 Upregulation of gene transcription levels further illustrates StRLCK185a Gene overexpression enhances the disease resistance of potatoes.

[0089] Example 6: Western blotting detection of in vitro and in vivo kinase activity of StRLCK185a

[0090] 1. In vitro kinase activity

[0091] (1) Protein expression in prokaryotes

[0092] a. The target protein StRLCK185a and its mutant StRLCK185a... K115E Homologous recombination (with lysine K at position 115 mutated to glutamate E) into the vector pET30-MBP was performed to construct a fusion expression plasmid with an N-terminal MBP tag. The plasmid was then heat-transformed into the expression strain. E. coli In BL21. After resuscitation, the bacterial culture was evenly spread on LB agar plates containing kanamycin and incubated at 37°C for about 12 hours.

[0093] b. Inoculate the single clone strain into 1 mL LB liquid medium containing kanamycin and incubate at 37°C and 220 rpm for 12 h.

[0094] c. Inoculate the well-shaken bacterial culture at a ratio of 1:100 into a 250 mL Erlenmeyer flask to provide a favorable growth environment for the strain. Add 500 μL of the bacterial culture to 50 mL of LB liquid medium containing kanamycin and incubate at 37°C and 200 rpm for approximately 4 hours until OD (dose retardation). 600 = Around 0.5.

[0095] d. Add IPTG to the conical flask to a final concentration of 0.2 mM and incubate at 18℃ and 150 rpm for 12–18 h.

[0096] e. Collect the induced bacterial cells by centrifugation at 4℃ and 4000 rpm for 10 min. Discard the supernatant and resuspend the bacterial cells in an appropriate amount of pre-cooled PBST buffer (add 1 mM PMSF before use).

[0097] f. Use an ultrasonic disruptor to disrupt the bacteria until the solution becomes clear. Ultrasonic conditions: 3 seconds of sonication followed by 6 seconds of rest, 20% power, and approximately 5 minutes of sonication time.

[0098] g. Centrifuge at 15,000 rpm for 10 min at 4℃, and store the supernatant at -80℃ for later use.

[0099] (2) Validation of kinase activity

[0100] The MBP-StRLCK185a and MBP-StRLCK185a obtained above K115E The unpurified crude protein was subjected to a kinase reaction by incubation at 30°C for 2 hours with the aid of some metal ions. After incubation, Western blotting (WB) was performed according to the method in Example 3. The in vitro incubation reaction system is as follows:

[0101]

[0102] See results Figure 3 A. The results showed that MBP-StRLCK185a possessed kinase activity in vitro, while empty MBP and the kinase active site mutant MBP-StRLCK185a... K115E It has no kinase activity.

[0103] 2. In vivo kinase activity

[0104] (1) Agrobacterium transformation

[0105] a. Take 2 μL of pYBA-1132-EGFP-StRLCK185a plasmid and add it to 50 μL of Agrobacterium competent cells (GV3101). Gently stir the tube to mix well, place on ice for 5 min, in liquid nitrogen for 5 min, in a 37℃ water bath for 5 min, and then place on ice for another 5 min.

[0106] b. Add 500 μL of antibiotic-free LB liquid and incubate at 28°C and 220 rpm for 1 h on a shaker.

[0107] c. Take 50-100 μL of the resuspended bacterial culture and spread it onto LB agar plates containing rifampicin and kanamycin antibiotics. Incubate at 28°C inverted position for 2 days.

[0108] d. Pick 8 monoclonal Agrobacterium bacteria from the plate for PCR positive identification and store them for later use.

[0109] (2) Agrobacterium-mediated transient expression in tobacco

[0110] a. Pick a positive monoclonal antibody into a 2 mL centrifuge tube and add 1 mL of LB to activate it.

[0111] b. The activated Agrobacterium culture was transferred to a 50 mL centrifuge tube, and 10 mL of LB broth containing rifampicin and kanamycin antibiotics was added. The mixture was then incubated at 28°C and 240 rpm for 16 h.

[0112] c. Centrifuge at 4000 rpm for 6 min at room temperature and collect the bacterial cells.

[0113] d. Resuspend the bacterial cells in a mixed solution of 10 mM MgCl2 and 10 mM MES (4-Morpholineethanesulfonic acid), and adjust the bacterial concentration to OD using a spectrophotometer. 600 =1.5; P19 bacterial concentration up to OD 600 =1.

[0114] e. Mix equal volumes of the adjusted Agrobacterium tumefaciens bacterial suspension, and add 2 μL of 100 mM acetylsuccinone (AS) per milliliter of bacterial suspension; let stand at room temperature for 2-4 h.

[0115] f. Tobacco Injection: Inject the bacterial suspension into the entire tobacco leaf using a 1 mL syringe. Thoroughly mix the Agrobacterium suspension before injection. Determine the sampling time based on the stability of the target protein; typically, sampling is performed 2 days after expression in tobacco. After sampling, downstream experiments can be performed directly, or the sample can be temporarily stored at -80°C.

[0116] (3) In vivo phosphorylation experiment

[0117] a. Extraction of tobacco protein: Take a tobacco sample, add an appropriate amount of non-denaturing protein extraction buffer, vortex to mix, and incubate on ice for 60 min. Then centrifuge at 4℃ and 12000 rpm for 15 min, and transfer the supernatant to a 1.5 mL centrifuge tube; after centrifugation again, collect the supernatant, which is the protein sample. The formula for the non-denaturing protein extraction buffer is as follows:

[0118]

[0119] b. Input detection. Take 50 μL of each of the two protein solutions obtained and boil them as samples for Western blotting (WB) detection.

[0120] c. Binding protein. Take an equal amount of tobacco undenatured protein, add PBST to make up to 1 mL, add 20 μL of anti-MYC beads, and incubate at 4°C using a rotary mixer for 2 h.

[0121] e. Wash the beads. After incubation, let them stand on a magnetic rack for 1 min and remove the supernatant. Add 1 mL of pre-chilled PBST buffer and rotate to wash at 4°C, washing once every 10 min, repeating 5-7 times.

[0122] f. Sample detection. After the final wash, add 50 μL of PBST buffer, add 4× protein loading buffer, boil to separate the protein for Western blotting.

[0123] The results are as follows Figure 3 B. The results showed that GFP-StRLCK185a has kinase activity in vivo, while the empty GFP and the kinase active site mutant GFP-StRLCK185a... K115E It has no kinase activity.

[0124] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of a receptor-like cytokinase StRLCK185a gene in improving potato resistance to late blight, characterized in that, The receptor-like cytokinase StRLCK185a gene has the nucleotide sequence shown in SEQ ID No. 1; the application is to improve the resistance of potatoes to late blight by overexpressing the receptor-like cytokinase StRLCK185a gene in potatoes.

2. The application of a receptor-like cytokinase StRLCK185a gene in improving potato resistance to late blight, characterized in that, The receptor-like cytokinase StRLCK185a gene contains a polynucleotide that encodes the amino acid StRLCK185a, as shown in SEQ ID No. 2; the application is to improve the resistance of potatoes to late blight by overexpressing the receptor-like cytokinase StRLCK185a gene in potatoes.

3. The application of the protein encoded by the overexpression of the receptor-like cytokinase StRLCK185a gene in improving potato resistance to late blight, characterized in that... The amino acid sequence of the protein encoded by the receptor-like cytokinase StRLCK185a gene is shown in SEQ ID No.

2.

4. The application of the receptor-like cytokinase StRLCK185a gene as described in claim 1 or 2, or a recombinant overexpression vector containing the gene, transgenic plant lines, or genetically engineered bacteria in the cultivation of potatoes resistant to late blight.

5. A method for cultivating potatoes resistant to late blight, characterized in that, This includes introducing the receptor-like cytokinase StRLCK185a gene as described in claim 1 or 2 into potato plants and overexpressing the gene to enhance their resistance to late blight.

6. The application of the receptor-like cytokinase StRLCK185a gene as described in claim 1 or 2, or a recombinant overexpression vector containing the gene, transgenic plant lines, or genetically engineered bacteria in regulating potato resistance to late blight, characterized in that... The regulation is achieved by overexpressing the receptor-like cytokinase StRLCK185a gene.

Images