Application of genetic marker associated with shank circumference of 13-week-old chicken in genetic breeding of chicken

By applying genetic markers SC_tag18_1 and SC_tag18_2, the problem of the difficulty in improving the shank circumference trait in light-type high-producing laying hens was solved, and the genetic uniformity of shank circumference was improved, osteoporosis was reduced, and high-quality laying hens were obtained.

CN121852548APending Publication Date: 2026-04-14JIANGSU INST OF POULTRY SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JIANGSU INST OF POULTRY SCI
Filing Date
2025-11-25
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively improve the shank circumference of light-type high-producing laying hens through conventional breeding methods, leading to frequent osteoporosis problems in the later stages of egg production.

Method used

By applying the genetic markers SC_tag18_1 and SC_tag18_2, which are associated with shank circumference in 13-week-old chickens, and by selecting favorable genes through genomic selection, the shank circumference and its uniformity can be improved, thereby reducing the incidence of osteoporosis.

Benefits of technology

By improving the shank circumference of laying hens through genetic breeding, we can obtain flocks with stronger legs and better body size uniformity, reduce the risk of osteoporosis, and obtain high-quality laying hen breeds.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121852548A_ABST
    Figure CN121852548A_ABST
Patent Text Reader

Abstract

The invention provides application of a genetic marker associated with the shank girth of a 13-week-old chicken in chicken genetic breeding, and belongs to the technical field of animal genetic breeding and genetic marker detection, and the genetic marker associated with the shank girth of the 13-week-old chicken comprises SCtag181 and / or SCtag182; the SCtag181 corresponds to the 10017293 site of the physical position of a chromosome 18 in the sequence information of a chicken reference genome bGalGal1. Mat.broil.GRCg7b version published in NCBI (National Center of Biotechnology Information), and belongs to the 19 intron sequence of a gene RPTOR, and the basic group at the position is A or G; the SCtag182 corresponds to the 10125815th site of the physical position of the No.18 chromosome in the same version of sequence information and belongs to the 67 exon missense mutation of the gene RNF213, and the basic group at the site is T or C. The SCtag181 and the SCtag182 are both helpful for genetically improving the shin girth of the chicken, and when the SCtag181 and the SCtag182 are applied to genetic breeding of the chicken, the uniformity of growth traits can be improved, and the incidence frequency of osteoporosis can be reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of animal genetics and breeding and genetic marker detection technology, and specifically relates to the application of genetic markers associated with shank circumference of 13-week-old chickens in chicken genetics and breeding. Background Technology

[0002] Tibia circumference is a commonly used indicator in laying hen breeding, used to evaluate both skeletal development and body size uniformity. Tibia circumference uniformity is an important indicator of flock growth; similar tibia circumference growth rates suggest that the age at which the hens begin laying is also similar. High tibia circumference uniformity also indicates that the eggs produced by the flock will be of uniform size. High flock uniformity also means easier management in terms of lighting, space, and feeding. Bone calcium is the main source of calcium for eggshells. According to Muir et al., the calcium deposited in the eggshells of a commercial laying hen over its lifetime is approximately equal to its body weight. Light-type laying hens, including Leghorn and Dongxiang Green-shelled hens, often face osteoporosis near the end of their laying period. This is mainly due to an imbalance between structural bone and medullary bone, leading to a loss of structural bone integrity. To reduce the harm of osteoporosis to light-type high-producing laying hens, it is necessary to improve the skeletal quality of laying hens, including the selection of tibia circumference. Tibial circumference is regulated by multiple genes with minor effects. Conventional breeding methods are difficult to make effective progress genetically. Only by clarifying the genetic structure of tibial circumference and improving the accuracy of breeding through genomic selection can we achieve the goal of genetically increasing tibial circumference size. Summary of the Invention

[0003] To address the problem of osteoporosis in the later stages of egg production in light-weight, high-producing laying hens, this invention provides the application of genetic markers associated with shank circumference in 13-week-old chickens in chicken genetic breeding. These genetic markers include SC_tag18_1 and SC_tag18_2. Both SC_tag18_1 and SC_tag18_2 contribute to genetically improving shank circumference and its uniformity. Applying them to chicken genetic breeding can help reduce the incidence of osteoporosis by improving shank circumference in laying hens and improve flock uniformity by selecting beneficial genes.

[0004] This invention is achieved through the following technical solution: This invention provides the application of genetic markers associated with shank circumference in 13-week-old chickens in chicken genetic breeding, wherein the genetic markers associated with shank circumference in 13-week-old chickens include SC_tag18_1 and / or SC_tag18_2; The SC_tag18_1 corresponds to the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, which is located at position 10017293 on chromosome 18 and belongs to the 19th intron sequence of the gene RPTOR. The base here is A or G. The SC_tag18_2 corresponds to the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, which is located at position 10125815 on chromosome 18. It belongs to the missense mutation [Ser / Asn] in exon 67 of gene RNF213, where the base is T or C.

[0005] Based on the same inventive concept, the present invention provides an early screening method for chicken shank girth traits, the early screening method comprising early screening of chicken shank girth traits based on the genotypes of genetic markers SC_tag18_1 and / or SC_tag18_2; The SC_tag18_1 corresponds to the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, which is located at position 10017293 on chromosome 18 and belongs to the 19th intron sequence of the gene RPTOR. The base here is A or G. The SC_tag18_2 corresponds to the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, which is located at position 10125815 on chromosome 18. It belongs to the missense mutation in exon 67 of gene RNF213, where the base is T or C.

[0006] Furthermore, the early screening method specifically includes: Detect the genotypes of genetic markers SC_tag18_1 and / or SC_tag18_2 in the genome of the chicken to be tested; Early selection of the tibia circumference trait of the chickens to be tested based on the genotypes of SC_tag18_1 and / or SC_tag18_2; Specifically, the tibia circumference of individuals with the GG genotype in SC_tag18_1 is smaller than that of individuals with the GA genotype, and the tibia circumference of individuals with the GA genotype is smaller than that of individuals with the AA genotype; the tibia circumference of individuals with the CC genotype in SC_tag18_2 is smaller than that of individuals with the CT genotype, and the tibia circumference of individuals with the CT genotype is smaller than that of individuals with the TT genotype.

[0007] Furthermore, the detection of the genotypes of genetic markers SC_tag18_1 and / or SC_tag18_2 in the genome of the chicken to be tested specifically includes: The genotypes of genetic markers SC_tag18_1 and / or SC_tag18_2 in the genome of the chicken to be tested were detected. The method for detecting the genotype of SC_tag18_1 in the chicken to be tested is as follows: Using Pr_sc1f and Pr_sc1r as primers, PCR amplification was performed on the genomic DNA of the chicken to be tested; The PCR amplification products were sequenced to obtain the genotype at position 10017293 on the positive strand of chromosome 18 of the chicken to be tested. The method for detecting the genotype of the SC_tag18_2 in the test chickens is as follows: Using Pr_sc2f and Pr_sc2r as primers, PCR amplification was performed on the genomic DNA of the chicken to be tested; The PCR amplification products were sequenced to obtain the genotype of chromosome 18 positive strand 10125815 of the test chicken. The nucleotide sequence of Pr_sc1f is shown in SEQ ID NO.1, the nucleotide sequence of Pr_sc1r is shown in SEQ ID NO.2, the nucleotide sequence of Pr_sc2f is shown in SEQ ID NO.3, and the nucleotide sequence of Pr_sc2r is shown in SEQ ID NO.4.

[0008] Preferably, the breed of chicken to be tested includes Dongxiang green-shelled chicken and / or White Leghorn chicken.

[0009] Based on the same inventive concept, the present invention provides primers for detecting genetic markers SC_tag18_1 and / or SC_tag18_2, said primers including primers for detecting SC_tag18_1 and / or primers for detecting SC_tag18_2; The primers for detecting SC_tag18_1 include Pr_sc1f and Pr_sc1r, the nucleotide sequence of Pr_sc1f is shown in SEQ ID NO.1, and the nucleotide sequence of Pr_sc1r is shown in SEQ ID NO.2; The primers for detecting SC_tag18_2 include Pr_sc2f and Pr_sc2r, the nucleotide sequence of which is shown in SEQ ID NO.3 and the nucleotide sequence of which is shown in SEQ ID NO.4.

[0010] Based on the same inventive concept, this invention provides the application of primers for detecting genetic markers SC_tag18_1 and / or SC_tag18_2 in chicken genetic breeding.

[0011] Furthermore, the SC_tag18_1 corresponds to the 10017293rd position of the physical location on chromosome 18 in the chicken reference genome version bGalGal1.mat.broiler.GRCg7b published in NCBI, which belongs to the 19th intron sequence of the gene RPTOR, and the base here is A or G; The SC_tag18_2 corresponds to the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, which is located at position 10125815 on chromosome 18. It belongs to the missense mutation of exon 67 of gene RNF213, and the base here is T or C. The tibia circumference of individuals with the GG genotype in SC_tag18_1 is smaller than that of individuals with the GA genotype, and the tibia circumference of individuals with the GA genotype is smaller than that of individuals with the AA genotype; the tibia circumference of individuals with the CC genotype in SC_tag18_2 is smaller than that of individuals with the CT genotype, and the tibia circumference of individuals with the CT genotype is smaller than that of individuals with the TT genotype.

[0012] Based on the same inventive concept, the present invention provides a kit containing the primers described above for detecting genetic markers SC_tag18_1 and / or SC_tag18_2.

[0013] Based on the same inventive concept, this invention provides an application of a reagent kit in chicken genetic breeding.

[0014] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages: This invention relates to the application of genetic markers associated with tibia circumference in 13-week-old chickens in chicken genetic breeding. The genetic markers associated with tibia circumference in 13-week-old chickens include SC_tag18_1 and SC_tag18_2. Individuals with beneficial genotypes of SC_tag18_1 and SC_tag18_2 have higher tibia circumferences. Applying these markers to chicken genetic breeding can help to genetically improve the tibia circumference of laying hens at 13 weeks of age, thereby obtaining laying hens with stronger legs and better body size uniformity, which is beneficial to reducing the incidence of osteoporosis and thus obtaining high-quality laying hen breeds. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 This is a box plot of tibia circumference of a 13-week-old resource population according to Embodiment 1 of the present invention; Figure 2 Manhattan plot of GWAS analysis of tibia circumference of resource population in Embodiment 2 of the present invention; Figure 3 This is a QQ plot of the tibia circumference GWAS analysis of the resource population in Embodiment 2 of the present invention; Figure 4Box plots of tibia circumference for individuals with different genotypes of SC_tag18_1 in Example 3 of this invention; Figure 5 This is a box plot of tibia circumference for individuals with different genotypes of SC_tag18_2 in Example 3 of the present invention. Detailed Implementation

[0017] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0018] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0019] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0020] The following will provide a detailed description of the application of the genetic markers associated with shank circumference of 13-week-old chickens in chicken genetic breeding, in conjunction with embodiments and experimental data.

[0021] Example 1 Resource Group Building A laying hen population was constructed based on the F2 design. Dongxiang Green-shelled Chickens and White Leghorn Chickens were used as parents, and F1 generation was obtained through reciprocal crosses. F2 generation was then bred using F1 as parents. Experimental chickens were individually tagged with wing tags and housed in single cages in a fully enclosed chicken house. Artificial lighting was provided for 16 hours during the laying period, and cooling was achieved using fans and evaporative cooling pads. Routine immunizations were administered according to the immunization program established by the Jiangsu Provincial Poultry Research Institute. Feed was supplied by COFCO, and the laying hen feed composition included 16.5% crude protein and 11511 kJ / kg metabolizable energy. During the laying period, chickens had free access to feed, with water provided by nipple drinkers, feed supplied by a traveling feeder, and manure removed by a manure conveyor belt. The shank circumference (the circumference of the mid-shank) was measured at 13 weeks of age.

[0022] After initial screening of the tibia circumference data to remove obviously erroneous and duplicate data, outliers were removed, and the data was compiled into an Excel spreadsheet. Following data cleaning, the 13-week-old tibia circumference dataset from the resource population contained 4713 records, including records from 1994 individual roosters. Using R software, observation of QQ plots, kurtosis and skewness statistics, and the Kolmogorov-Smirnov test, the tibia circumference data distribution was determined to be substantially unskewed and suitable for subsequent GWAS analysis. Figure 1As shown, a box plot of tibia circumference of the resource population at 13 weeks of age was plotted using the ggplot2 software package.

[0023] Figure 1 In the diagram, DX represents Dongxiang Green-shelled Chicken, and WL represents White Leghorn Chicken; the red box represents the shank circumference of roosters, and the yellow box represents the shank circumference of hens.

[0024] Example 2 GWAS analysis of tibial circumference at 13 weeks of age The experimental chickens were adult hens from the F2 generation of the laying hen resource population constructed in Example 1. Approximately 0.5 ml of blood was collected from the wing vein of the experimental chickens and placed in BD anticoagulant tubes (Suzhou BD Medical Instruments Co., Ltd.) for storage at -70℃. Genomic DNA was extracted and analyzed by 0.8% agarose gel electrophoresis and ultraviolet spectrophotometry. After passing the analysis, the DNA sample was diluted to 50±5 ng / μl for genotyping using a gene chip.

[0025] Using Affymetrix gene chip from Affymetrix Axiom Genotyping was performed using a 600K Chicken Genotyping Array. Data quality control was conducted according to the array's instruction manual, including: pre-genotyping quality control using APT software; PLINK quality control to remove SNPs with a detection rate below 0.97 and those deviating from Hardy-Weinberg equilibrium; SNP screening using metrics.R, SNP_filter.R, and SNP, CR, and FLD information analysis; and genotyping using BEAGLE. After quality control, 435,867 autosomal SNPs remained for subsequent analysis.

[0026] Prior to genome-wide association analysis, the independence test estimate for each SNP was calculated using the "simpleM" method in R scripts, yielding 59,308 independent markers. Using multiple correction, the genomic significance threshold was determined to be 8.43 × 10⁻⁶. -7 The suggested threshold for genome sequencing is 1.69 × 10⁻⁶. -5 To fully utilize records of individuals without genotyping, this study also used microarray data instead of pedigree data to construct a genomic relationship (G) matrix. Subsequently, a hybridization genetic relationship (H) matrix was constructed using the microarray data plus the pedigree data, as shown in the following expression:

[0027] Among them, A -1 It is the inverse of the pedigree genetic relationship matrix, and τ and ω are the integration of G. -1 and A -1 22 scaling factor, G -1 It is the inverse of the genome genetic relationship matrix. A-1 22 is the inverse of the genetic relationship matrix constructed from pedigree data of genotyped individuals. When running the program, τ is set to 1, ω to 0.7, α to 1, and β to 0.05. The G matrix is ​​calculated according to the VanRaden method.

[0028] Tibial circumference at 13 weeks of age was analyzed using a mixed linear model, and p-values ​​for the significance test of each SNP marker were obtained. The matrix expression of the linear model is as follows:

[0029] Where y represents the sample phenotypic value vector; W represents the covariance matrix; α is the intercept vector; x is the genotype vector of the label; β is the effect value of the label; G is the genetic relationship matrix constructed based on the microarray; u is the random effect vector (here, the breeding value); and ε is the residual.

[0030] GWAS screening identified genetic markers associated with tibia circumference at 13 weeks of age (Table 1). Genome-wide association analysis was performed on tibia circumference in 4713 chickens at 13 weeks of age, and the results are as follows: Figure 2 , Figure 3 As shown. By Figure 2 The Manhattan plot shows that a genomically significant marker exists on chicken chromosome 18, with five SNPs exceeding the genomically significant level and five SNPs exceeding the genomically suggested level in its vicinity, serving as evidence supporting this genetic marker. The QQ plot further verifies the reliability of the GWAS results. Figure 3 It can be seen that the vast majority of SNPs that did not deviate from the oblique line were affected by genetic drift, while SNPs located at the tail of the QQ plot were affected by artificial selection. The calculated expansion coefficient was 1.129, indicating that there was no obvious population stratification in the tibia circumference trait of the resource population. Genetic parameters were analyzed using the hybridization matrix, and the heritability of tibia circumference at 13 weeks of age was found to be 0.459 ± 0.035.

[0031] Table 1 Genetic markers related to tibial circumference ; Wherein: the physical location of the marker chromosome is referenced to the whole chicken genome (bGalGal1.mat.broiler.GRCg7b).

[0032] In Table 1, "minor" indicates that the allele frequency is minor.

[0033] Example 3 Detection and validation of genetic markers Candidate gene association analysis was performed on the Dongxiang Green-shelled Egg Chicken-Leihun Chicken resource population using the aforementioned SNP genetic markers. The specific steps are as follows: 1) PCR primers: DNA template sequence information was downloaded from the NCBI website, and PCR amplification primers were designed using Primer Premier 6.0 software. Primer information is shown in Table 2. PCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0034] Table 2. Amplification primers used for detecting tibia circumference genetic markers in 13-week-old chickens. ; 2) Genomic DNA extraction: Genomic DNA was extracted from 1512 blood samples using the phenol-formaldehyde method. After passing the tests by ultraviolet spectrophotometer and agarose electrophoresis, PCR amplification was performed.

[0035] 3) PCR amplification process: ① Reaction system: The 10μl system includes 50ng of DNA template for identification, 10ng each of forward and reverse primers, 5μL of 2×power Taq MasterMix, and the remaining volume is made up with ultrapure water.

[0036] ② Reaction procedure: First, denature at 94℃ for 30s, anneal at 54.1℃ or 54.6℃ for 30s, extend at 72℃ for 30s, for a total of 5 cycles; then, denature at 94℃ for 30s, anneal at 54.1℃ or 54.6℃ for 30s, extend at 72℃ for 30s, for a total of 30 cycles; extend at 72℃ for 5min, and store at 4℃.

[0037] 4) The amplified product was sent to a sequencing company for sequence polymorphism detection. The nucleotide sequence of the amplified fragment is as follows: SC_tag18_1 TTATCAGCCTCCGTTCCT GAGACACCCTAGGATTTCTTCTTTTTTATCTCCTATTTTAACAACGTGCATATAAACGCGCAGGGAGAATTAGCTAGGTAAGGCTTTCTTGTATGAGTAACACAACAAAATGGCTGTGCTGTACAGAAATACGACCTACACGAAAAATAATCGGGGGAAGCTGTTGCTGCCAGACAGCCCAGCTGCTGCA TCCATGGGAT[A / G]GGGAGTCCTTGTTTTGATTATCTAGGCAACTAAACCGTGGTGGACATAAAATCCCTTCATGTGTGACATTTTTGTGCTCATATTCCTAGGAGGATTGCTGTCTGCCACAGCGAGGCATACAGCTGAAGCCAACAGTTTCAGAGCAGGAGGGGCTCTGCCCTGCACATAGCCTAACC AGACACAAGAACGGCATT SC_tag18_2 GCTGAGTGACTGCTGTAT TCCCCAAACAGCCCATGTAGGAGGCAGGAACACACGGGGCAGCTTACAAATAGCTGCATATTCTTAACAGCAATGCATGCACTGCGTGGCCAGCAGAGCAGCCATTTGCTAACACAGCCGTTTCCATCAATGGCATTTTCATAGTGGCAGAGAAGCTTAAGTTGTTACTAAGTGTGGGTTGTTTGGGGCTGCACAGATCCCCCAAATTTACCCCCAGGTGGGTCTGAACTCATCCACAGATCTG ACACGCTTCAGCTTCAGGATGATCATCTTATGGAGCTCCTGCAGGAAGGTTTCCAGCCTGGAGTGGACCAGGTAGGTGTGGAGGAGCTTGGCCATCTCTGGACTGAGATCAGCTTTGTATTCTGTA[T / C]TGATGTCTTCAAAAGGATCCTAAAAATGCAACGAGAGAACAAATTAAAGACCAAAACCCATCACATTAAGCATCTTCATTTTAGAGGTGAGAGGACATCCCAACAGTCACTGAG GACACCAGCCTATCTAT CTTA. In the above sequences, [] indicates mutation sites, parentheses indicate allele variations, and the bolded and underlined parts at the beginning and end of the sequence indicate primer sequences.

[0038] 5) Association analysis: The genotypes of the subjects were obtained using the plink software, and a one-way ANOVA was performed on them and the shank circumference of 13-week-old chickens.

[0039] The results of the association analysis between the genetic marker SC_tag18_1 and tibial circumference are as follows: Figure 4 As shown, the average lengths at 13 weeks of age were 3.072±0.154cm (GG genotype), 3.113±0.150cm (GA genotype), and 3.231±0.236cm (AA genotype).

[0040] The results of the association analysis between the genetic marker SC_tag18_2 and tibia circumference are as follows: Figure 5 As shown, the average lengths at 13 weeks of age were 3.071±0.154cm (CC genotype), 3.112±0.152cm (CT genotype), and 3.221±0.218cm (TT genotype).

[0041] In summary, AA and TT are the favorable genotypes for the genetic markers SC_tag18_1 and SC_tag18_2, respectively.

[0042] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0043] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0044] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. The application of genetic markers associated with shank circumference in 13-week-old chickens in chicken genetic breeding, characterized in that, The genetic markers associated with shank circumference in 13-week-old chickens include SC_tag18_1 and / or SC_tag18_2; The SC_tag18_1 corresponds to the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, which is located at position 10017293 on chromosome 18 and belongs to the 19th intron sequence of the gene RPTOR. The base here is A or G. The SC_tag18_2 corresponds to the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, which is located at position 10125815 on chromosome 18. It belongs to the missense mutation in exon 67 of gene RNF213, where the base is T or C.

2. A method for early screening of chicken shank girth traits, characterized in that, The early screening method includes early screening of chicken shank girth traits based on the genotypes of genetic markers SC_tag18_1 and / or SC_tag18_2; The SC_tag18_1 corresponds to the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, which is located at position 10017293 on chromosome 18 and belongs to the 19th intron sequence of the gene RPTOR. The base here is A or G. The SC_tag18_2 corresponds to the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, which is located at position 10125815 on chromosome 18. It belongs to the missense mutation in exon 67 of gene RNF213, where the base is T or C.

3. The method for early screening of chicken shank girth traits according to claim 2, characterized in that, The early screening method specifically includes: Detect the genotypes of genetic markers SC_tag18_1 and / or SC_tag18_2 in the genome of the chicken to be tested; Early selection of the tibia circumference trait of the chickens to be tested based on the genotypes of SC_tag18_1 and / or SC_tag18_2; Specifically, the tibia circumference of individuals with the GG genotype in SC_tag18_1 is smaller than that of individuals with the GA genotype, and the tibia circumference of individuals with the GA genotype is smaller than that of individuals with the AA genotype; the tibia circumference of individuals with the CC genotype in SC_tag18_2 is smaller than that of individuals with the CT genotype, and the tibia circumference of individuals with the CT genotype is smaller than that of individuals with the TT genotype.

4. The method for early screening of chicken shank girth traits according to claim 3, characterized in that, The detection of the genotypes of genetic markers SC_tag18_1 and / or SC_tag18_2 in the genome of the chicken to be tested specifically includes: The genotypes of genetic markers SC_tag18_1 and / or SC_tag18_2 in the genome of the chicken to be tested were detected. The method for detecting the genotype of SC_tag18_1 in the chicken to be tested is as follows: Using Pr_sc1f and Pr_sc1r as primers, PCR amplification was performed on the genomic DNA of the chicken to be tested; The PCR amplification products were sequenced to obtain the genotype at position 10017293 on the positive strand of chromosome 18 of the chicken to be tested. The method for detecting the genotype of the SC_tag18_2 in the test chickens is as follows: Using Pr_sc2f and Pr_sc2r as primers, PCR amplification was performed on the genomic DNA of the chicken to be tested; The PCR amplification products were sequenced to obtain the genotype of chromosome 18 positive strand 10125815 of the test chicken. The nucleotide sequence of Pr_sc1f is shown in SEQ ID NO.1, the nucleotide sequence of Pr_sc1r is shown in SEQ ID NO.2, the nucleotide sequence of Pr_sc2f is shown in SEQ ID NO.3, and the nucleotide sequence of Pr_sc2r is shown in SEQ ID NO.

4.

5. A method for early screening of chicken shank girth traits according to claim 3 or 4, characterized in that, The breeds of chickens to be tested include Dongxiang Green-shelled Egg Chicken and / or White Leghorn Chicken.

6. Primers for detecting genetic markers SC_tag18_1 and / or SC_tag18_2, characterized in that, The primers include primers for detecting SC_tag18_1 and / or primers for detecting SC_tag18_2; The primers for detecting SC_tag18_1 include Pr_sc1f and Pr_sc1r, the nucleotide sequence of Pr_sc1f is shown in SEQ ID NO.1, and the nucleotide sequence of Pr_sc1r is shown in SEQ ID NO.2; The primers for detecting SC_tag18_2 include Pr_sc2f and Pr_sc2r, the nucleotide sequence of which is shown in SEQ ID NO.3 and the nucleotide sequence of which is shown in SEQ ID NO.

4.

7. The application of the primers for detecting genetic markers SC_tag18_1 and / or SC_tag18_2 as described in claim 6 in chicken genetic breeding.

8. The application according to claim 7, characterized in that, The SC_tag18_1 corresponds to the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, which is located at position 10017293 on chromosome 18 and belongs to the 19th intron sequence of the gene RPTOR. The base here is A or G. The SC_tag18_2 corresponds to the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, which is located at position 10125815 on chromosome 18. It belongs to the missense mutation of exon 67 of gene RNF213, and the base here is T or C. The tibia circumference of individuals with the GG genotype in SC_tag18_1 is smaller than that of individuals with the GA genotype, and the tibia circumference of individuals with the GA genotype is smaller than that of individuals with the AA genotype; the tibia circumference of individuals with the CC genotype in SC_tag18_2 is smaller than that of individuals with the CT genotype, and the tibia circumference of individuals with the CT genotype is smaller than that of individuals with the TT genotype.

9. A reagent kit, characterized in that, The kit contains the primers as described in claim 6 for detecting genetic markers SC_tag18_1 and / or SC_tag18_2.

10. The application of the kit as described in claim 9 in chicken genetic breeding.