SNP (Single Nucleotide Polymorphism) molecular marker influencing disease resistance character of Tibetan sheep and application thereof
By detecting the SNP molecular marker at locus 29462145 on chromosome 10 of Tibetan sheep, the accuracy and efficiency of early breeding of disease resistance traits in Tibetan sheep were solved, providing early breeding guidance and enabling efficient screening and optimization of breeding resources.
Patent Information
- Application Number
- CN202610200065.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-11
- Publication Date
- 2026-04-14
AI Technical Summary
Existing technologies make it difficult to efficiently screen for disease resistance traits in Tibetan sheep at the genetic level, resulting in low breeding accuracy, long cycles, and an inability to predict individual disease resistance potential in the early stages, leading to a waste of resources and time.
By detecting the SNP molecular marker at locus 29462145 on chromosome 10 of the Tibetan sheep international sheep reference genome Oar_v4.0, and using the association analysis between the three genotypes AA, AG, and GG and IL-1α, IL-1β, IL-6, TNF-β, IL-1Ra, and IL-10, early breeding guidance can be provided.
This approach enables early and efficient screening of disease-resistant traits in Tibetan sheep, provides new SNP molecular marker resources, improves the accuracy and efficiency of breeding, and reduces breeding costs.
Smart Images

Figure CN121852558A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of marker-assisted breeding technology for Tibetan sheep, and particularly relates to an SNP molecular marker that affects the disease resistance trait of Tibetan sheep and its application. Background Technology
[0002] Tibetan sheep are a unique livestock breed native to the Qinghai-Tibet Plateau region, exhibiting remarkable adaptability to the high-altitude, oxygen-deficient environment. However, the special natural environment and grazing practices of the plateau region make Tibetan sheep populations susceptible to various diseases. These infectious diseases not only directly restrict the growth, development, and reproductive efficiency of Tibetan sheep but also pose a continuous threat to the sustainable development of regional animal husbandry. Against this backdrop, improving the disease resistance of Tibetan sheep from a genetic standpoint and cultivating breeds with innate immune advantages have become key directions for the current genetic improvement of Tibetan sheep.
[0003] For a long time, the breeding of disease-resistant Tibetan sheep has mainly relied on the observation of clinical manifestations, such as disease records or evaluation of responses after immunization. This approach has several limitations: First, disease resistance is a complex quantitative trait, influenced by multiple genes and environmental factors, leading to low accuracy and long cycles in phenotype-based selection. Second, risky challenge experiments are difficult to conduct for some major diseases, hindering in-depth analysis of disease resistance mechanisms. Third, it is impossible to effectively predict an individual's disease resistance potential in early life stages (such as the young animal stage), resulting in a significant waste of breeding resources and time.
[0004] The rise of marker-assisted selection (MAG) technology has provided a new breakthrough for animal breeding. Among various genetic markers, single nucleotide polymorphisms (SNPs) are widely considered the preferred tool for precision breeding due to their high density of coverage in the genome, strong genetic stability, and suitability for large-scale detection. By locating SNP sites closely associated with target traits, early and efficient screening of superior genotypes can be achieved at the DNA level, thereby significantly accelerating genetic progress.
[0005] In the immune regulatory network, cytokines are the core mediators of inflammation and immune responses. Pro-inflammatory cytokines such as IL-1α, IL-1β, IL-6, and TNF-β are responsible for initiating the body's defense mechanisms against pathogens; while anti-inflammatory cytokines such as IL-1Ra and IL-10 play a crucial role in timely inhibiting excessive immune responses and maintaining homeostasis. The in vivo levels of these cytokines can serve as important intrinsic indicators for assessing an individual's immune regulatory capacity and disease resistance potential. Therefore, the discovery of SNP markers closely associated with key disease-resistant immune indicators in Tibetan sheep, and the development of dedicated detection reagents and kits based on these markers, is of great and urgent importance for overcoming existing breeding bottlenecks and propelling Tibetan sheep disease-resistant breeding into a new stage of molecular design. Summary of the Invention
[0006] In view of this, the purpose of this invention is to provide an SNP molecular marker that affects the disease resistance trait of Tibetan sheep and its application.
[0007] This invention provides a SNP molecular marker that affects the disease resistance trait of Tibetan sheep. The SNP molecular marker is located at nucleotide 29,462,145 on chromosome 10 of the International Sheep Reference Genome Oar_v4.0. The variant type is A / G, with three genotypes: AA, AG, and GG. Tibetan sheep individuals with genotype AA have significantly lower levels of IL-1α, IL-6, and TNF-β than those with genotype GG. Tibetan sheep individuals with genotype AA have significantly lower levels of IL-1β and IL-1Ra than those with genotypes AG and GG. Tibetan sheep individuals with genotype AA have significantly higher levels of IL-10 than those with genotype GG.
[0008] The present invention provides a DNA molecule containing the SNP molecular marker described above, the nucleotide sequence of which is shown in SEQ ID No. 1.
[0009] The present invention provides primers for detecting the molecular marker genotype of the SNP, the sequences of which are shown in SEQ ID No. 2 and SEQ ID No. 3.
[0010] This invention provides the application of the SNP molecular marker, the DNA molecule, or the primer in the selection of immune trait markers in Tibetan sheep.
[0011] This invention provides the application of the SNP molecular marker, the DNA molecule, or the primer in the early breeding of disease resistance traits in Tibetan sheep.
[0012] This invention provides a method for detecting the genotype of the SNP molecular marker, comprising the following steps: 1) Extract genomic DNA from the blood sample to be tested; 2) Using the genomic DNA obtained in step 1) as a template, perform PCR amplification with the primers to obtain the amplification product; 3) Sequencing the amplification products and analyzing the genotype at position 231 of the amplification products to determine the genotype of the SNP molecular marker.
[0013] Preferably, the PCR amplification system, in 25 μL, includes the following components: 22 μL PCR premix, 1 μL upstream primer, 1 μL downstream primer, and 1 μL template.
[0014] Preferably, the PCR amplification program is as follows: 98℃ for 2 min; 98℃ for 10 s, 58℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min.
[0015] Compared with the prior art, the present invention has the following beneficial effects: The SNP molecular marker provided by this invention is located at position 29,462,145 on chromosome 10 of the International Sheep Reference Genome Oar_v4.0; the variant type is A / G, named g29462145A>G, and there are three genotypes. When position 29,462,145 on chromosome 10 is A, the genotype is AA or AG; when position 29,462,145 on chromosome 10 is G, the genotype is GG; different genotypes are correlated with IL-1α and I... Association analysis of L-1β, IL-6, TNF-β, IL-1Ra, and IL-10 levels revealed that Tibetan sheep individuals with the AA genotype had significantly lower levels of IL-1α, IL-6, and TNF-β than those with the GG genotype (p<0.05), significantly lower levels of IL-1β and IL-1Ra than those with the AG and GG genotypes (p<0.05), and significantly higher levels of IL-10 than those with the GG genotype (p<0.05). This invention demonstrates that the bases at the g29462145A>G SNP site on Tibetan sheep chromosome 10 are SNP markers related to IL-1α, IL-1β, IL-6, TNF-β, IL-1Ra, and IL-10 in Tibetan sheep. By detecting the bases at the 29462145th nucleotide site on Tibetan sheep chromosome 10, the levels of IL-1α, IL-1β, IL-6, TNF-β, IL-1Ra, and IL-10 in individual Tibetan sheep can be determined. This invention provides a new SNP molecular marker resource for the marker-assisted selection of immune traits in Tibetan sheep for non-diagnostic purposes and offers a new approach to early molecular breeding of Tibetan sheep. Attached Figure Description
[0016] Figure 1 The results of agarose gel electrophoresis for detecting the amplification products of the g29462145A>G SNP site on chromosome 10 of Tibetan sheep, where M is the Marker and 1-3 are three replicates of the amplification product; Figure 2 The peak diagram and sequence of SNP sites obtained after purification and sequencing of PCR amplification products. Detailed Implementation
[0017] This invention provides a SNP molecular marker that affects the disease resistance trait of Tibetan sheep. The SNP molecular marker is located at nucleotide 29,462,145 on chromosome 10 of the International Sheep Reference Genome Oar_v4.0. The variant type is A / G, with three genotypes: AA, AG, and GG. Tibetan sheep individuals with genotype AA have significantly lower levels of IL-1α, IL-6, and TNF-β than those with genotype GG. Tibetan sheep individuals with genotype AA have significantly lower levels of IL-1β and IL-1Ra than those with genotypes AG and GG. Tibetan sheep individuals with genotype AA have significantly higher levels of IL-10 than those with genotype GG.
[0018] This invention provides a DNA molecule containing the aforementioned SNP molecular marker, the nucleotide sequence of which is shown in SEQ ID No. 1, as follows: AATACTTACAGCCAAGTCAGCTGATAGTAAGCTTTGAAGACTCCAGGTCTGAGAGTTGTAATGCAGTTGTGGTTGAGATATCTGCAAATAGAATGGGTGAGTCAATGAGGCAAACTTAATACTTCACTTTCGTCACATATAATTAGCATACGAGCCTCTGTTAACGATTATGAAGTACGGACATCTGTCTCCGACAGCACTCAACCGATGGGCAAGGGGAGAAAACCAAG G CCAACCAGGAGATACAGACGACCCCAAGCCCAGTGTGACAAGCACCAGGGCCAGCAGCAGGAAAGTGGCCGGAAATAATGCACTGGGGTATTATATGACCTTAGCATGTAAGAGTAGAATAAAACATGTGAGGTGATTTTTGCTTTA GCTCACCTCCTTTGTAGACTGTTGTTTTAAGAAAGTATGCACTAAGTTGTATCTGACTCTTTGTGACCCCATGGACTGTAGCCCACCATACTCCTCTGTCCATGGGATTTCCCAGGCAAGAATACTGGACTGGGTTGCCTTTTC.
[0019] This invention provides primers for detecting the molecular marker genotype of the SNP, the sequences of which are shown in SEQ ID No. 2 and SEQ ID No. 3, as follows: F: 5'-AATACTTACAGCCAAGTCAGC-3' (SEQ ID NO. 2); R: 5'-GAAAAGGCACCCAGTCCA-3' (SEQ ID NO. 3).
[0020] This invention provides the application of the aforementioned SNP molecular markers, DNA molecules, or primers in the selection of immune trait markers in Tibetan sheep. Cytokines in the blood are important signaling molecules in the immune system, participating in the regulation of inflammatory responses, immune cell proliferation and differentiation, and pathogen clearance. Among them, IL-1α and IL-6, as pro-inflammatory cytokines, can activate immune cells and promote the release of inflammatory factors, playing a key role in the early immune response against pathogen infection; TNF-α and TNF-β can regulate the activation and proliferation of immune cells, participating in the regulation of inflammatory responses; IL-1Ra, as an IL-1 receptor antagonist, can competitively inhibit the pro-inflammatory effect of IL-1, maintaining the balance of the body's inflammatory response; IL-10, as an anti-inflammatory cytokine, can inhibit the secretion of pro-inflammatory cytokines, regulate the function of immune cells, and prevent excessive inflammatory responses from damaging the body. The levels of these cytokines directly reflect the body's immune status and disease resistance potential, and differences in their expression levels are closely related to individual disease resistance traits.
[0021] This invention provides the application of the SNP molecular marker, the DNA molecule, or the primer in the early breeding of disease resistance traits in Tibetan sheep.
[0022] The present invention provides a method for detecting the genotype of the SNP molecular marker, comprising the following steps: 1) extracting genomic DNA from the blood of the sample to be tested; 2) using the genomic DNA obtained in step 1) as a template, performing PCR amplification with the primers to obtain amplification products; 3) sequencing the amplification products and analyzing the genotype at position 231 of the amplification products to determine the genotype of the SNP molecular marker.
[0023] In this invention, genomic DNA is extracted from the blood sample to be tested. The method for extracting the blood genomic DNA is not particularly limited in this invention; conventional genomic DNA extraction methods in the art can be used.
[0024] In this invention, the obtained genomic DNA is used as a template, and PCR amplification is performed using the primers in the kit to obtain amplification products. In this invention, the PCR amplification system is in 25 μL units, preferably comprising: PCR premix: 22 μL of Gold Mix (green), 1 μL of upstream primer, 1 μL of downstream primer, and 1 μL of template (genomic DNA). The preferred PCR amplification program is as follows: 98℃ for 2 min; 98℃ for 10 s, 58℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min. After obtaining the amplification products, the amplification products are sequenced, and the genotype at position 231 of the amplification products is analyzed to determine the genotype of the SNP molecular marker. In this invention, the amplification products are preferably sequenced after passing agarose gel electrophoresis. The sequencing is preferably performed using direct sequencing. The nucleotide sequence of the amplification products is shown in SEQ ID No. 1, and the SNP marker is located at position 231 of the nucleotide sequence shown in SEQ ID No. 1. In this invention, the sequencing results of the amplified products are preferably compared using the bioanalysis software MEGA 6.0, the sequencing peak diagram is analyzed, and genotyping is completed.
[0025] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0026] Example 1
[0027] 1. Sample collection
[0028] The samples were collected from Tibetan sheep populations under natural grazing conditions, including 76 samples from Gannan Tibetan Autonomous Prefecture in Gansu Province, 40 samples from Yushu Tibetan Autonomous Prefecture in Qinghai Province, and 45 samples from Shigatse City in Tibet Autonomous Region. 5 mL of blood samples were collected from 161 fasting Tibetan sheep in clean, anticoagulant vacuum blood collection tubes. The tubes were allowed to stand for 30 min, then centrifuged at 3500 rpm for 15 min. The supernatant was collected into clean PE tubes, sealed, and stored at -20°C as serum samples for the detection of pro-inflammatory and anti-inflammatory factors. Separately, 5 mL of blood samples were collected in blood collection tubes containing EDTA-K2 anticoagulant. After collection, the samples were quickly mixed, placed in a sampling box with ice packs for temporary storage, and then transported back to the laboratory and frozen at -20°C for DNA extraction.
[0029] 2. Main Reagents and Instruments
[0030] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; the blood genomics extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.; the NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL1000 markers, agarose, and nucleic acid dyes were purchased from Beijing Solarbio Science & Technology Co., Ltd.; the gold-labeled mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; the electrophoresis apparatus was purchased from Beijing Liuyi Instrument Factory; and the PCR instrument was purchased from BioRad. The IL-1α, IL-1β, IL-6, TNF-β, IL-1Ra, and IL-10 detection kits were purchased from Nanjing Jiancheng Bioengineering Institute.
[0031] 3 Methods
[0032] 3.1 Detection of IL-1α, IL-1β, IL-6, TNF-β, IL-1Ra and IL-10
[0033] The assay was performed using the enzyme-linked immunosorbent assay (ELISA) method according to the test kit from Nanjing Jiancheng Biotechnology Research Institute. The assay steps were as follows: (1) The standard was serially diluted according to the instructions; (2) 100 μL of antibody was added to each well and coated for 2 hours, then the liquid was discarded and the sample was dried; (3) 300 μL of diluted washing buffer was added to each well, the mixture was shaken for 30 seconds, then the washing buffer was discarded and the sample was patted dry with absorbent paper. This was repeated 5 times; (4) 200 μL of blocking buffer was added to each well, the mixture was gently shaken and mixed, then the mixture was allowed to stand at room temperature for 30 minutes, then the liquid was discarded and the sample was dried; (5) 300 μL of diluted washing buffer was added to each well, the mixture was shaken for 30 seconds, then the washing buffer was discarded and the sample was patted dry with absorbent paper. This was repeated 5 times; (6) 25 μL of coating buffer, 25 μL of serum sample and 50 μL of standard were added to each well and the mixture was gently shaken and mixed; (7) (8) Add 100 μL of HRP to each well, shake gently to mix, let stand at room temperature for 60 min, then discard the liquid and spin dry; (9) Add 300 μL of diluted washing solution to each well, shake for 30 s, then discard the washing solution and pat dry with absorbent paper, repeat 5 times; (10) Add 100 μL of color developing solution to each well, shake gently to mix, and develop color for 15 min; (11) Add 100 μL of stop solution to each well to stop the reaction (at this time, the blue color immediately turns yellow); (12) Zero the blank well and measure the OD value of each well at a wavelength of 450 nm; (13) Make a standard curve using the OD value of the standard and obtain the curve formula, then substitute the OD measured by the sample test tube into the calculation formula to obtain the result.
[0034] 3.2 Extraction of genomic DNA from blood
[0035] Genomic DNA was extracted from blood samples using the blood genome extraction kit from Tiangen Biotech (Beijing) Co., Ltd. The concentration and purity of the extracted DNA were detected by ultraviolet spectrophotometer. A concentration >20 ng / μL and an OD260 / OD280 between 1.7 and 1.9 were sufficient for the experiment. The DNA was stored at -20℃ for later use.
[0036] 3.3 Primer Design
[0037] Based on the gene sequence of chromosome 10 in the Oar_v4.0 version of the international sheep genome (GenBank accession number: NC_019467.2), a pair of specific primers containing the g29462145A>G SNP site was designed using Primer Premier 5.0 software.
[0038] Primer sequences: F: 5'-AATACTTACAGCCAAGTCAGC-3' (SEQ ID NO. 2); R: 5'-GAAAAGGCACCCAGTCCA-3' (SEQ ID NO. 3).
[0039] The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.
[0040] 3.4 PCR amplification and sequencing
[0041] PCR amplification system 25μL: Gold Mix (green) 22μL, upstream and downstream primers 1μL each, template 1μL.
[0042] PCR amplification program: 98℃ for 2 min; 98℃ for 10 s, 58℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min.
[0043] PCR products were detected by 1.5% agarose gel electrophoresis. After passing the agarose gel electrophoresis test, the PCR products were sequenced using direct sequencing, which was performed by Beijing Qingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID No. 1, with a fragment length of 522 bp. The SNP marker is located at position 231 (bold and underlined) of the nucleotide sequence shown in SEQ ID No. 1, as detailed below: AATACTTACAGCCAAGTCAGCTGATAGTAAGCTTTGAAGACTCCAGGTCTGAGAGTTGTAATGCAGTTGTGGTTGAGATATCTGCAAATAGAATGGGTGAGTCAATGAGGCAAACTTAATACTTCACTTTCGTCACATATAATTAGCATACGAGCCTCTGTTAACGATTATGAAGTACGGACATCTGTCTCCGACAGCACTCAACCGATGGGCAAGGGGAGAAAACCAAG G CCAACCAGGAGATACAGACGACCCCAAGCCCAGTGTGACAAGCACCAGGGCCAGCAGCAGGAAAGTGGCCGGAAATAATGCACTGGGGTATTATATGACCTTAGCATGTAAGAGTAGAATAAAACATGTGAGGTGATTTTTGCTTTA GCTCACCTCCTTTGTAGACTGTTGTTTTAAGAAAGTATGCACTAAGTTGTATCTGACTCTTTGTGACCCCATGGACTGTAGCCCACCATACTCCTCTGTCCATGGGATTTCCCAGGCAAGAATACTGGACTGGGTTGCCTTTTC.
[0044] The sequencing results of PCR products were compared using the bioanalysis software MEGA 6.0, and the sequencing peak diagrams were analyzed to complete the typing.
[0045] 4. Statistical Analysis
[0046] Based on the genotyping results, the number of individuals with different genotypes at each locus was counted. Popgen32 software was used to calculate the gene frequency, genotype frequency, effective allele count (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test. Polymorphism information content (PIC) was calculated using PIC software. IBM SPSS Statistics 22 software was used to analyze the association between different genotypes in Tibetan sheep and IL-1α, IL-1β, IL-6, TNF-β, IL-1Ra, and IL-10 using a general linear model. Results are expressed as mean ± standard error.
[0047] 5 Results
[0048] 5.1 PCR amplification and sequencing results
[0049] The amplification products of the g29462145A>G SNP site on chromosome 10 of Tibetan sheep were detected using 1.5% agarose gel electrophoresis (see [link to article]). Figure 1 The bands were clear and free of impurities, indicating good specificity. The PCR product fragment size was 522 bp, which met the expected size, and the next step of the experiment could be carried out.
[0050] The peak chromatogram and sequence obtained after purification and sequencing of the PCR product are shown below. Figure 2 .Depend on Figure 2 It can be seen that the AG mutation occurs at the g29462145A>GSNP site, resulting in three genotypes: AA, AG, and GG.
[0051] 5.2 Statistical Analysis Results
[0052] Genotype and allele frequencies of the g29462145A>G SNP locus on chromosome 10 of Tibetan sheep were analyzed from a population genetics perspective. Table 1 shows that at the g29462145A>G SNP locus, the GG genotype had the highest frequency and was the dominant genotype, while the G allele frequency was 76.4%, indicating a dominant allele. The χ² fitness test showed that the SNP locus significantly deviated from Hardy-Weinberg equilibrium (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.361, and the PIC was 0.296, indicating moderate polymorphism.
[0053] Table 1. Polymorphism of SNP site g29462145A>G on chromosome 10 of Tibetan sheep
[0054] 5.3 Association analysis between different genotypes and IL-1α, IL-1β, IL-6, TNF-β, IL-1Ra, and IL-10
[0055] The association between different genotypes of Tibetan sheep and the levels of IL-1α, IL-1β, IL-6, TNF-β, IL-1Ra, and IL-10 was analyzed using a general linear model in IBM SPSS Statistics 22 software. The results showed that the levels of IL-1α, IL-6, and TNF-β in Tibetan sheep with the AA genotype were significantly lower than those with the GG genotype (p<0.05). The levels of IL-1β and IL-1Ra in Tibetan sheep with the AA genotype were significantly lower than those with the AG and GG genotypes (p<0.05). The level of IL-10 in Tibetan sheep with the AA genotype was significantly higher than that with the GG genotype (p<0.05). This indicates that the base at the g29462145A>G SNP site on chromosome 10 of Tibetan sheep is a SNP marker related to IL-1α, IL-1β, IL-6, TNF-β, IL-1Ra, and IL-10. The results are shown in Table 2.
[0056] Table 2. Correlation analysis between different genotypes and the relative levels (concentrations) of IL-1α, IL-1β, IL-6, TNF-β, IL-1Ra, and IL-10.
[0057] Note: Different lowercase letters in the intercalation of data in the same row indicate significant differences (P < 0.05).
[0058] As can be seen from the above embodiments, the genotype of the SNP molecular marker described in this invention is significantly correlated with the cytokine content of Tibetan sheep. By detecting the genotype of the SNP molecular marker, the levels of IL-1α, IL-1β, IL-6, TNF-β, IL-1Ra, and IL-10 in individual Tibetan sheep can be determined. This invention provides a new SNP molecular marker resource for the selection of immune trait markers in Tibetan sheep for non-diagnostic purposes.
[0059] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A SNP molecular marker affecting disease resistance traits in Tibetan sheep, characterized in that, The SNP molecular marker is located at nucleotide 29,462,145 on chromosome 10 of the International Sheep Reference Genome Oar_v4.
0. The variant type is A / G, with three genotypes: AA, AG, and GG. Tibetan sheep individuals with genotype AA had significantly lower levels of IL-1α, IL-6, and TNF-β than those with genotype GG. Tibetan sheep individuals with genotype AA had significantly lower levels of IL-1β and IL-1Ra than those with genotypes AG and GG. Tibetan sheep individuals with genotype AA had significantly higher levels of IL-10 than those with genotype GG.
2. A DNA molecule comprising the SNP molecular marker of claim 1, wherein the nucleotide sequence of the DNA molecule is shown in SEQ ID No.
1.
3. Primers for detecting the SNP molecular marker genotype as described in claim 1, characterized in that, The sequences of the primers are shown in SEQ ID No. 2 and SEQ ID No.
3.
4. The application of the SNP molecular marker of claim 1, the DNA molecule of claim 2, or the primer of claim 3 in the selection of immune trait markers in Tibetan sheep.
5. The application of the SNP molecular marker of claim 1, the DNA molecule of claim 2, or the primer of claim 3 in the early breeding of disease resistance traits in Tibetan sheep.
6. The method for detecting the SNP molecular marker genotype according to claim 1, characterized in that, Includes the following steps: 1) Extract genomic DNA from the blood sample to be tested; 2) Using the genomic DNA obtained in step 1) as a template, perform PCR amplification using the primers described in claim 3 to obtain the amplification product; 3) Sequencing the amplification products and analyzing the genotype at position 231 of the amplification products to determine the genotype of the SNP molecular marker.
7. The method according to claim 6, characterized in that, The PCR amplification system, in 25 μL units, includes the following components: 22 μL PCR premix, 1 μL upstream primer, 1 μL downstream primer, and 1 μL template.
8. The method according to claim 7, characterized in that, The PCR amplification program is as follows: 98℃ for 2 min; 98℃ for 10 s, 58℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min.