Fetub gene molecular marker related to bovine sperm motility traits and application thereof

CN121852565BActive Publication Date: 2026-07-21JILIN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-03-17
Publication Date
2026-07-21

Smart Images

  • Figure CN121852565B_ABST
    Figure CN121852565B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of animal genetic engineering, and provides a FETUB gene molecular marker related to the sperm vigor trait of a cow and application thereof, wherein the FETUB gene molecular marker is an SNP site on a FETUB gene fragment of the cow as shown in the sequence table SEQ ID NO:1, specifically, the 315th site of the FETUB gene fragment, the site has an A-G base mutation, resulting in the generation of a single nucleotide polymorphism of the gene. Based on the FETUB gene molecular marker, the genotype is determined by sequence determination, the genotype is associated with the normal and post-thawing vigor traits of the sperm of the cow, and the normal and post-thawing vigor of the sperm of individuals with different genotypes has a significant difference. The FETUB gene molecular marker provided by the application provides a theoretical basis and specific application for marker-assisted selection of the cow.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of animal genetic engineering technology, and in particular relates to a molecular marker of the FETUB gene related to bovine sperm motility and its application. Background Technology

[0002] In recent years, the application of artificial insemination technology has made a significant contribution to the advancement of livestock reproduction. By effectively utilizing the genetic resources of superior bull breeds, it has significantly improved reproductive efficiency and promoted the standardization of cattle breed improvement. The widespread application of this technology has led to an increasingly urgent need for long-term semen preservation and inter-regional transportation, thus giving rise to and popularizing semen cryopreservation technology.

[0003] While sperm cryopreservation technology has successfully expanded the spatial and temporal reach of genetic resources, its core bottleneck lies in the multiple damages to sperm caused during the freezing-thawing process. During this process, sperm not only undergo cold stress, but also experience significant declines in membrane structural integrity and functional activity due to ice crystal formation, drastic changes in osmotic pressure, and alterations in cell membrane fluidity and permeability. This results in loss of motility and unstable quality after thawing, severely limiting the expected efficiency of the technology.

[0004] It is noteworthy that sperm tolerance to cryogenic damage exhibits significant individual differences, suggesting that genetic factors play a decisive role. Therefore, analyzing and screening molecular markers related to cryogenic resistance at the genetic level has become an important direction for overcoming this bottleneck. Among these, single nucleotide polymorphisms (SNPs) have become an effective tool for studying genetic variations related to reproductive traits due to their widespread distribution in the genome and ease of precise detection.

[0005] The FETUB gene, as a protease inhibitor, plays a crucial role in maintaining normal fertilization function. Studies have shown that this gene plays a key role in reproduction, effectively preventing premature hardening of the zona pellucida of oocytes, thus ensuring sperm can successfully complete the recognition, adhesion, and penetration processes. This suggests that the functional state of the FETUB gene is closely related to sperm fertilization potential and intrinsic quality. Based on its molecular characteristics, it can be further inferred that FETUB not only acts on the fertilization process but may also potentially affect sperm's inherent ability to resist cryopreservation damage by inhibiting the activity of enzymes that degrade sperm membrane proteins during freezing, or by stabilizing the cellular microenvironment through its glycosylation and calcium ion binding properties.

[0006] However, no research has yet clearly revealed how specific SNPs in the FETUB gene affect the cryopreservation resistance of bovine sperm, especially the maintenance of motility after thawing. Clarifying this issue is of great significance for selecting superior bulls through molecular markers and further improving the quality of frozen semen, and is also the core starting point of this invention. Summary of the Invention

[0007] The purpose of this invention is to provide a molecular marker for the FETUB gene related to bovine sperm motility traits and its application, aiming to solve the problems raised in the background art.

[0008] To achieve the above objectives, the present invention provides the following technical solution:

[0009] A molecular marker for the FETUB gene associated with bovine sperm motility traits, wherein the bovine sperm motility traits include normal and thawed bovine sperm motility traits; the molecular marker for the FETUB gene is an SNP site on the bovine FETUB gene fragment as shown in SEQ ID NO:1; the SNP site is position 315 of the bovine FETUB gene fragment, which has an AG base mutation, resulting in a single nucleotide polymorphism in the gene.

[0010] Another object of the present invention is to provide a specific primer set, wherein the specific primer set is used to identify the above-mentioned molecular marker of the FETUB gene associated with bovine sperm motility traits, and includes forward primers and reverse primers as shown in SEQ ID NO:2-3, respectively.

[0011] Another object of the present invention is to provide the application of the above-mentioned FETUB gene molecular marker related to bovine sperm motility traits in the preparation of a kit for detecting the normal and thawed motility traits of bovine sperm.

[0012] Another object of the present invention is to provide an application of the above-mentioned FETUB gene molecular marker related to bovine sperm motility traits in marker-assisted selection of normal and thawed bovine sperm motility traits, characterized in that the FETUB gene molecular marker is used to screen or evaluate breeding bulls with high normal sperm motility and high thawed sperm motility.

[0013] Another object of the present invention is to provide the application of the above-mentioned specific primer set in the preparation of a kit for detecting the normal and thawed motility traits of bovine sperm.

[0014] Another objective of this invention is to provide an application of the above-mentioned specific primer set in marker-assisted selection of normal and thawed sperm motility traits in bovine sperm, characterized in that the FETUB gene molecular marker is used to screen or evaluate breeding bulls with high normal sperm motility and high thawed sperm motility.

[0015] Furthermore, the method for marker-assisted selection of normal and thawed bovine sperm motility traits includes the following steps:

[0016] Genomic DNA was extracted from the blood of individuals to be screened, and PCR amplification was performed using the specific primer set described above to obtain PCR products;

[0017] The PCR product was sequenced to determine the base type at position 315, and the sequencing results were obtained.

[0018] The genotype of the individuals to be screened was determined based on the sequencing results, and a correlation analysis was performed with the normal and thawed sperm motility traits of bovine sperm.

[0019] Furthermore, the genotypes include AA, AG, and GG; the sperm of individuals with the GG genotype are normal and have better motility after thawing than those with the AG and AA genotypes.

[0020] This invention provides a molecular marker for the FETUB gene associated with bovine sperm motility. Genotype determination through sequencing allows for association between genotype and normal and thawed sperm motility. Analysis results show significant differences in normal and thawed sperm motility among individuals with different genotypes. This invention utilizes a specific primer set to obtain a partial fragment of the FETUB gene associated with normal and thawed sperm motility, and uses specific SNP sites within this fragment as molecular markers, providing a theoretical basis and practical application for marker-assisted selection in cattle. Attached Figure Description

[0021] Figure 1 The results of 1.5% agarose gel electrophoresis are shown for the FETUB gene amplification products in Example 1. In the figure, lane M is the standard molecular weight marker, and lanes 1-5 are 5 randomly detected PCR products with a clear and specific band at the 544bp position.

[0022] Figure 2 The image shows the sequencing peaks of the PCR products of the three genotypes of the FETUB gene in Example 1. In the image, the arrows indicate the mutation sites; for AA genotype individuals, the site is an A base; for AG genotype individuals, the site is an A / G base; and for GG genotype individuals, the site is a G base.

[0023] Figure 3 The results of 1.5% agarose gel electrophoresis are shown for the FETUB gene amplification products in Example 2. In the figure, lane M is the standard molecular weight marker, and lanes 1-6 are 6 randomly detected PCR products, which have a clear and specific band at the 544bp position.

[0024] Figure 4 The image shows the sequencing peaks of the PCR products of the three genotypes of the FETUB gene in Example 2. In the image, the arrows indicate the mutation sites; for AA type individuals, the site is an A base; for AG type individuals, the site is an A / G base; and for GG type individuals, the site is a G base. Detailed Implementation

[0025] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0026] In one embodiment of the present invention, a specific mutation site is identified by cloning a bovine FETUB gene fragment (544 bp, nucleotide sequence as shown in SEQ ID NO:1) to serve as a method for detecting polymorphisms in genes related to normal bovine sperm motility and thawed sperm motility, providing a meaningful molecular marker for bovine marker-assisted breeding; the molecular marker for the FETUB gene is the SNP site on the aforementioned bovine FETUB gene fragment; specifically, the SNP site is the 315th site of the aforementioned bovine FETUB gene fragment, which has an AG base mutation, resulting in the generation of a single nucleotide polymorphism (SNP).

[0027] In another embodiment of the present invention, a specific primer set is also provided, wherein the specific primer set is used to identify the above-mentioned molecular marker of the FETUB gene associated with bovine sperm motility traits, specifically including the forward primer and the reverse primer as shown in sequence listing SEQ ID NO:2-3, respectively.

[0028] In another embodiment of the present invention, a method for screening molecular markers suitable for bovine sperm normal and thawed motility traits and for use in bovine marker-assisted selection is also provided. The FETUB gene molecular marker is used to screen or evaluate breeding bulls with high sperm normal and thawed motility, specifically including the following steps:

[0029] S1. Genomic DNA is extracted from the blood of individuals to be screened and amplified by PCR using the specific primer set mentioned above to obtain PCR products. Due to the presence of an AG base mutation at position 315 of the DNA sequence of the PCR product fragment, SNP polymorphism is generated.

[0030] S2. Sequencing the PCR product to determine the base type at position 315, and obtaining the sequencing results;

[0031] S3. The genotypes of the individuals to be screened were determined based on the sequencing results, and correlation analysis was performed with the normal and thawed sperm motility traits of bovine sperm. Among them, the genotypes included AA, AG, and GG. The results showed that individuals with specific genotypes would have higher normal and thawed sperm motility. Specifically, individuals with the GG genotype had better normal and thawed sperm motility than those with the AG and AA genotypes.

[0032] In this embodiment of the invention, by performing an association analysis on the genetic polymorphism of the bovine FETUB gene and the normal and post-thawed sperm motility traits, the influence of specific SNP sites in the FETUB gene and the genetic polymorphism at these sites on normal and post-thawed sperm motility was clarified. This embodiment of the invention provides an important theoretical basis and application prospect for using the FETUB gene as a molecular marker for auxiliary selection of normal and post-thawed sperm motility and related reproductive performance in bovine production, and for its application in genetic improvement.

[0033] The following embodiments are implementation examples of the technical solution of the present invention in practical applications, but are not limited thereto. Unless otherwise specified, all materials and reagents involved are commercially available products; unless otherwise specified, all experimental methods used are conventional methods.

[0034] Example 1: This example uses extracted bovine genomic DNA as a template, designs a pair of specific primers, clones a partial DNA sequence of the bovine FETUB gene, and performs sequencing and genotyping. The association between different genotypes and normal and thawed bovine sperm motility traits is then analyzed to provide molecular markers for marker-assisted selection in cattle, as detailed below:

[0035] 1. Cloning of a partial DNA fragment of the bovine FETUB gene: To ensure good primer quality, the specific primers used in this embodiment of the invention were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the specific sequences of these specific primers are as follows:

[0036] Forward primer: FETUB-fwd (as shown in SEQ ID NO:2 of the sequence listing): GCCCAGTGTGCAAAGTCAAC;

[0037] Reverse primer: FETUB-rev (as shown in SEQ ID NO:3 in the sequence listing): GCCTAGAGGTGAAAACGCT.

[0038] The Taq enzyme, buffer, magnesium ions, dNTPs, etc. required in the PCR reaction can be selected by the user. To obtain good results quickly, this embodiment of the invention uses the 2× chemical dye quantitative PCR premix from MonAmp Biotechnology Co., Ltd. for PCR amplification. The specific reaction system is as follows: 10.0 μL of 2×MonAmp ChemoHS qPCR Mix (provided in the product packaging), 0.5 μL each of forward and reverse primers (concentration of 10 pmol / μL), 0.5 μL of genomic DNA (containing 10-50 ng DNA), and 8.5 μL of double-distilled water. The PCR reaction conditions are: 94℃ pre-denaturation for 1 minute; 94℃ denaturation for 45 seconds, 55℃ annealing for 45 seconds, 72℃ extension for 45 seconds, for a total of 35 cycles; and a final extension at 72℃ for 5 minutes.

[0039] 2. PCR product sequencing and genotype determination: Bovine genomic DNA was amplified using primers FETUB-fwd (SEQ ID NO:2) and FETUB-rev (SEQ ID NO:3) to obtain a 544 bp specific amplified fragment. The sequence of this fragment is shown in SEQ ID NO:1 of the sequence listing, specifically:

[0040] .

[0041] Sequencing results revealed that within this 544bp fragment, a mutation at position 315 (AG) resulted in different genotypes: AA, AG, and GG. Individuals with the AA genotype were homozygous for A at position 315; individuals with the AG genotype were heterozygous for A / G at position 315; and individuals with the GG genotype were homozygous for G at position 315 (e.g., ...). Figure 2 (As shown).

[0042] 3. Marker-Track Association Analysis: Using the applicant's experimental population as the experimental subjects, a marker-track association analysis was conducted. The One-Way ANOVA procedure in SPSS 22.0 software was used to establish the following statistical analysis model for the marker-track association analysis:

[0043] The statistical analysis model is: Yij =μ+G i +e j .

[0044] Among them, Y ij G represents the phenotypic value of the observed individual's productive performance; μ represents the least squares mean of productive performance; G i e represents the effect of genotype on production performance. j This represents the random residuals corresponding to the observed values.

[0045] 4. Cloning of partial DNA sequences of the bovine FETUB gene and determination of different genotypes: PCR amplification products were detected by 1.5% agarose gel electrophoresis, showing them to be specific PCR products, such as... Figure 1 As shown. The PCR product was recovered and sequenced, revealing a product length of 544 bp. Sequencing results showed an A and B base mutation at position 315 bp of this fragment, with some sequencing peaks as shown. Figure 2 As shown.

[0046] 5. Association analysis of marker traits: Association analysis of the SNP site at position 315 of the amplified sequence of the bovine FETUB gene with normal sperm motility and post-thaw motility in bovine sperm showed that, among the 94 randomly selected individuals, 24 were AA type, 37 were AG type, and 33 were GG type. The results of the significant differences (mean ± standard error) between normal sperm motility and post-thaw motility among individuals with different genotypes are shown in Table 1.

[0047] Table 1. Results of the analysis of significant differences in sperm motility between individuals with different genotypes and those after thawing in Example 1.

[0048] Normal vitality (%) <![CDATA[69.68 ± 1.12 a ]]> <![CDATA[74.34 ± 0.68 b ]]> <![CDATA[80.57 ± 0.83 c ]]> Viability after thawing (%) <![CDATA[41.65 ± 0.41 a ]]> <![CDATA[44.84 ± 0.73 b ]]> <![CDATA[46.73 ± 0.29 c ]]>

[0049] Note: In the same row, different letters on the shoulder labels of different groups of data indicate significant differences (P<0.05).

[0050] The analysis results showed that there were significant differences in sperm normality and post-thaw motility among individuals corresponding to different genotypes at this SNP locus. Overall, the sperm normality and post-thaw motility of GG-type individuals were better than those of AG or AA-type individuals. When selecting breeding bulls, GG-type individuals should be given priority, while AA-type individuals should be avoided as much as possible.

[0051] Example 2: Sixty-eight individuals were randomly selected from the breeding bull population at the bull station. Blood samples were collected for genomic DNA extraction, and PCR amplification was performed using the specific primers, PCR reaction system, and conditions described above. PCR amplification was performed using 2× chemical dye-based quantitative PCR premix from MonAmpChemoHS Technology Co., Ltd. The specific reaction system was as follows: 10.0 μL of 2×MonAmpChemoHS qPCR Mix, 0.5 μL each of forward and reverse primers (both at a concentration of 10 pmol / μL), 0.5 μL of genomic DNA (containing 10-50 ng DNA), and 8.5 μL of double-distilled water. The PCR reaction conditions were: 94℃ pre-denaturation for 1 minute; 94℃ denaturation for 45 seconds, 55℃ annealing for 45 seconds, 72℃ extension for 45 seconds, for a total of 35 cycles; and a final extension at 72℃ for 5 minutes.

[0052] The amplification products were detected by 1.5% agarose gel electrophoresis, and the results showed that they were specific PCR products. Figure 3 As shown, lane M represents the standard molecular weight marker, and lanes 1-6 contain randomly selected PCR products for testing. The PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Sequencing results showed an AG base mutation at 315 bp in this fragment, with some sequencing peaks as shown... Figure 4 As shown. Of the 68 individuals examined, 19 were of type AA; 31 were of type AG; and 18 were of type GG.

[0053] Based on the records of normal sperm and post-thawed motility of these 68 individuals, correlation analysis was performed using the same method as in Example 1. The correlation analysis results (least squares values ​​and standard deviations) between different genotypes and normal sperm and post-thawed motility in these 68 individuals are shown in Table 2.

[0054] Table 2. Results of analysis of significant differences in sperm motility between individuals with different genotypes and those with normal sperm and sperm motility after thawing in Example 2.

[0055] Normal vitality (%) <![CDATA[69.24 ± 1.32 a ]]> <![CDATA[74.14 ± 0.81 b ]]> <![CDATA[79.94 ± 1.22 c ]]> Viability after thawing (%) <![CDATA[41.75 ± 0.50 a ]]> <![CDATA[44.16 ± 0.42 b ]]> <![CDATA[46.59 ± 0.46 c ]]>

[0056] Note: In the same row, different letters on the shoulder labels of different groups of data indicate significant differences (P<0.05).

[0057] Analysis results show that individuals corresponding to different genotypes of the SNP locus provided in this embodiment of the invention exhibit significant differences in sperm normality and post-thaw motility traits. Individuals with the GG genotype show better sperm normality and post-thaw motility than those with the AG and AA genotypes. Therefore, this embodiment of the invention provides an important theoretical basis for using this SNP locus as a molecular marker for auxiliary selection of bull reproductive and production performance and for its application in genetic improvement, and it has promising application prospects.

[0058] Based on the above-described preferred embodiments of the present invention, and through the foregoing description, those skilled in the art can make various changes and modifications without departing from the inventive concept. The technical scope of this invention is not limited to the contents of the specification.

Claims

1. The application of a specific primer set in the preparation of a kit for detecting the normal and thawed motility traits of bovine sperm, characterized in that, The specific primer set was used to identify the FETUB gene molecular marker associated with bovine sperm motility traits; the FETUB gene molecular marker is the SNP site on the bovine FETUB gene fragment as shown in SEQ ID NO:1 of the sequence listing; the SNP site is the 315th site of the bovine FETUB gene fragment, which has an AG base mutation, resulting in a single nucleotide polymorphism; among them, individuals with the GG type have normal sperm and better motility after thawing than those with the AG and AA types.

2. The application of the specific primer set according to claim 1 in the preparation of a reagent kit for detecting the normal and thawed motility traits of bovine sperm, characterized in that, The specific primer set includes forward and reverse primers as shown in the sequence listing SEQ ID NO:2-3, respectively.

3. The application of a specific primer set in marker-assisted selection of bovine sperm motility traits in normal and thawed samples, characterized in that, The specific primer set is used to identify FETUB gene molecular markers associated with bovine sperm motility traits; the FETUB gene molecular markers are used to screen or evaluate breeding bulls with high normal sperm motility and thawed motility; the FETUB gene molecular markers are SNP sites on the bovine FETUB gene fragment as shown in SEQ ID NO:1; the SNP site is position 315 of the bovine FETUB gene fragment, which has an AG base mutation, resulting in a single nucleotide polymorphism; among them, individuals with the GG type have better normal sperm motility and thawed motility than those with the AG and AA types.

4. The application of the specific primer set according to claim 3 in marker-assisted selection of bovine sperm motility traits in normal and thawed conditions, characterized in that, The specific primer set includes forward and reverse primers as shown in the sequence listing SEQ ID NO:2-3, respectively.

5. The application of the specific primer set according to claim 3 in marker-assisted selection of bovine sperm motility traits under normal and thawed conditions, characterized in that, The method for marker-assisted selection of normal and thawed bovine sperm motility traits includes the following steps: Genomic DNA was extracted from the blood of individuals to be screened, and PCR amplification was performed using the specific primer set described above to obtain PCR products; The PCR product was sequenced to determine the base type at position 315 of the bovine FETUB gene fragment, and the sequencing results were obtained. The genotype of the individuals to be screened was determined based on the sequencing results, and a correlation analysis was performed with the normal and thawed sperm motility traits of bovine sperm.