ABHD1 inhibitors and uses thereof

Abstract

The invention relates to the technical field of biological medicine, in particular to an ABHD1 inhibitor and application of the ABHD1 inhibitor in preparation of a colorectal cancer treatment product, and a target sequence of the ABHD1 inhibitor comprises a sequence shown as any one of SEQ ID NO: 1-3. It is found that ABHD1 in colorectal cancer tissue is abnormally high in expression, and the expression level of ABHD1 is in negative correlation with prognosis of a patient. A further research shows that the proliferation and migration capabilities of colorectal cancer cells RKO and HCT116 can be remarkably reduced by inhibiting the expression of ABHD1. The results jointly reveal the potential of the ABHD1 as a colorectal cancer treatment target. On the basis, a series of implementable technical forms including interfering nucleic acid molecules, nucleic acid constructs, viruses, cells and the like are provided around the ABHD1 gene, and a set of complete ABHD1 targeted inhibition technical scheme is formed.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to ABHD1 inhibitors and their uses. Background Technology

[0002] Colorectal cancer is a malignant tumor that originates from the mucosal epithelium of the colon or rectum, and usually develops from intestinal polyps over a long period of time.

[0003] Currently, the main clinical treatments for colorectal cancer include surgical resection, chemotherapy, radiotherapy, and targeted therapy. However, surgery is only suitable for patients in the early and middle stages, and the risk of recurrence and metastasis after surgery is high; chemotherapy and radiotherapy have poor selectivity, causing significant damage to normal tissues while killing tumor cells, leading to decreased patient tolerance and a series of adverse reactions; and existing targeted drugs face problems such as limited applicable populations and easy development of drug resistance.

[0004] Therefore, in-depth analysis of the key molecular mechanisms in the development and progression of colorectal cancer, screening and verification of key molecular targets in the development and progression of colorectal cancer, clarifying their expression status and functional roles in colorectal cancer, and developing more targeted new intervention strategies and products are of great scientific significance and clinical application value for improving the treatment level of colorectal cancer and improving patient prognosis. Summary of the Invention

[0005] In view of the shortcomings of the prior art described above, and in order to solve the problems of limited surgical indications and easy recurrence and metastasis in existing colorectal cancer treatment methods; lack of selectivity and large toxic side effects of radiotherapy and chemotherapy; and scarcity of existing targeted therapy options, the purpose of this application is to provide an ABHD1 inhibitor and its use in the preparation of colorectal cancer treatment products, so as to solve the problems in the prior art.

[0006] To achieve the above and other related objectives, this application first provides the use of ABHD1 inhibitors in the preparation of colorectal cancer treatment products.

[0007] This application further provides a nucleic acid molecule that reduces ABHD1 gene expression, wherein the nucleic acid molecule is selected from any of the following:

[0008] 1) Double-stranded RNA; the double-stranded RNA comprises a first strand and a second strand, the first strand and the second strand being complementary to form an RNA dimer; the nucleotide sequence of the first strand comprises any of the sequences shown in SEQ ID NO: 4-6;

[0009] 2) shRNA; the nucleotide sequence of the shRNA includes any of the sequences shown in SEQ ID NO: 22-24.

[0010] This application subsequently provides an ABHD1 gene interference nucleic acid construct containing a gene fragment encoding the aforementioned nucleic acid molecule.

[0011] This application then provides a host cell obtained by transfecting the aforementioned ABHD1 gene interference nucleic acid construct into the cell.

[0012] This application then provides an ABHD1 gene interference lentivirus, which is prepared by viral packaging of the above-mentioned ABHD1 gene interference nucleic acid construct with the assistance of lentivirus helper plasmids and host cells.

[0013] This application also provides a cell line, which is a cell line infected with the above-mentioned ABHD1 gene-interfering lentivirus.

[0014] This application further provides a pharmaceutical composition in which the active substance comprises: the above-mentioned nucleic acid molecule; and / or, the above-mentioned nucleic acid construct; and / or, the above-mentioned lentivirus, and a pharmaceutically acceptable carrier or excipient.

[0015] This application concludes by providing the use of the above-mentioned nucleic acid molecule, the above-mentioned nucleic acid construct, the above-mentioned host cell, the above-mentioned lentivirus, the above-mentioned cell line, and the above-mentioned pharmaceutical composition in the preparation of a colorectal cancer treatment product.

[0016] Compared with the prior art, the beneficial effects of this application are as follows:

[0017] 1) Through bioinformatics analysis and clinical sample validation, the inventors discovered that ABHD1 is abnormally highly expressed in colorectal cancer tissues, and its expression level is negatively correlated with patient prognosis, suggesting that ABHD1 may be involved in the development and progression of colorectal cancer. Further experiments revealed that inhibiting ABHD1 expression significantly reduced the proliferation and migration abilities of RKO and HCT116 colorectal cancer cells. These results collectively reveal the potential of ABHD1 as a therapeutic target for colorectal cancer, providing important experimental evidence for the development of ABHD1 inhibitors for colorectal cancer treatment.

[0018] 2) This invention focuses on the construction of the ABHD1 gene and provides various technical forms such as interfering nucleic acid molecules, nucleic acid constructs, viruses and cells, forming a complete and implementable ABHD1 targeted inhibition technology solution, which is conducive to achieving effective intervention on ABHD1 gene expression in colorectal cancer-related research and product development.

[0019] 3) This invention improves the stability and substitutability of the technical solution by setting up multiple target site interference sequences. By designing and constructing multiple interfering nucleic acid sequences targeting different regions of the ABHD1 gene transcript, the risk of unstable or ineffective interference efficiency at a single target site is avoided. This provides a technical basis for subsequent screening to obtain efficient and specific ABHD1 inhibitory sequences, which is beneficial to improving the applicability and reliability of the solution in different application scenarios.

[0020] 4) This invention employs a vector and viral delivery method, which facilitates stable inhibition of the ABHD1 gene. By constructing ABHD1 interfering nucleic acid molecules into vectors, especially lentiviral vectors, the interfering sequence can be continuously expressed in target cells, thereby providing conditions for obtaining cells or cell lines with stable downregulated ABHD1 expression, suitable for long-term research or product development needs related to colorectal cancer.

[0021] 5) The ABHD1 inhibitory cells and related product forms provided by this invention expand the technical pathway for targeted intervention in colorectal cancer. This invention not only provides the ABHD1 inhibitor itself, but also further provides various product forms such as cells that inhibit ABHD1 expression and their compositions, providing multi-level technical support for the functional study of ABHD1 in colorectal cancer and its application in products for the prevention and / or treatment of colorectal cancer. Attached Figure Description

[0022] Figure 1 The image shows the background expression level of the ABHD1 gene in normal human colonic epithelial cells NCM460 and different colorectal cancer cells (RKO, HCT116, HT-29, SW620, DLD-1) detected by the RT-qPCR method in this invention.

[0023] Figure 2 The image shows the expression level of the ABHD1 gene in RKO (left) and HCT116 (right) cells infected with the lentivirus of Example 1, as detected by the RT-qPCR method of this invention.

[0024] Figure 3 The figure shows the fold change in cell growth of RKO (left) and HCT116 (right) cells after infection with lentivirus in Example 1, measured by the CCK8 assay in this invention, from day 1 to day 5.

[0025] Figure 4 The figure shows the number of migrating cells in RKO (left) and HCT116 (right) cells after 24 h of culture following infection with lentivirus in Example 1, as measured by the Transwell assay of the present invention. Detailed Implementation

[0026] To make the inventive objectives, technical solutions, and beneficial effects of this application clearer, the following description, in conjunction with embodiments, further illustrates this application. It should be understood that the embodiments described are for illustrative purposes only and are not intended to limit the scope of the application. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and those skilled in the art can easily understand other advantages and effects of this application from the content disclosed in this description.

[0027] The first aspect of this application provides the use of ABHD1 inhibitors in the preparation of colorectal cancer treatment products.

[0028] ABHD1, NCBI Reference Sequence: NM_032604.4.

[0029] In this invention, ABHD1 inhibitors refer to any substance capable of inhibiting or reducing the activity, expression, or function of ABHD1, including but not limited to nucleic acid molecules such as antisense oligonucleotides, RNA aptamers, ribozymes, nucleic acid constructs, double-stranded RNA (dsRNA) or short hairpin RNA (shRNA); polypeptides such as dominant inactivating mutants; proteins such as antibodies or their functional fragments; small molecule chemicals; viruses such as lentiviruses, adenoviruses, or adeno-associated viruses; and any other biological or chemical entity capable of directly or indirectly inhibiting ABHD1.

[0030] The phrase "reducing ABHD1 expression" can refer to inhibiting the transcription or translation of the ABHD1 gene. Specifically, it means preventing gene transcription, reducing gene transcriptional activity, preventing gene translation, or reducing gene translation levels.

[0031] In some specific embodiments, the target sequence of the ABHD1 inhibitor includes any of the sequences shown in SEQ ID NO: 1 to 3.

[0032] The “target sequence” is a segment in the ABHD1 gene corresponding to the identified and silenced mRNA fragment.

[0033] SEQ ID NO. 1: TGGAGGGATACTGGTGCTGAA.

[0034] SEQ ID NO. 2: TGGAGCCACACTGTTCCATCA.

[0035] SEQ ID NO. 3: CTGCCAACTTGTGGAACGAAA.

[0036] In some specific embodiments, the ABHD1 inhibitor is selected from nucleic acid molecules or viruses.

[0037] Preferably, the nucleic acid molecule is selected from double-stranded RNA, which comprises a first strand and a second strand, and the first strand and the second strand are complementary to form an RNA dimer.

[0038] More preferably, the double-stranded RNA is siRNA.

[0039] More preferably, the nucleotide sequence of the first chain comprises any of the sequences shown in SEQ ID NO: 4 to 6.

[0040] SEQ ID NO. 4: UGGAGGGAUACUGGUGCUGAA.

[0041] SEQ ID NO. 5: UGGAGCCACACUGUUCCAUCA.

[0042] SEQ ID NO. 6: CUGCCAACUUGUGGAACGAAA.

[0043] Preferably, the nucleic acid molecule is selected from shRNA, which includes a sense strand fragment and an antisense strand fragment, and a stem-loop structure connecting the sense strand fragment and the antisense strand fragment, wherein the sequences of the sense strand fragment and the antisense strand fragment are complementary.

[0044] More preferably, the nucleotide sequence of the positive strand fragment of the shRNA comprises any of the sequences shown in SEQ ID NO: 4 to 6.

[0045] More preferably, the nucleotide sequence of the stem-loop structure of the shRNA may be selected from any of the following: UUCAAGAGA, UUCG, CCACC, CUCGAG, AAGCUU, or CCACACC.

[0046] More preferably, the nucleotide sequence of the shRNA comprises any of the sequences shown in SEQ ID NO: 22-24.

[0047] SEQ ID NO.22:

[0048] UGGAGGGAUACUGGUGCUGAACUCGAGUUCAGCACCAGUAUCCCUCCA.

[0049] SEQ ID NO.23:

[0050] UGGAGCCACACUGUUCCAUCACUCGAGUGAUGGAACAGUGUGGCCUCCA.

[0051] SEQ ID NO.24:

[0052] CUGCCAACUUGUGGAACGAAACUCGAGUUUCGUUCCACAAGUUGGCAG.

[0053] More preferably, the encoding nucleotide sequence of the shRNA comprises any of the sequences shown in SEQ ID NO: 7-12.

[0054] Preferably, the virus is selected from lentiviruses, adenoviruses, or adeno-associated viruses.

[0055] In some specific embodiments, the colorectal cancer treatment product is a colorectal cancer treatment drug or an enhancer of a colorectal cancer chemotherapy drug.

[0056] In some specific embodiments, the colorectal cancer treatment product treats colorectal cancer by inhibiting the proliferation rate of colorectal cancer cells and / or inhibiting the migration of colorectal cancer cells.

[0057] A second aspect of this application provides a nucleic acid molecule that reduces ABHD1 gene expression, said nucleic acid molecule being selected from any of the following:

[0058] 1) Double-stranded RNA; the double-stranded RNA comprises a first strand and a second strand, the first strand and the second strand being complementary to form an RNA dimer; the nucleotide sequence of the first strand comprises any of the sequences shown in SEQ ID NO: 4-6;

[0059] 2) shRNA; the encoding nucleotide sequence of the shRNA includes any of the sequences shown in SEQ ID NO: 7~12.

[0060] A third aspect of this application provides an ABHD1 gene interference nucleic acid construct, wherein the ABHD1 gene interference nucleic acid construct contains a gene fragment encoding the nucleic acid molecule described in the second aspect.

[0061] In some specific embodiments, the ABHD1 gene interference nucleic acid construct is obtained by cloning a gene fragment encoding the nucleic acid molecule described in the second aspect into a vector.

[0062] Preferably, the vector is an ABHD1 gene interference lentiviral vector.

[0063] More preferably, the ABHD1 gene-interfering lentiviral vector contains a promoter sequence and / or a nucleotide sequence encoding a detectable marker in colorectal cancer cells.

[0064] More preferably, the detectable marker is green fluorescent protein (GFP).

[0065] More preferably, the ABHD1 gene interference lentiviral vector is selected from: BR-V108, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, and pLKO.1-puro-CMV-TagFP63. 5. pLKO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pL Any of P2, pLP / VSV-G, pENTR / U6, pLenti6 / BLOCK-iT-DEST, pcDNA1.2 / V5-GW / lacZ, pLenti6.2 / N-Lumio / V5-DEST, and pGCSIL-GFP.

[0066] The fourth aspect of this application provides a host cell obtained by transfecting the ABHD1 gene interference nucleic acid construct described in the third aspect into the cell.

[0067] In the fourth aspect, “cell” means any cell suitable for assembling the elements necessary for lentiviral packaging into infectious lentiviral particles by co-transfection, including but not limited to human embryonic kidney cell line 293 and its derived cells, such as 293T and 293FT cells; human cervical cancer cell line HeLa; human osteosarcoma cell line HOS; mouse embryonic fibroblast cell line NIH3T3 and mouse myoblast cell line C2C12, etc.

[0068] The fifth aspect of this application provides an ABHD1 gene interference lentivirus, which is prepared by viral packaging of the ABHD1 gene interference nucleic acid construct described in the third aspect with the assistance of a lentivirus helper plasmid and a host cell.

[0069] In the fifth aspect, the "lentiviral helper plasmids" refer to a set of plasmid DNA molecules that are essential for lentiviral packaging, encoding viral structural and functional proteins, but which cannot self-replicate to produce infectious viruses. These plasmids are co-transfected with the ABHD1 gene interference nucleic acid construct to provide all the necessary elements for viral packaging, capsid formation, and infectivity within the cell, but do not integrate themselves into the final viral particles. Examples include, but are not limited to: packaging plasmids (such as psPAX2), envelope protein plasmids (such as pMD2.G), and optional helper plasmids (such as Rev response element expression plasmids).

[0070] The sixth aspect of this application provides a cell line infected with the ABHD1 gene-interfering lentivirus described in the fifth aspect.

[0071] In some specific embodiments, the cell line is selected from one or more of 293, 293T, NCM460, RKO, HCT116, HT-29, SW620 and DLD-1.

[0072] The seventh aspect of this application provides a pharmaceutical composition in which the active substance comprises: the nucleic acid molecule described in the second aspect; and / or, the nucleic acid construct described in the third aspect; and / or, the lentivirus described in the fifth aspect, and a pharmaceutically acceptable carrier or excipient.

[0073] In this invention, "pharmaceutically acceptable carriers or excipients" refer to any inert component used in the formulation of the pharmaceutical composition that is non-toxic and harmless to the host and does not adversely interact with the active ingredient (such as nucleic acid molecules or lentiviruses). Their function is to act as carriers, diluents, excipients, stabilizers, or adjuvants for the active ingredient, providing suitable physical form, stability, osmotic pressure, pH, or delivery efficiency, thereby making them suitable for drug storage, administration, and in vivo function. These include, but are not limited to: buffer systems such as phosphate buffer, Tris buffer, and HEPES; isotonic agents such as sodium chloride, glucose, mannitol, and sorbitol; stabilizers / protectants such as albumin, serum proteins, polyethylene glycol, glycerol, and sugars such as trehalose or sucrose; surfactants such as poloxamer and Tween-80; lyophilization protectants; suitable matrices for local or systemic administration; and nanocarriers or lipid complexes suitable for viral or nucleic acid delivery. The carriers or excipients should comply with the requirements of relevant pharmaceutical formulation specifications.

[0074] The eighth aspect of this application provides a treatment method for colorectal cancer, comprising administering an effective dose of an ABHD1 inhibitor to a subject.

[0075] The meaning of ABHD1 inhibitors is the same as described in the first aspect.

[0076] In this invention, the term "effective dose" refers to the dose or concentration at which the ABHD1 inhibitor is effective in treating the disease. For example, for the lentiviruses disclosed in this invention, an "effective dose" is a dose or concentration at which the lentivirus can eliminate all or part of a tumor, inhibit or slow tumor growth, inhibit the growth or proliferation of cells mediating a cancerous state, inhibit tumor cell metastasis, alleviate any symptoms or markers associated with a tumor or cancerous state, prevent or delay the development of a tumor or cancerous state, or some combination thereof.

[0077] In some specific implementations, the object is a mammal.

[0078] Preferably, the mammal is selected from rodents, even-toed ungulates, perissodactyls, lagomorphs, and primates.

[0079] More preferably, the primate is selected from monkeys, apes, or humans.

[0080] Using this method, the growth, proliferation, recurrence, and / or metastasis of the colorectal cancer are inhibited. Furthermore, at least 10%–30%, 30%–50%, 50%–70%, 70%–90%, and 90%–100% of the growth, proliferation, recurrence, and / or metastasis of the colorectal cancer are inhibited.

[0081] The ninth aspect of this application provides the use of the nucleic acid molecule described in the second aspect, the nucleic acid construct described in the third aspect, the host cell described in the fourth aspect, the lentivirus described in the fifth aspect, the cell line described in the sixth aspect, and the pharmaceutical composition described in the seventh aspect in the preparation of a colorectal cancer treatment product.

[0082] The meaning of "colorectal cancer treatment products" is the same as described in the first aspect.

[0083] The present invention will be further illustrated by the following examples, but these examples do not limit the scope of the invention.

[0084] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. All reagents or instruments whose manufacturers are not specified are conventional products that can be purchased commercially. In addition to the specific methods, equipment, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, equipment, and materials similar to or equivalent to those described, used, and materials in the embodiments of this invention may be used to implement this invention.

[0085] Example 1: Preparation of ABHD1 Interference Lentiviral Virus

[0086] This embodiment provides a lentivirus for colorectal cancer, wherein the RNAi target sequence of the lentivirus has the following fragment coding sequence:

[0087] SEQ ID NO. 1: TGGAGGGATACTGGTGCTGAA.

[0088] SEQ ID NO. 2: TGGAGCCACACTGTTCCATCA.

[0089] SEQ ID NO. 3: CTGCCAACTTGTGGAACGAAA.

[0090] Secondly, the above target sequences are constructed into the corresponding lentiviral vector to construct the lentiviral vector plasmid. The preparation steps include:

[0091] (1) Selecting a tool carrier

[0092] BR-V108 was selected as the tool vector (purchased from Shanghai Yibeirui Biomedical Technology Co., Ltd.), and its nucleotide sequence is shown in SEQ ID NO.13.

[0093] (2) Synthesize single-stranded primers and oligo DNA

[0094] In step (2), the single-stranded primer contains the following three sets of sequences:

[0095] I) KD-1 Group

[0096] SEQ ID NO.7:

[0097] 5'-ccggTGGAGGGATACTGGTGCTGAActcgagTTCAGCACCAGTATCCCTCCAtttttg-3'

[0098] SEQ ID NO.8:

[0099] 5'-gatccaaaaaTGGAGGGATACTGGTGCTGAActcgagTTCAGCACCAGTATCCCTCCA-3'

[0100] II) KD-2 group

[0101] SEQ ID NO.9:

[0102] 5'-ccggTGGAGCCACACTGTTCCATCActcgagTGATGGAACAGTGTGGCTCCAtttttg-3'

[0103] SEQ ID NO.10:

[0104] 5'-gatccaaaaaTGGAGCCACACTGTTCCATCActcgagTGATGGAACAGTGTGGCTCCA-3'

[0105] III) KD-3 Group

[0106] SEQ ID NO.11:

[0107] 5'-ccggCTGCCAACTTGTGGAACGAAActcgagTTTCGTTCCACAAGTTGGCAGtttttg-3'

[0108] SEQ ID NO.12:

[0109] 5'-gatccaaaaaCTGCCAACTTGTGGAACGAAActcgagTTTCGTTCCACAAGTTGGCAG-3'

[0110] The above primers were annealed to form oligo DNA.

[0111] The annealing system consisted of 2.5 μL upstream chain (10 μmol / L) + 2.5 μL downstream chain (10 μmol / L) + 5 μL annealing buffer + 10 μL ultrapure water. The annealing temperature was as follows: 95℃ for 5 min in a PCR instrument; 95℃ for 40 s; decreasing the temperature by 0.7℃ every 40 s for 99 cycles; 25℃ for 3 min; and stored at 8℃.

[0112] (3) After ligating oligo DNA and linearized tool vector, transform

[0113] The tool vector was first digested with enzymes at Age I and BamH I. The digestion system consisted of 16 μL ultrapure water + 30 μL 10×CutSmart Buffer (manufacturer: NEB, component number: B6004SVIA) + 12 μL purified plasmid DNA (1 μg / μL) + 1 μL Age I (10 U / μL) + 1 μL EcoR I (10 U / μL). The reaction was carried out at 37℃ for 3 h. After digestion, agarose gel electrophoresis was performed to recover the target fragment.

[0114] The enzyme-digested tool vector was reacted with oligo DNA in a reaction system at 22°C for 1 hour. The reaction system was as follows:

[0115] 50 ng of enzyme-digested tool vector

[0116] 2μL oligo DNA

[0117] 0.5μL T4 DNA ligase (EL0011, ThermoFisher)

[0118] 2μL 10×T4 DNA ligase Buffer (EL0011, ThermoFisher)

[0119] Ultrapure water (to a total volume of 20 μL)

[0120] Thaw E. coli competent cells (Stable, DL1080) on ice, add 10 μL of ligation product to 100 μL of competent cells, and place on ice for 1 min; heat shock in a 42℃ water bath for 40 s, and place on ice for 2 min; add 200 µL of antibiotic-free LB liquid medium, and shake in a shaker at 37℃ at 200 rpm for 1 h; take 150 µL of bacterial culture and spread it evenly on LB solid medium containing ampicillin (Amp) resistance, and incubate in a 37℃ incubator for 14 h.

[0121] (4) Colony PCR identification, sequencing, and plasmid extraction

[0122] In the colony PCR identification, the identification primer-F sequence is SEQ ID NO.14: CCTATTTCCCATGATTCCTTCATA, and the identification primer-R sequence is SEQ ID NO.15: GTAATACGGTTATCCACGCG;

[0123] The PCR reaction system was as follows: 10 μL 2×Hieff UNICON® HotStart PCR Master Mix (WithDye) (manufacturer: Yisheng, product number: 10732ES03) + 0.4 μL identification primer-F + 0.4 μL identification primer-R + ultrapure water (to a total volume of 20 μL).

[0124] PCR amplification conditions were as follows: 94℃ for 3 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, 22 cycles; 72℃ for 5 min; after PCR, 5 μL of product was taken and the bands were detected by 1% agarose gel electrophoresis (for electrophoresis loading: the blank control used ultrapure water as a template; the negative control used an empty vector without the target gene inserted as a template).

[0125] The identified positive clone transformants were inoculated into LB liquid medium containing the corresponding antibiotics and cultured at 37°C for 14 hours. After colony PCR identification, the samples were sent for sequencing.

[0126] The correctly sequenced bacterial culture was transferred to 150 mL of LB liquid medium containing Amp resistance and cultured overnight at 37°C with shaking. The bacterial culture was then collected, and plasmids were extracted using the Tiangen endotoxin-free plasmid extraction kit.

[0127] Bacterial cell enrichment: Take 10 mL of bacterial solution, centrifuge at 8000 rpm for 4 min, and collect the bacterial cells;

[0128] Bacterial lysis: Resuspend the bacterial cells in 1 mL of GP1 Buffer and transfer to a 2.0 mL centrifuge tube;

[0129] Cycle termination: Add 0.5 mL of GP2 Buffer, gently invert to mix, let stand for 1 min, and centrifuge at 12000 rpm for 1 min; take 0.7 mL of the supernatant from the previous step and add it to the activated adsorption column GP, ​​centrifuge at 3000 rpm for 1 min; remove the waste liquid in the collection tube;

[0130] Washing: Add 0.5 mL of GPW Buffer and centrifuge at 12000 rpm for 1 min;

[0131] Recovery: Replace the collection tube, add 0.2 mL of GP3 Buffer to the adsorption column, let stand for 1 min, and centrifuge at 12000 rpm for 1 min;

[0132] Stability: Centrifuge tubes containing the recovered solution were placed in a 37°C incubator for 15 minutes.

[0133] (5) Lentiviral packaging

[0134] The lentivirus was prepared by co-transfecting 293T cells with the above-mentioned lentiviral vector plasmid, the psPAX2 vector plasmid (nucleotide sequence as shown in SEQ ID NO. 16), and the pMD2.G vector (nucleotide sequence as shown in SEQ ID NO. 17).

[0135] The preparation steps of the lentivirus are as follows:

[0136] 1) 12-18 hours before transfection, trypsin-digested 293T cells (ATCC ACS-4500) in logarithmic growth phase, and adjust the cell density to approximately 5 × 10⁶ cells / year using medium containing 10% FBS. 6 Re-seed 15 mL of the solution into 10 cm cell culture dishes and incubate at 37°C with 5% CO2. The cells are ready for transfection when the confluence reaches 70%–80%.

[0137] 2) The cell culture medium was replaced with serum-free medium 2 hours before transfection.

[0138] 3) Add DNA solution (10 μg lentiviral vector plasmid, 7.5 μg pMD2.G vector plasmid, and 5 μg psPAX2 vector plasmid) to 500 μL Opti-MEM R1 medium and let stand at room temperature for 5 min; add the corresponding mass of transfection reagent Polybrene (manufacturer: Santa Cruz Biotechnology, catalog number: sc-134220A) to another 500 μL Opti-MEM R1 medium and let stand at room temperature for 5 min; gently mix the two and let stand at room temperature for 20 min.

[0139] 4) Add the mixture dropwise to the 293T cell culture medium, mix gently, and incubate at 37°C with 5% CO2. After 6 hours, replace with 10 mL of 10% FBS medium and continue culturing at 37°C with 5% CO2 for another 60 hours.

[0140] 5) Collect cell supernatant 48h and 72h after transfection for virus titer determination and concentration.

[0141] Example 2: Lentiviral reduction of ABHD1 expression

[0142] Experimental group setup:

[0143] shCtrl: Normal target cells infected with negative control lentivirus (control group).

[0144] shABHD1-1, shABHD1-2, and shABHD1-3 correspond to the normal target cell groups (experimental groups) infected with RNAi lentiviruses in groups I), II), and III) of Example 1, respectively.

[0145] Experiment content:

[0146] 1. Detection of ABHD1 gene background expression in colorectal cancer cells

[0147] The ABHD1 gene background expression level was detected in colorectal cancer cell lines RKO, HCT116, HT-29, SW620, and DLD-1.

[0148] 2. Real-time qPCR detection of the expression level of the target gene ABHD1

[0149] After passage of RKO and HCT116 cells, RKO and HCT116 cells in the logarithmic growth phase were trypsinized to prepare cell suspensions. The cell suspensions were seeded in 96-well incubators and cultured at 37°C in a 5% CO2 incubator until the cell confluence reached approximately 20-30%. An appropriate amount of virus was added according to the cell MOI value. The cell status was observed after 12 hours, and the culture medium was changed. The expression of the reporter gene GFP on the lentivirus was observed 2-3 days after infection. When the fluorescence rate reached about 80%, the cells were cultured again until the confluence reached 70%-90%, and the cells were collected.

[0150] Cells in the logarithmic growth phase of each experimental group were digested with trypsin, resuspended in complete culture medium to form a cell suspension, and counted. The cell density for plating was determined according to the cell size. Cells were incubated at 37°C in a 5% CO2 incubator with 3 replicates per group and a culture medium of 1 mL / well. The number of cells added to each well was kept consistent. Cells were collected after 24 / 36 h of culture.

[0151] After total RNA extraction according to the Trizol procedure of Sigma, 4X gDNA wiper mix and 1.0 μg total RNA were added to a PCR tube, and RNase-free H2O was added to 8 μL. After mixing, the mixture was centrifuged and incubated at 42℃ for 2 min. 5X qPCR supermix was added, and reverse transcription was performed at 55℃ for 15 min and 85℃ for 2 min. The resulting cDNA was stored at -80℃ for later use.

[0152] The real-time qPCR reaction system was as follows: 5.0 μL SYBR Green mastermixes + 0.25 μL upstream primer (10 μmol / L, sequence SEQ ID NO.18: GAGTGACATCCTCCAAACACC) + 0.25 μL downstream primer (10 μmol / L, sequence SEQ ID NO.19: GTAGCCATCCCTCAGAGCTT) + 0.2 μL Dye2 (Qihengxing, FS-Q1001) + 2.3 μL LNase-Free H2O.

[0153] The primer sequence for the internal reference gene GAPDH is as follows:

[0154] Upstream primer SEQ ID NO.20: TGACTTCAACAGCGACACCCA

[0155] Downstream primer SEQ ID NO.21: CACCCTGTTGCTGTAGCCAAA

[0156] Through 2 ΔΔCt The expression level of mRNA was analyzed using a method.

[0157] Experimental results:

[0158] The expression results of gene ABHD1 in different cells are shown in the figure. Figure 1 .

[0159] The ABHD1 gene showed high expression levels in both RKO and HCT116 cells, and RKO and HCT116 were subsequently selected as the main cell models for further functional validation.

[0160] The effect of the lentivirus prepared in Example 1 on ABHD1 expression in RKO and HCT116 cells is shown in the figure. Figure 2 .

[0161] like Figure 2 As shown, in RKO cells, after infection with lentivirus, compared to the shCtrl group:

[0162] The knockdown efficiency of the ABHD1 gene of the virus prepared from the vector containing the nucleotide sequence of group I in Example 1 reached 59.2% (p<0.05).

[0163] The knockdown efficiency of the ABHD1 gene of the virus prepared from the vector containing the nucleotide sequence of group II in Example 1 reached 50.5% (p<0.05).

[0164] The knockdown efficiency of the ABHD1 gene of the virus prepared from the vector containing the nucleotide sequence of group III in Example 1 reached 32.0% (p<0.05).

[0165] In HCT116 cells, after infection with lentivirus, compared to the shCtrl group:

[0166] The knockdown efficiency of the ABHD1 gene of the virus prepared from the vector containing the nucleotide sequence of group I in Example 1 reached 58.0% (p<0.05).

[0167] The knockdown efficiency of the ABHD1 gene of the virus prepared from the vector containing the nucleotide sequence of group II in Example 1 reached 50.2% (p<0.05).

[0168] The knockdown efficiency of the ABHD1 gene of the virus prepared from the vector containing the nucleotide sequence of group III in Example 1 reached 32.0% (p<0.05).

[0169] The above results indicate that the three interference sequences targeting ABHD1 designed in this invention can effectively downregulate the expression of the ABHD1 gene in both RKO and HCT116 colorectal cancer cells. Among them, the shABHD1-1 and shABHD1-2 groups have the highest knockdown efficiency and can be used as the preferred interference sequences for subsequent functional experiments.

[0170] Example 3: Lentiviral cells reduce the growth rate of colorectal cancer cells

[0171] CCK8 assay for growth:

[0172] After passage of RKO and HCT116 cells, RKO and HCT116 cells in the logarithmic growth phase were trypsinized to prepare a cell suspension. The cell suspension (approximately 1500-2500 cells) was seeded in 96-well incubators and cultured at 37°C in a 5% CO2 incubator until the cell confluence reached approximately 20-30%. An appropriate amount of virus was added according to the cell MOI value. The cell status was observed after 12 hours, and the culture medium was changed. The expression of the reporter gene GFP on the lentivirus was observed 2-3 days after infection. When the fluorescence rate reached approximately 80%, the cells were cultured again until the confluence reached 70%-90%, and the cells were collected.

[0173] Cells in the logarithmic growth phase of each experimental group were trypsinized and resuspended in complete culture medium to form a cell suspension. Cell counts were performed. The cell density for plating was determined based on cell size (set to 2000 cells / well). Cells were incubated at 37°C in a 5% CO2 incubator, with three replicates per group and a culture volume of 100 μL / well. The number of cells added to each well was ensured to be consistent. CCK8 assays were performed daily for five consecutive days, starting the second day. The OD450 absorbance was read using a microplate reader to accurately calculate the number of cells in each well. The data were statistically analyzed and plotted to create a 5-day cell proliferation curve.

[0174] Experimental results:

[0175] Five days after lentivirus infection of the target cells, the fold change in cell number over time for Example 1 and the control group is shown in the curves. Figure 3 .

[0176] from Figure 3 As can be seen, after lentiviral infection, compared with the shCtrl group, the proliferation of RKO cells in the shABHD1-1 and 2 groups in Example 1 was significantly inhibited, with fold change values ​​of -1.8 and -1.5, respectively (p<0.05); the proliferation of HCT116 cells in the shABHD1-1 and 2 groups was significantly inhibited, with fold change values ​​of -1.7 and -1.5, respectively (p<0.05).

[0177] The above results indicate that inhibiting ABHD1 expression can significantly reduce the proliferation of colorectal cancer cells RKO and HCT116.

[0178] Example 4: Colorectal cancer cell migration experiment

[0179] Transwell cell migration in vitro assay:

[0180] After passage of RKO and HCT116 cells, RKO and HCT116 cells in the logarithmic growth phase were trypsinized to prepare cell suspensions. The cell suspensions were seeded in 96-well incubators and cultured at 37°C in a 5% CO2 incubator until the cell confluence reached approximately 20-30%. An appropriate amount of virus was added according to the cell MOI value. The cell status was observed after 12 hours, and the culture medium was changed. The expression of the reporter gene GFP on the lentivirus was observed 2-3 days after infection. When the fluorescence rate reached about 80%, the cells were cultured again until the confluence reached 70%-90%, and the cells were collected.

[0181] (1) Take the required number of chambers into an empty 24-well plate, add 100µL of serum-free culture medium into the chamber, and incubate for 1~2 hours;

[0182] (2) Preparation of cell suspension: RKO and HCT116 cells in the logarithmic growth phase of each group were digested with trypsin and resuspended in low serum medium to prepare cell suspension; cell counting was performed on the cell suspension using a hemocytometer.

[0183] (3) After step (1) is completed, carefully remove the culture medium from the small chamber, add 600µL of culture medium containing 30% FBS to the lower chamber, dilute the cells with serum-free culture medium at a certain ratio, and add 100µL of the cell suspension (containing 100,000~200,000 cells) to each small chamber;

[0184] (4) Use tweezers to transfer the chamber into the lower chamber containing 30% FBS medium and incubate in a tissue culture incubator for 24 hours;

[0185] (5) Invert the chamber onto absorbent paper to remove the culture medium, and gently remove the non-transferred cells with a cotton swab;

[0186] (6) Add 400µL of staining solution to the empty wells of the 24-well plate, immerse the chamber in the staining solution for 5 min, and stain and transfer cells on the lower surface of the membrane;

[0187] (7) Soak the membrane in a large glass of water, rinse it several times, air dry it, and take pictures of the membrane under a microscope.

[0188] Experimental results:

[0189] The comparison of the number of transferred cells between the experimental group and the control group after 24 hours of incubation in the Transwell chamber in Example 1 is shown in the figure below. Figure 4 .

[0190] from Figure 4It can be seen that after lentiviral infection, compared with the shCtrl group, the Transwell migration rate of RKO cells in shABHD1-1 and 2 groups in Example 1 decreased by 53% and 27% respectively (p<0.05); the Transwell migration rate of HCT116 cells in shABHD1-1 and 2 groups decreased by 76% and 49% respectively (p<0.05).

[0191] The above results indicate that inhibiting ABHD1 expression can significantly suppress the migration ability of colorectal cancer cells RKO and HCT116.

[0192] The above embodiments are merely illustrative of the principles and effects of the present invention and are not intended to limit this application. Any person skilled in the art can modify or alter the above embodiments without departing from the spirit and scope of this application. Therefore, all equivalent modifications or alterations made by those skilled in the art without departing from the spirit and technical concept disclosed in this invention should still be covered by the claims of this application.

Claims

1. Use of ABHD1 inhibitors in the preparation of colorectal cancer treatment products.

2. Use according to claim 1, characterized in that, The target sequence of the ABHD1 inhibitor includes any of the sequences shown in SEQ ID NO: 1 to 3.

3. Use according to claim 1, characterized in that, The ABHD1 inhibitor is selected from nucleic acid molecules or viruses.

4. Use according to claim 3, characterized in that, The nucleic acid molecule is selected from any of the following: 1) Double-stranded RNA; the double-stranded RNA comprises a first strand and a second strand, the first strand and the second strand being complementary to form an RNA dimer; Preferably, the nucleotide sequence of the first chain comprises any one of the sequences shown in SEQ ID NO: 4 to 6; 2) shRNA; the shRNA comprises a sense strand and an antisense strand, and a stem-loop structure connecting the sense strand and the antisense strand, wherein the sequences of the sense strand and the antisense strand are complementary; Preferably, the nucleotide sequence of the positive strand fragment of the shRNA comprises any one of the sequences shown in SEQ ID NO: 4-6; More preferably, the nucleotide sequence of the shRNA comprises any of the sequences shown in SEQ ID NO: 22-24; And / or, the virus is selected from lentiviruses, adenoviruses, or adeno-associated viruses.

5. A nucleic acid molecule that reduces ABHD1 gene expression, said nucleic acid molecule being selected from any of the following: 1) Double-stranded RNA; the double-stranded RNA comprises a first strand and a second strand, the first strand and the second strand being complementary to form an RNA dimer; the nucleotide sequence of the first strand comprises any of the sequences shown in SEQ ID NO: 4-6; 2) shRNA; the nucleotide sequence of the shRNA includes any of the sequences shown in SEQ ID NO: 22~24.

6. An ABHD1 gene interference nucleic acid construct, wherein the ABHD1 gene interference nucleic acid construct contains a gene fragment encoding the nucleic acid molecule of claim 5.

7. A host cell obtained by transfecting the ABHD1 gene interference nucleic acid construct of claim 6 into a cell.

8. An ABHD1 gene-interfering lentivirus, wherein the lentivirus is prepared by viral packaging of the ABHD1 gene-interfering nucleic acid construct of claim 6 with the assistance of a lentivirus helper plasmid and a host cell.

9. A cell line, said cell line being infected with the ABHD1 gene-interfering lentivirus of claim 8.

10. A pharmaceutical composition wherein the active ingredient comprises: the nucleic acid molecule of claim 5; and / or the nucleic acid construct of claim 6; and / or the lentivirus of claim 8, and a pharmaceutically acceptable carrier or excipient.

11. Use of the nucleic acid molecule of claim 5, the nucleic acid construct of claim 6, the host cell of claim 7, the lentivirus of claim 8, the cell line of claim 9, and the pharmaceutical composition of claim 10 in the preparation of a colorectal cancer treatment product.

Images