Aerobic efficient ammonia nitrogen degradation strain TYF-QDKJ-P44 and application thereof

By screening and applying Pseudomonas TYF-QDKJ-P44, the problems of insufficient existing bacterial resources and complex processes have been solved, achieving efficient and stable ammonia nitrogen degradation, which is suitable for the treatment of a variety of complex wastewaters.

CN121874052APending Publication Date: 2026-04-17SHANXI QINGDONG TECH CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202610101600.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-26
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

There is a shortage of efficient ammonia nitrogen-degrading bacteria, and their environmental adaptability is limited. Existing biological denitrification processes are complex and have weak resistance to shock loads, making it difficult to effectively treat industrial wastewater with high concentrations, high salinity, high toxicity, and variable water quality.

Method used

A highly efficient aerobic ammonia nitrogen degrading strain, TYF-QDKJ-P44, belonging to the Pseudomonas species, was provided. It has a high ammonia nitrogen degradation capacity and a wide range of environmental adaptability. It can simultaneously complete ammonia nitrogen oxidation and nitrogen oxide reduction under a single aerobic condition, simplifying the process and improving stability.

Benefits of technology

It achieves a degradation rate of over 90% under high concentrations of ammonia nitrogen, adapts to a wide range of temperature and pH, reduces reliance on precise water quality control, improves process stability and simplifies treatment procedures, and is suitable for the remediation of various industrial wastewaters and natural water bodies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121874052A_ABST
    Figure CN121874052A_ABST
Patent Text Reader

Abstract

The invention discloses an aerobic efficient ammonia nitrogen degradation strain TYF-QDKJ-P44 and application thereof, the strain is Pseudomonas sp. TYF-QDKJ-P44, the strain is preserved in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms, the preservation number is CGMCC No.36444, and the preservation date is October 31, 2025. The invention further discloses an application of the aerobic efficient ammonia nitrogen degradation strain TYF-QDKJ-P44. The strain has excellent degradation performance on high-concentration ammonia nitrogen under the aerobic condition, and the degradation rate of the strain can reach 90% or above within the initial ammonia nitrogen concentration range of 100-800 mg / L; the optimal carbon nitrogen ratio range is 5 to 15. The invention also relates to a microbial agent containing the strain, and application of the microbial agent in degradation of various ammonia nitrogen polluted water bodies (such as landfill leachate, aquaculture wastewater, coking wastewater and the like). The strain has the advantages of high degradation efficiency, strong environmental adaptability, wide application range and the like, and provides new microbial resources and technical choices for biological enhancement treatment and polluted environment restoration of high-ammonia-nitrogen wastewater.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of environmental microbiology and wastewater biological treatment, and particularly relates to an aerobic, highly efficient ammonia nitrogen degrading strain TYF-QDKJ-P44 and its applications. Background Technology

[0002] Ammonia nitrogen is a common pollutant in aquatic and soil environments, mainly resulting from fertilizer runoff in agricultural activities, excrement from large-scale livestock and poultry farming, large-scale discharge of urban and rural domestic sewage, and various industrial wastewaters such as leachate from chemical, pharmaceutical, coking, and landfill sites. Excessive ammonia nitrogen discharge into the environment can trigger a series of serious environmental problems. It is not only a key nutrient causing eutrophication, stimulating excessive algal growth and disrupting the aquatic ecological balance, but it also consumes large amounts of dissolved oxygen during nitrification, leading to black and foul-smelling water bodies and causing fish and other aquatic organisms to suffocate and die. Furthermore, ammonia nitrogen itself is directly toxic to aquatic life. More importantly, it may be converted into nitrite and nitrate naturally or during treatment processes, and long-term intake can threaten drinking water safety and human health. Therefore, developing efficient, economical, and environmentally friendly ammonia nitrogen removal technologies remains a significant and urgent challenge in the field of environmental governance.

[0003] Currently, technologies for removing ammonia nitrogen from water can be mainly divided into two categories: physicochemical methods and biological methods. Physicochemical methods, such as air stripping, breakpoint chlorination, ion exchange, and chemical precipitation (e.g., magnesium ammonium phosphate precipitation), can achieve rapid and significant results in specific situations or for wastewater of specific concentrations. However, these methods generally have inherent drawbacks that are difficult to overcome. For example, air stripping is energy-intensive and can easily cause secondary air pollution; breakpoint chlorination requires the addition of large amounts of chlorine gas, resulting in high operating costs and the potential generation of chlorinated organic byproducts with "three-fold" risks (carcinogenicity, teratogenicity, and mutagenicity); ion exchange requires frequent resin regeneration, generating high-salinity regeneration wastewater; and chemical precipitation requires the addition of chemical agents, producing large amounts of chemical sludge, increasing the difficulty and cost of subsequent disposal. These disadvantages make physicochemical methods less economical for large-scale, continuous wastewater treatment and pose a risk of secondary pollution, making it difficult to meet the requirements of green and sustainable development.

[0004] In comparison, biological denitrification, relying on the biochemical action of microorganisms, offers advantages such as relatively low treatment costs, environmental friendliness, less secondary pollution, and potential resource recovery, making it the mainstream technology for wastewater treatment, especially for municipal wastewater and industrial wastewater with good biodegradability. Traditional biological denitrification theory primarily relies on the tandem action of two types of microorganisms: first, autotrophic nitrifying bacteria (including ammonia-oxidizing and nitrite-oxidizing bacteria), which gradually oxidize ammonia nitrogen to nitrite and nitrate under aerobic conditions; followed by heterotrophic denitrifying bacteria, which reduce nitrate to nitrogen gas under anoxic or anaerobic conditions. Based on this principle, technologies such as A / O (anaerobic / aerobic) and A... 2 Various processes, such as anaerobic / anoxic / aerobic and sequencing batch reactor (SBR), are used. However, traditional biological nitrogen removal processes have significant limitations: First, the process flow is relatively long, usually requiring the construction of multi-stage reactors or the division of a single reactor into different stages in time to achieve spatial or temporal separation of nitrification and denitrification, which makes infrastructure and operation management complex. Second, they have stringent requirements for operating conditions; nitrification requires a strictly aerobic environment, while denitrification requires a carbon source and the maintenance of anoxic conditions, making control difficult. Third, and most importantly, the autotrophic nitrifying bacteria, which are the core functional bacteria, have slow growth rates, long generation times, and low cell yields, resulting in slow system start-up. They are also extremely sensitive to environmental fluctuations (such as pH, temperature, and toxic shocks). Under unfavorable conditions such as high ammonia nitrogen, high salinity, low temperature, or high organic matter concentration (COD), the system is prone to instability, with a significant decrease in nitrification efficiency or even collapse, limiting their application in the treatment of many recalcitrant industrial wastewaters.

[0005] In recent years, the discovery and research of heterotrophic nitrifying-aerobic denitrifying strains have provided new ideas for biological nitrogen removal. These strains can simultaneously complete the oxidation of ammonia nitrogen and the reduction of nitrogen oxides under a single aerobic condition, theoretically simplifying the process, reducing reactor volume, and exhibiting stronger environmental adaptability. Nevertheless, from both research and application perspectives, the existing resources of highly efficient heterotrophic nitrifying-aerobic denitrifying strains are still insufficient, and they generally suffer from some common problems. Many reported strains have relatively single functions, and their degradation efficiency is limited when faced with the complex and diverse coexistence of pollutants in actual wastewater. Secondly, when these strains are introduced into actual wastewater treatment systems, especially complex industrial wastewater systems, they often face fierce competition with native microbial communities, making it difficult to guarantee their colonization ability, functional stability, and persistence, resulting in immediate ineffectiveness after addition. In addition, the large-scale fermentation culture, inoculant preparation, and long-term preservation technologies of highly efficient strains still need optimization, and costs need to be reduced. Especially when treating special ammonia nitrogen wastewater with high concentration, high salinity, high toxicity, and variable water quality, such as landfill leachate, coking wastewater, and aquaculture wastewater, the requirements for the activity, tolerance, and stability of functional strains are almost stringent. The market urgently needs to screen and obtain functional strain resources with higher activity, stronger adaptability, and easier engineering applications.

[0006] Therefore, given the current technical bottlenecks such as insufficient resources of efficient ammonia nitrogen degrading microorganisms, unstable performance in complex water conditions, and the complexity and weak resistance to shock loads of existing biological denitrification processes, developing an aerobic ammonia nitrogen degrading strain that combines high efficiency in degradation, broad environmental adaptability, strong competitive colonization ability, and ease of cultivation and expansion is of great practical significance and application value. This is crucial for improving the core efficiency of biological denitrification technology, broadening its application scope in the treatment of challenging industrial wastewater, reducing overall treatment costs, and promoting the industrialization of environmental microbiology technology. Summary of the Invention

[0007] This invention addresses the problems of insufficient resources, limited environmental adaptability, and room for improvement in treatment efficiency of existing ammonia nitrogen-degrading bacteria strains by providing a new aerobic bacterial strain with excellent ammonia nitrogen degradation capabilities and its applications. This strain can rapidly and efficiently remove ammonia nitrogen from water under aerobic conditions, and exhibits strong environmental adaptability, showing broad prospects for industrial application.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides an aerobic, highly efficient ammonia nitrogen-degrading strain, wherein the strain is *Pseudomonas* (…). Pseudomonas sp. TYF-QDKJ-P44 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 36444 and deposit date of October 31, 2025.

[0009] Furthermore, the 16S rRNA gene sequence of the strain is shown in SEQ ID No. 1. Phylogenetic analysis based on this sequence indicates that it is related to... Pseudomonas sp. The standard strain showed the highest homology (>99%).

[0010] Secondly, the present invention provides a microbial agent containing an effective amount of the above-mentioned aerobic, high-efficiency ammonia nitrogen degrading strain TYF-QDKJ-P44.

[0011] Furthermore, the microbial agent is prepared by fermenting and culturing the Pseudomonas TYF-QDKJ-P44, collecting the bacterial cells, mixing them with a protectant, and then drying them.

[0012] Thirdly, the present invention provides the application of the above-mentioned aerobic and efficient ammonia nitrogen degrading strains or the above-mentioned microbial agents in degrading ammonia nitrogen pollution in water bodies.

[0013] Furthermore, the water body includes natural freshwater bodies, domestic sewage, industrial wastewater, or artificial sewage treatment systems; the industrial wastewater includes coking wastewater, landfill leachate, or aquaculture wastewater.

[0014] Furthermore, the application is carried out under aerobic conditions; when the initial ammonia nitrogen concentration in the water is 100-800 mg / L, the degradation rate of ammonia nitrogen by the strain or agent can reach more than 90%; and / or, the carbon-nitrogen ratio range for the strain or agent to exert its optimal degradation efficiency is 5-15.

[0015] Fourthly, the present invention provides a method for treating ammonia nitrogen-polluted water, comprising adding an effective amount of the above-mentioned aerobic high-efficiency ammonia nitrogen-degrading strain or the above-mentioned microbial agent to the ammonia nitrogen-polluted water to be treated, and carrying out biological treatment under aerobic conditions.

[0016] Furthermore, the aerobic conditions are achieved through aeration, stirring, or natural reoxygenation.

[0017] Furthermore, based on bacterial cell concentration, the dosage of the bacterial strain or agent is 10. 4 -10 8 CFU / mL water.

[0018] Compared with the prior art, the present invention has the following advantages and technical effects: The aerobic, highly efficient ammonia nitrogen degrading strain TYF-QDKJ-P44 provided by this invention exhibits stable and excellent removal efficiency for high concentrations of ammonia nitrogen pollutants. Experiments show that within a wide range of initial ammonia nitrogen concentrations from 100 to 800 mg / L, this strain can achieve a degradation rate of over 90% under aerobic conditions. Especially at concentrations below 500 mg / L, the removal rate exceeds 95% within 48 hours, demonstrating its strong potential and high tolerance for treating practical high-ammonia nitrogen wastewater.

[0019] This strain maintains excellent ammonia nitrogen degradation activity over a wide range of carbon-to-nitrogen ratios (C / N = 5-15), with an optimal C / N ratio of 10. This broad range of suitable nutrient conditions reduces the reliance on precise control of influent water quality in practical applications, enhances the operational flexibility and stability of the process, and makes it more practical when dealing with industrial wastewater with fluctuating water quality.

[0020] Compared to traditional autotrophic nitrifying bacteria that are sensitive to environmental factors and grow slowly, the strains of this invention exhibit significantly enhanced environmental adaptability. They maintain high activity within a certain range of temperature (20-35℃) and pH (6.0-9.0) fluctuations, and remain effective even in complex wastewater matrices containing certain characteristic pollutants (such as phenol and cyanide). This strong adaptability ensures that the strains can better colonize and function after being deployed in actual treatment systems, improving the reliability and durability of bioaugmentation treatment.

[0021] The application of this invention can effectively simplify the traditional biological nitrogen removal process. As an aerobic heterotrophic nitrifying bacterium, this strain can directly convert ammonia nitrogen under a single aerobic condition, avoiding the strict separation requirements of anoxic / anaerobic sections in the traditional nitrification-denitrification process. This is expected to reduce reactor structures, lower energy consumption and operational complexity, and provide a more economical and simpler technical option for building or upgrading nitrogen removal facilities.

[0022] This strain and the agents prepared from it have a wide range of applications, especially suitable for the bio-enhanced treatment of high-concentration, recalcitrant ammonia nitrogen industrial wastewater such as landfill leachate, aquaculture wastewater, and coking wastewater. Simultaneously, it can also be used for in-situ remediation of polluted natural water bodies, efficiency improvement of wastewater treatment systems, and the development of related microbial agents, providing efficient microbial resources and reliable technical means to solve ammonia nitrogen pollution problems in various environmental media. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 Phylogenetic tree of Pseudomonas TYF-QDKJ-P44.

[0025] Figure 2 This is a colony morphology representation of Pseudomonas TYF-QDKJ-P44.

[0026] Figure 3 This is a comparison of the ammonia nitrogen degradation performance of strain TYF-QDKJ-P44 under different initial ammonia nitrogen concentrations. Figure 4 This is a comparison of the cell growth of strain TYF-QDKJ-P44 under different initial ammonia nitrogen concentrations.

[0027] Figure 5 This is a comparison chart showing the ammonia nitrogen degradation performance of strain TYF-QDKJ-P44 under different carbon-to-nitrogen ratios.

[0028] Figure 6 This is a comparison of the cell growth of strain TYF-QDKJ-P44 under different carbon-nitrogen ratios. Detailed Implementation

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] All raw materials used in this invention are not particularly limited in their source; they can be purchased from the market or prepared using conventional methods known to those skilled in the art.

[0031] There are no particular restrictions on the purity of any of the raw materials used in this invention. However, this invention preferably uses raw materials of analytical grade or purity commonly used in the field of chemical synthesis.

[0032] Example 1: Isolation and screening of Pseudomonas TYF-QDKJ-P44 This embodiment details the isolation, enrichment, and purification process of the aerobic, high-efficiency ammonia nitrogen degrading strain TYF-QDKJ-P44 described in this invention.

[0033] (1) Strains and sample collection The mixed bacterial flora samples used for screening functional strains were obtained from activated sludge in the aerobic tank of the Qingxu Hongbo Wastewater Treatment Plant in Taiyuan City, Shanxi Province. This wastewater treatment plant primarily treats mixed industrial and domestic wastewater, and its aerobic tank operates under high ammonia nitrogen loads for extended periods, making it an ideal source for screening tolerant and highly efficient degrading strains. During sampling, approximately 500 mL of fresh activated sludge from the middle of the aerobic tank was collected using a sterile sampler, placed in a sterile sampling bottle, refrigerated at 4°C, and quickly returned to the laboratory for further processing.

[0034] (2) Preparation of culture medium The culture medium formula used in the experiment is as follows: Beef extract peptone medium: 5.0 g beef extract, 10.0 g peptone, 5.0 g sodium chloride (NaCl), 1000 mL distilled water, pH adjusted to 7.0-7.2 with 1 M NaOH or HCl.

[0035] Heterotrophic ammoniation medium: sodium citrate 5.25 g, ammonium sulfate ((NH4)2SO4) 0.472 g (providing approximately 100 mg / L NH4) + -N), dipotassium hydrogen phosphate (K2HPO4) 0.2 g, magnesium sulfate heptahydrate (MgSO4·7H2O) 0.05 g, manganese sulfate tetrahydrate (MnSO4·4H2O) 0.01 g, ferrous sulfate (FeSO4) 0.01 g, sodium chloride (NaCl) 0.12 g, distilled water 1000 mL, pH 7.0.

[0036] Basic culture medium: sodium citrate 10.5 g, ammonium sulfate ((NH4)2SO4) 0.943 g (providing approximately 200 mg / L NH4) + -N), dipotassium hydrogen phosphate (K2HPO4) 0.2 g, magnesium sulfate heptahydrate (MgSO4·7H2O) 0.05 g, manganese sulfate tetrahydrate (MnSO4·4H2O) 0.01 g, ferrous sulfate (FeSO4) 0.01 g, sodium chloride (NaCl) 0.12 g, distilled water 1000 mL, pH 7.0.

[0037] Solid culture media are prepared by adding 2%-2.5% agar to the above-mentioned culture media. All culture media are autoclaved at 121°C for 30 minutes and then cooled to room temperature before use.

[0038] (3) Main experimental instruments The main instruments involved in the experiment include: constant temperature biochemical incubator, high-speed refrigerated centrifuge, constant temperature shaker, ultra-clean workbench, vertical pressure steam sterilizer, full-wavelength microplate reader, horizontal ultra-low temperature storage box, laboratory ultrapure water system, electronic balance, etc.

[0039] (4) Enrichment of microbial strains 10 mL of each of the retrieved activated sludge and river water samples were inoculated into Erlenmeyer flasks containing 90 mL of sterilized beef extract peptone medium and cultured at 120 r / min and 30 ℃ for 5 days.

[0040] (5) Isolation and preservation of bacterial strains In a clean bench, the enriched culture medium was serially diluted with sterile water and spread onto heterotrophic ammoniated solid medium. After standing for 30 min, the plates were inverted and incubated at 30 ℃ for at least 24 h. Single colonies with different morphological characteristics were picked and inoculated into heterotrophic ammoniated liquid medium. After incubation at 120 r / min and 30 ℃ for 24 h, the culture was further purified by streaking on plates. This process was repeated three times. The resulting single colonies were then inoculated into heterotrophic ammoniated liquid medium and incubated under the same conditions for 24 h. Finally, the culture was inoculated into paraffin slant agar and stored at 4 ℃. Simultaneously, 500 μL of the bacterial culture was mixed with 50% glycerol at a 1:1 ratio and frozen at -80 ℃. NH4+ levels in the culture medium were then measured. + -N content was used to further screen for strains that could efficiently degrade ammonia nitrogen for the next stage of experiments. Finally, the strain TYF-QDKJ-P44, which showed the best ammonia nitrogen degradation effect, was identified as the target strain. Its colony morphology on solid culture medium is shown in the figure below. Figure 2 As shown.

[0041] Example 2: Molecular biological identification of strain TYF-QDKJ-P44 In this embodiment, the highly efficient strain TYF-QDKJ-P44 obtained through screening was subjected to molecular biological identification to determine its taxonomic status.

[0042] The purified strain was inoculated into basal medium and cultured at 140 r / min and 30 ℃ for more than 48 h. The total genomic DNA of the strain was extracted using the bacterial culture as a template.

[0043] Using the extracted genomic DNA as a template, PCR amplification was performed using the universal primer pair 27F / 1492R for the bacterial 16S rRNA gene.

[0044] PCR reaction system (50 μL): 1 μL template DNA, 1 μL each of forward and reverse primers, 25 μL 2×Taq PCR MasterMix, and ddH2O to a final volume of 50 μL. PCR reaction program: pre-denaturation at 95℃ for 5 min; denaturation at 94℃ for 30 s, annealing at 57℃ for 30 s, extension at 72℃ for 90 s, for a total of 30 cycles; then extension at 72℃ for 10 min, and finally storage at 4℃ for 15 min.

[0045] The upstream primer was 27F (SEQ ID No. 2): 5' AGAGTTTGATCCTGGCTCAG 3'; The downstream primer is 1492R (SEQ ID No. 3): 5' TACGGCTACCTTGTACGACTT 3'; The 16S rRNA product obtained by PCR amplification was subjected to first-generation sequencing by Sangon Biotech Co., Ltd. The obtained sequence was submitted to the NCBI website and compared with existing strain data in the GenBank database. Then, BLAST (http: / / www.ncbi.nlm.nih.gov / blast / ) was used to search for strains with high similarity. Pseudomonas sp. The homology was as high as 99%. Then, using MEGA 11.0 software, a phylogenetic tree was constructed using the Neighbor Joining method, such as... Figure 1 As shown, further analysis of the genus and species of the strain was conducted. The strain was identified as belonging to the genus *Pseudomonas* (…). Pseudomonas sp. The strain was named TYF-QDKJ-P44. It was deposited on October 31, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 36444, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China.

[0046] The 16S rRNA sequence of Pseudomonas TYF-QDKJ-P44 is shown in SEQ ID No. 1: CGGGGGCAGCTACCATGCAGTCGAGCGGATGAAGGGAGCTTGCTCCTGAATTCAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGTAGTGGGGGACAACGTTTCGAAAGGAACGCTAATACCGCATACGTCCTACGGGAGAAAGCAGGGGACCTTCGGGCCTTGCGCTATCAGATGAGCTAGGTCGGATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGGCGACTCCGTAAC TGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACCGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAAGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCATTGTAAAGCACTTTAAGTTGGGAGGAAGGGTTGTAGATTAATACTCTAATTTTGACGTTACCGACAGAATAAGCACCGGCTAACTCTGTGCCACGGCGCGCGGTAAA.

[0047] Example 3: Degradation performance of strain TYF-QDKJ-P44 on different initial ammonia nitrogen concentrations This example investigated the effect of initial ammonia nitrogen concentration on the growth and degradation performance of strain TYF-QDKJ-P44, aiming to determine its effective concentration range.

[0048] Glycerol tubes of the TYF-QDKJ-P44 strain, stored at -80℃, were inoculated into heterotrophic ammonified liquid medium and activated at 30℃ and 120 rpm until the logarithmic phase. The activated bacterial culture was then transferred at a 5% (v / v) inoculation rate to a series of 250 mL Erlenmeyer flasks containing 100 mL of fresh heterotrophic ammonified liquid medium. The initial NH4+ level was set by adjusting the amount of ammonium sulfate added to the medium. + -N concentration gradients were: 100 mg / L, 200 mg / L, 300 mg / L, 500 mg / L, 800 mg / L, and 1200 mg / L. All conical flasks were incubated at 30°C and 120 rpm for 48 h using a constant temperature shaker. Three parallel experiments were set up for each concentration, with uninoculated culture medium as a blank control.

[0049] Aseptic samples were taken from each conical flask at 0, 12, 24, 36, and 48 hours of incubation. The absorbance (OD) of a portion of the sample was immediately measured at 600 nm using a UV spectrophotometer. 600 The amount of NH4+ in the supernatant was determined by centrifugation (12000 rpm, 5 min) to characterize the bacterial growth. The remaining sample was then centrifuged at high speed (12000 rpm, 5 min), and the supernatant was collected. The NH4+ content in the supernatant was determined by Nessler's reagent spectrophotometry. + Calculate the ammonia nitrogen degradation rate based on the concentration of -N.

[0050] Results of strain growth and ammonia nitrogen degradation kinetics are as follows: Figure 3 and Figure 4 As shown. In different NH4 + All strains grew well at -N concentrations. The initial NH4+ in the culture medium... + When the -N concentration is less than 500 mg / L, more than 95% of the NH4+ can be degraded within 48 hours. Furthermore, the initial NH4+... + When the -N concentration is less than 800 mg / L, the strain's resistance to NH4+ decreases with increasing concentration. + The degradation rate of -N gradually increases. At 800 mg / L, the degradation rate of NH4+ reaches its maximum after 48 hours. + -N degradation rate reached 92.18%, OD 600 The value also reached its maximum, at 1.4041. However, at 1200 mg / L, the degradation rate of the strain decreased slightly, reaching only 32.56% after 48 hours. This indicates that when the NH4+ concentration in the culture medium... + When the -N concentration is too high, it will affect the strain's NH4+. +The degradation rate of -N slowed down, but did not inhibit the degradation ability of the strain. Therefore, it can be seen that the strain, with an initial ammonia nitrogen concentration of 100... Within the range of 800 mg / L, the degradation rate of ammonia nitrogen can reach over 90%, especially for high concentrations of NH4. + -N exhibits good tolerance and has the potential to treat high ammonia nitrogen wastewater in practical applications.

[0051] Example 4: Degradation performance of strain TYF-QDKJ-P44 under different carbon-to-nitrogen ratios (C / N) This example investigates the effect of the carbon-to-nitrogen ratio on the denitrification efficiency of the TYF-QDKJ-P44 strain, aiming to determine its optimal nutrient conditions.

[0052] Using sodium citrate as the sole carbon source and ammonium sulfate as the sole nitrogen source, initial NH4 was fixed. + The -N concentration was set at 200 mg / L, and the sodium citrate dosage was adjusted to set a carbon-to-nitrogen ratio gradient of 2, 5, 10, 15, and 20. Other components of the culture medium were the same as those of the heterotrophic ammoniation medium.

[0053] The activated TYF-QDKJ-P44 bacterial culture was inoculated at a rate of 5% (v / v) into 100 mL of heterotrophic ammoniation medium with different C / N ratios and cultured at 30℃ and 120 rpm for 48 hours. Three replicates were set up for each C / N ratio.

[0054] The growth and ammonia nitrogen degradation results of the strains under different C / N conditions are as follows: Figure 5 and Figure 6 As shown. NH4+ levels after 48 hours when C / N ratios were 2, 5, 10, 15, and 20. + The degradation rates of -N were 42.65%, 84.78%, 95.32%, 89.96%, and 52.54%, respectively. The degradation rate reached its highest point when C / N = 10, with an OD of [missing value]. 600 The value also reached its maximum, at 1.4232. Therefore, the optimal C / N range for the growth and function of strain TYF-QDKJ-P44 is 5-15.

[0055] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. An aerobic, highly efficient ammonia nitrogen-degrading strain, characterized in that, The strain is Pseudomonas ( ) Pseudomonas sp. TYF-QDKJ-P44 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 36444 and deposit date of October 31, 2025.

2. The aerobic, high-efficiency ammonia nitrogen-degrading strain according to claim 1, characterized in that, The 16S rRNA gene sequence of the strain is shown in SEQ ID No.

1.

3. A microbial inoculant, characterized in that, Contains an effective amount of the aerobic, highly efficient ammonia nitrogen degrading strain TYF-QDKJ-P44 as described in claim 1 or 2.

4. The microbial agent according to claim 3, characterized in that, The microbial agent is prepared by fermenting and culturing the Pseudomonas TYF-QDKJ-P44, collecting the cells, mixing them with a protectant, and then drying them.

5. The application of the aerobic, high-efficiency ammonia nitrogen degrading strain according to claim 1 or 2, or the microbial agent according to claim 3 or 4, in the degradation of ammonia nitrogen pollution in water bodies.

6. The application according to claim 5, characterized in that, The water body includes natural freshwater bodies, domestic sewage, industrial wastewater, or artificial sewage treatment systems; the industrial wastewater includes coking wastewater, landfill leachate, or aquaculture wastewater.

7. The application according to claim 5 or 6, characterized in that, The application is carried out under aerobic conditions; when the initial ammonia nitrogen concentration in the water is 100-800 mg / L, the degradation rate of ammonia nitrogen by the strain or agent can reach more than 90%; and / or, the carbon-nitrogen ratio range for the strain or agent to exert its optimal degradation efficiency is 5-15.

8. A method for treating ammonia nitrogen-polluted water bodies, characterized in that, This includes adding an effective amount of the aerobic, high-efficiency ammonia nitrogen-degrading strain described in claim 1 or 2, or the microbial agent described in claim 3 or 4, to the ammonia nitrogen-polluted water body to be treated, and carrying out biological treatment under aerobic conditions.

9. The method according to claim 8, characterized in that, The aerobic conditions are achieved through aeration, stirring, or natural reoxygenation.

10. The method according to claim 8 or 9, characterized in that, The dosage of the bacterial strain or agent, based on bacterial cell concentration, is 10. 4 -10 8 CFU / mL water.

Citation Information

Patent Citations

  • Method for denitrifying wastewater by using low-temperature-resistant heterotrophic nitrification and aerobic denitrification bacteria

    CN120328744A

  • Aerobic efficient ammonia nitrogen degradation strain TYF-QDKJ-P83 and application thereof

    CN121874051A

  • Salt-tolerant heterotrophic nitrification aerobic denitrification phosphorus removal bacterial strain and application thereof

    US20240191178A1