Method for enhancing the insect resistance of poplar by using leaf senescence-related gene nac109
By knocking out the NAC109 gene, a senescence gene in poplar leaves, using CRISPR/Cas9 gene editing technology, the problem of fall webworm infestation on poplar trees was solved, thereby enhancing the poplar's insect resistance and ecological safety, and providing an efficient control technology pathway.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- BEIJING FORESTRY UNIVERSITY
- Filing Date
- 2026-01-29
- Publication Date
- 2026-07-07
AI Technical Summary
The American white moth severely damages broad-leaved trees such as poplar, and existing control technologies are insufficient to effectively curb its spread and harm. In particular, leaf loss leads to physiological metabolic disorders and stunted growth in trees, and there is a lack of efficient and environmentally friendly comprehensive control measures.
The insect resistance of poplar trees was enhanced by knocking out the NAC109 gene, which is related to leaf senescence, using CRISPR/Cas9 gene editing technology. The specific steps included obtaining the PtNAC109 gene sequence, designing guide gRNA, constructing a targeting vector, Agrobacterium infection, callus screening and rooting culture, and finally obtaining new poplar germplasm with enhanced insect resistance.
It significantly reduces the feeding preferences and digestive efficiency of American white moth larvae, reduces leaf loss, enhances the insect resistance of poplar trees, meets ecological safety requirements, and has good application prospects.
Smart Images
Figure CN121874249B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of insect resistance research technology, specifically to a method for enhancing the insect resistance of poplar trees using the leaf senescence-related gene NAC109. Background Technology
[0002] The description of the background art in this invention pertains to related technologies and is used merely for illustration and to facilitate understanding of the invention. It should not be construed as the applicant explicitly believing or presuming that the invention was prior art on the filing date of the first application.
[0003] The fall webworm (Hyphantria cunea) is a lepidopteran pest native to North America. Since its introduction to Asia in the mid-20th century, it has spread rapidly and is now a significant quarantine pest globally. In my country, the fall webworm is listed as a major invasive alien species and is included in the "National List of Forestry Quarantine Pests" and the "List of Quarantine Pests for Imported Plants," receiving high-level national attention. To date, this pest has caused varying degrees of damage in 611 county-level administrative regions across 14 provinces (autonomous regions and municipalities) in my country. Its distribution continues to expand, posing a very high risk of further spread and posing a serious threat to my country's forest ecological security, urban greening systems, and agricultural and forestry economy.
[0004] The American white moth's strong invasiveness and destructive power stem primarily from its biological characteristics and ecological adaptability. On the one hand, the lack of effective natural enemies (such as parasitic wasps and predatory insects) in its invasion areas leads to exponential population growth. On the other hand, the public and grassroots pest control personnel lack sufficient understanding of its life cycle, occurrence patterns, and harmful characteristics. Coupled with an inadequate early monitoring and warning system and limited reserves of green control technologies, control efforts often lag behind the rate of pest outbreaks, making effective containment difficult.
[0005] Of particular concern is the voracious feeding behavior of the fall webworm larvae. After the third instar, they enter a voracious feeding phase, often gathering in groups of dozens to hundreds at the branch tips to spin webs and feed on leaves within the webs. In areas with high density infestations, the larvae can devour the leaves of entire trees of various broadleaf species, such as poplar, willow, elm, and mulberry, within days, leaving only the main veins, creating the abnormal phenomenon of "summer trees in winter." This drastic leaf loss not only drastically reduces the photosynthetic area of trees, hindering carbohydrate synthesis and interrupting nutrient accumulation, but also severely disrupts the normal physiological metabolism and growth rhythms of trees. Long-term and repeated damage leads to weakened tree vigor and decreased resistance, subsequently inducing secondary diseases or pests, ultimately causing the death of entire forests and irreversible damage to urban landscapes, protective forest systems, and even the ecological balance of the entire region.
[0006] Furthermore, the fall webworm (Pterocarya stenoptera) is highly prolific, has a diverse diet, spreads rapidly, and is widely adaptable. It can have 2-3 generations per year (2 generations in the north, 3 generations in the south), with a single female laying 500-2000 eggs. It can also spread over long distances through adult flight and pupae transported with seedlings. These characteristics further exacerbate the difficulty of its control. Therefore, there is an urgent need to develop an efficient, environmentally friendly, and sustainable integrated control technology system to address this increasingly severe ecological security challenge. Against this backdrop, this invention proposes an innovative solution to address the shortcomings of existing technologies, aiming to improve the monitoring accuracy and control effectiveness of the fall webworm, and reduce its harm to the ecological environment and forestry production. Summary of the Invention
[0007] The purpose of this invention is to provide a
[0008] A method for enhancing the insect resistance of poplar trees using the leaf senescence-related gene NAC109 includes the following steps:
[0009] (1) Obtain the CDS sequence of the PtNAC109 gene:
[0010] (2) Design guide gRNA sequences;
[0011] (3) Construct a vector plasmid targeting the PtNAC109 gene for editing;
[0012] (4) Prepare the genetically transformed Agrobacterium infection solution;
[0013] (5) Infect Populus tomentosa plants with Agrobacterium; (6) Screen for resistant callus tissue;
[0014] (7) Induction, extension, and rooting of resistant buds;
[0015] (8) Verify the effects of gene editing using molecular biology techniques;
[0016] (9) Obtain new gene-edited poplar germplasm with enhanced insect resistance.
[0017] Furthermore, step (1) specifically includes the following steps:
[0018] The CDS sequence of the PtNAC109 gene was amplified by PCR using wild-type Populus tomentosa cDNA as a template; primers were:
[0019] Forward primer PtNAC109-F:ATGGAAAACATTTCTGGACTTG
[0020] Reverse primer PtNAC109-R:TCAATAGTTCCAGAAACAATCAAG
[0021] After purification, the PCR product was ligated into the T vector overnight at 4°C using T4 ligase. The ligation product was then transferred into E. coli by heat shock at 42°C for 60 seconds. Positive clones were screened on ampicillin-containing LB medium, and the PtNAC109 gene sequence was identified by sequencing.
[0022] Furthermore, step (2) specifically includes the following steps:
[0023] The target gene fragment was cloned, and the PtNAC109 gene sequence of Populus tomentosa was analyzed. Based on the sequence, gene editing guide gRNAs were designed and screened on the CRISPR-P2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ).
[0024] gRNA1: ATGCTAGAGCAATCGGAGATG
[0025] gRNA2: GATCTACAGAGGAAAATCCC.
[0026] Furthermore, step (3) specifically includes the following steps:
[0027] The pYLCRISPR / Cas9-N plasmid was added to E. coli TOP10 competent cells and incubated on ice for 2 minutes. After heat shock at 42°C for 60 seconds, the cells were placed on ice for 3 minutes. 500 μL of LB liquid medium was added, and the cells were centrifuged at 4000 g for 3 minutes. The precipitate was spread on LB solid medium containing Kanamycin until single colonies grew. Single colonies were picked and cultured in liquid medium. The plasmid was extracted, purified, and diluted to obtain the plasmid vector. The designed gRNA1 and gRNA2 were constructed into the gene editing vector pYLCRISPR / Cas9-N.
[0028] Furthermore, step (4) specifically includes the following steps:
[0029] The constructed gene-editing vector was introduced into Agrobacterium tumefaciens strain EHA105;
[0030] Obtaining single colonies: EHA105 Agrobacterium carrying the PtNAC109 gene editing sequence was inoculated into LB solid medium and cultured at 28°C for 48 hours; Small-scale culture of Agrobacterium: A portion of the single colony was picked and inoculated into LB liquid medium and cultured at 28°C and 200 rpm for one day; Large-scale Agrobacterium culture: All Agrobacterium cultured for one day was transferred to fresh LB liquid medium and cultured at 28°C and 200 rpm until the OD600 reached 0.8;
[0031] Secondary amplification: Agrobacterium tumefaciens after expansion culture was inoculated into new LB liquid medium at a ratio of 1:100 and cultured under the same conditions until the OD600 value was 0.6; Preparation of infection suspension: Agrobacterium tumefaciens after secondary culture was collected, and the precipitate was obtained by centrifugation and resuspended with resuspension medium (WPM liquid medium containing 30 g / L sucrose and 100 μM / L acetylsyleugenone); then graphene oxide solution was added to adjust the concentration to 0.01-0.05‰ for use in infection.
[0032] Furthermore, step (5) specifically includes the following steps:
[0033] Select one-month-old sterile poplar seedlings and cut them into small cubes with sides of 0.5-1.0 cm. Immerse them in the prepared suspension for 10-30 minutes, gently shaking them several times every five minutes to promote the co-culture of Agrobacterium and plant material. After infection, filter out excess liquid, absorb the water, and then place the leaf blades face down in a 9 cm diameter petri dish containing co-culture medium. Co-culture for one day at 22-25℃ in complete darkness. Afterward, place the petri dish at 4-7℃ for 2 hours, and then return it to 22-25℃ to continue culturing for two more days.
[0034] Furthermore, step (6) specifically includes the following steps:
[0035] The treated leaves were transferred to callus induction medium (WPM solid medium containing 30 g / L sucrose, 1.0 mg / L naphthaleneacetic acid, 2.0 mg / L zeatin, 350 mg / L Cefotaxime, 6.5 g / L agar, and 0.01–0.05‰ graphene oxide) and incubated at 22–25 °C under a light intensity of 150 μmol / m². -2 s -1 The cells were cultured for two weeks under a 16-hour light / 8-hour dark cycle, with the medium changed every week. Then, they were transferred to callus induction medium containing resistance components (WPM solid medium containing 30 g / L sucrose, 1.0 mg / L naphthaleneacetic acid, 2.0 mg / L zeatin, 350 mg / L Cefotaxime, 50 mg / L Kanamycin, 6.5 g / L agar, and 0.01~0.05‰ graphene oxide) and cultured for another 2-3 weeks under the same environmental conditions, with the medium changed regularly, until white callus formation was observed.
[0036] Furthermore, step (7) specifically includes the following steps:
[0037] The surrounding white callus tissue was excised and transplanted onto a resistant shoot induction medium (WPM solid medium containing 30 g / L sucrose, 0.1 mg / L naphthaleneacetic acid, 2.0 mg / L zeatin, 350 mg / L cefotaxime, 50 mg / L kanamycin, 6.5 g / L agar, and 0.01-0.05‰ graphene oxide). The medium was cultured under the same conditions for 4-5 weeks, changing the medium every ten days, until green resistant shoots approximately 0.5 cm long were produced. These resistant shoot fragments were then transferred to an elongation medium, WPM solid medium containing 30 g / L sucrose, 0.5 mg / L 6-BA, 350 mg / L cefotaxime, 9 mg / L kanamycin, and 6.5 g / L agar. The fragments were cultured under the same conditions for 10-20 days until the shoots elongated to 1.0-3.0 cm.
[0038] Finally, the adventitious buds are cut off and inserted into rooting medium (WPM solid medium containing 30 g / L sucrose, 0.05 mg / L NAA, 350 mg / L Cefotaxime, 30 mg / L Kanamycin, and 6.0 g / L agar) and cultured for 20-30 days until a complete root system is developed and the seedlings reach a height of 6-8 cm.
[0039] Furthermore, step (8) specifically includes the following steps:
[0040] DNA samples were extracted, and PCR amplification was performed using PtNAC109-F and PtNAC109-R primers. The PCR products were linked to a T vector and sequenced. The sequencing results were compared with the wild-type plant sequence to detect whether sequence changes occurred and whether gene editing events occurred.
[0041] The embodiments of the present invention have the following beneficial effects:
[0042] Precisely knocking out the key regulatory gene NAC109 for poplar leaf senescence using CRISPR / Cas9 gene editing technology significantly reduced the feeding preferences and digestive efficiency of the fall webworm (Hyphantriacunea) larvae. The NAC109 knockout lines showed significantly enhanced resistance to the fall webworm compared to the wild type, with leaf area loss due to the pest reduced by more than 70%. Furthermore, since this strategy does not introduce exogenous genes but achieves resistance enhancement solely through the loss of function of endogenous genes, it aligns with my country's regulatory guidelines for gene-edited plants, demonstrating good ecological safety and promising prospects for widespread application. This invention provides a new target and efficient technical pathway for poplar insect-resistant breeding, and is of significant value in ensuring the ecological security of plantations and timber production. Attached Figure Description
[0043] Figure 1 This is a map of the gene editing vector pYLCRISPR / Cas9P35S-N used in this invention.
[0044] Figure 2 The diagram shows the structure of the PtNAC109 gene and the location of the guide gRNA in this invention. Figure 2 A), and a schematic diagram of constructing gRNA onto a gene editing vector ( Figure 2 B).
[0045] Figure 3 This image shows the results of gene editing detection, including analysis of the gene-edited sequences (Ptnac109_cr #1, Ptnac109_cr #7, Ptnac109_cr #9) and wild-type (WT) sequences. Specifically, Ptnac109_cr #1 has a 285bp deletion, Ptnac109_cr #7 has a 5bp deletion (including the AAAAT base deletion), and Ptnac109_cr #9 has a 2bp deletion (including the AG base deletion).
[0046] Figure 4 The growth phenotypes of three gene-edited lines, Ptnac109_cr #1, Ptnac109_cr #7, and Ptnac109_cr #9, are presented. (A) Populus tomentosa plant height phenotype; (B) Plant height statistics of the wild type and the three gene-edited lines Ptnac109_cr #1, Ptnac109_cr #7, and Ptnac109_cr #9; (C) Base diameter statistics of the wild type and the three gene-edited lines Ptnac109_cr #1, Ptnac109_cr #7, and Ptnac109_cr #9. ns indicates no significance.
[0047] Figure 5 Phenotypic growth of fall webworms three days after feeding ( Figure 5 A) and larval body length ( Figure 5 B) and statistical analysis of weight gain ( Figure 5 C). Feeding experiments with the fall webworm revealed that feeding different strains of Populus tomentosa (WT, Ptnac109_cr #1, Ptnac109_cr #7, and Ptnac109_cr #9) with leaves, using methods referenced from relevant insect resistance research literature (Mao et al., 2017), showed that after 3 days of feeding, the weight gain of fall webworm larvae fed with Ptnac109_cr #1, Ptnac109_cr #7, and Ptnac109_cr #9 poplar leaves was significantly lower than that of WT plants, with weight gains 42.2%, 36.5%, and 29.7% lower than those of wild-type plants, respectively.
[0048] Figure 6 Phenotypic characteristics of American white moth larvae after feeding on different poplar leaves ( Figure 6 A) and statistical analysis of leaf area loss ratio ( Figure 6 B and Figure 6 C). An experiment involving feeding poplar leaves to the fall webworm revealed that different strains of Populus tomentosa (Ptnac109_cr #1, Ptnac109_cr #7, and Ptnac109_cr #9) were fed leaves, with the feeding method referring to relevant literature on insect resistance research (Mao et al., 2017). The results showed that after 16 and 24 hours of feeding, fall webworm larvae exhibited feeding preferences. The proportion of leaves consumed by Ptnac109_cr #1, Ptnac109_cr #7, and Ptnac109_cr #9 poplar leaves was significantly lower than that of the WT plants. After 24 hours of feeding, the leaf area loss was reduced by 74.6%, 83.2%, and 80.3% respectively compared to the wild type. Detailed Implementation
[0049] The present application will be further described below with reference to the embodiments.
[0050] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, in the following description, different "an embodiment" or "an embodiment" do not necessarily refer to the same embodiment. Different embodiments can be substituted or combined, and for those skilled in the art, other implementation methods can be obtained based on these embodiments without creative effort.
[0051] A method for enhancing the insect resistance of poplar trees using the leaf senescence-related gene NAC109 includes the following steps:
[0052] (1) Obtain the CDS sequence of the PtNAC109 gene.
[0053] In this embodiment, the CDS sequence of the PtNAC109 gene was amplified by PCR using wild-type Populus tomentosa cDNA as a template. Primers were:
[0054] Forward primer PtNAC109-F:ATGGAAAACATTTCTGGACTTG
[0055] Reverse primer PtNAC109-R:TCAATAGTTCCAGAAACAATCAAG
[0056] After purification, the PCR product was ligated into the T vector overnight at 4°C using T4 ligase. The ligation product was then transferred to E. coli by heat shock. Positive clones were screened on ampicillin-containing LB medium, and the PtNAC109 gene sequence was identified by sequencing.
[0057] (2) Design of guide gRNA sequence
[0058] The target gene fragment was cloned, and the PtNAC109 gene sequence of Populus tomentosa was analyzed. Based on the sequence, gene editing guide gRNAs were designed and screened on the CRISPR-P2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ).
[0059] gRNA1: ATGCTAGAGCAATCGGAGATG
[0060] gRNA2: GATCTACAGAGGAAAATCCC
[0061] (3) Constructing a PtNAC109 gene editing vector plasmid:
[0062] The pYLCRISPR / Cas9-N plasmid was added to *E. coli* TOP10 competent cells and incubated on ice. After heat shock in a water bath, the cells were placed on ice, added to LB liquid medium, centrifuged, and the precipitate was spread on LB solid medium containing Kanamycin until single colonies grew. Single colonies were picked and cultured in liquid medium. The plasmid was extracted, purified, and diluted to obtain the plasmid vector. The designed gRNA1 and gRNA2 were constructed into the gene editing vector pYLCRISPR / Cas9-N according to the vector construction method in the authorized national invention patent (Wang Houling; Xia Xinli; Yin Weilun; Liu Xiao; Ren Shuning; Zhu Chenyu. ZL 202311295558.2). Figure 1 The image shows the gene editing vector pYLCRISPR / Cas9P35S-N used in this invention. Figure 2 The diagram shows the structure of the PtNAC109 gene and the location of the guide gRNA in this invention. Figure 2 A), and a schematic diagram of constructing gRNA onto a gene editing vector ( Figure 2 B);
[0063] (4) Prepare the Agrobacterium tumefaciens infection solution for genetic transformation:
[0064] The constructed gene-editing vector was introduced into Agrobacterium strain EHA105; single colonies were obtained: Agrobacterium EHA105 carrying the PtNAC109 gene-editing sequence was inoculated into LB solid medium and cultured at 28°C for 48 hours; small-scale culture of Agrobacterium: a portion of the single colony was picked and inoculated into LB liquid medium and cultured at 28°C and 200 rpm for one day; Agrobacterium culture was expanded: all Agrobacterium cultured for one day was transferred to fresh LB liquid medium and cultured at 28°C and 200 rpm until the OD600 reached 0.8; secondary amplification was performed: the expanded Agrobacterium was inoculated into new LB liquid medium at a ratio of 1:100 and cultured under the same conditions until the OD600 value reached 0.6; preparation of infection suspension: the Agrobacterium EHA105 after secondary culture was collected, the precipitate was obtained by centrifugation, and the precipitate was resuspended with a specific solution. Then, graphene oxide solution was added to adjust the concentration to 0.01-0.05‰ for use in infection.
[0065] (5) Infecting Populus tomentosa plants with Agrobacterium: Select sterile Populus tomentosa seedlings that are one month old and cut them into small cubes with a side length of 0.5-1.0 cm. Soak these slices in the prepared suspension for 10-30 minutes, gently shaking them several times every five minutes to promote the co-culture of Agrobacterium and plant material. After infection, filter out the excess liquid, absorb the water, and then place the leaf face down in a 9 cm diameter petri dish containing co-culture medium. Co-culture for one day at 22-25℃ in complete darkness. After that, place the petri dish at 4-7℃ for 2 hours, and then return it to 22-25℃ to continue culturing for two days.
[0066] (6) Screening for resistant callus: The treated leaves were transferred to callus induction medium and incubated at 22-25℃ and 150 μmol / m² light intensity. -2 s -1 Cultured for two weeks under a cycle of 16 hours of light / 8 hours of darkness, with the medium changed every week; then transferred to a callus induction medium containing resistance components, and cultured for another 2-3 weeks under the same environmental conditions, with the medium changed regularly, until white callus formation was observed.
[0067] (7) Induction, elongation and rooting of resistant shoots: The surrounding white callus tissue was removed and transplanted onto the resistant shoot induction medium. The shoots were cultured under the same conditions for 4-5 weeks, with the medium being changed every 10 days, until green resistant shoots of about 0.5 cm in length were produced. These resistant shoot fragments were transferred to elongation medium (WPM solid medium containing 30 g / L sucrose, 0.5 mg / L 6-BA, 350 mg / L cefotaxime, 9 mg / L kanamycin, and 6.5 g / L agar) and cultured under the same conditions for 10-20 days until the shoots elongated to 1.0-3.0 cm. Finally, the adventitious shoots were cut off and inserted into the rooting medium and cultured for 20-30 days until a complete root system was developed and the seedling height reached 6-8 cm.
[0068] (8) Verify the gene editing effect using molecular biology methods: Extract DNA samples and perform PCR amplification using PtNAC109-F and PtNAC109-R primers to confirm the occurrence of the editing event.
[0069] (9) Obtaining new gene-edited poplar germplasm with enhanced insect resistance
[0070] Figure 3 This image shows the results of gene editing detection, including analysis of the gene-edited sequences (Ptnac109_cr #1, Ptnac109_cr #7, Ptnac109_cr #9) and wild-type (WT) sequences. Specifically, Ptnac109_cr #1 has a 285bp deletion, Ptnac109_cr #7 has a 5bp deletion (including the AAAAT base deletion), and Ptnac109_cr #9 has a 2bp deletion (including the AG base deletion). Figure 4 Growth phenotypes of three gene-edited lines: Ptnac109_cr #1, Ptnac109_cr #7, and Ptnac109_cr #9. (A) Populus tomentosa plant height phenotype; (B) Plant height statistics of wild type and the three gene-edited lines: Ptnac109_cr #1, Ptnac109_cr #7, and Ptnac109_cr #9; (C) Base diameter statistics of wild type and the three gene-edited lines: Ptnac109_cr #1, Ptnac109_cr #7, and Ptnac109_cr #9. ns indicates no significance. Figure 5 Phenotypic growth of fall webworms three days after feeding ( Figure 5 A) and larval body length ( Figure 5 B) and statistical analysis of weight gain ( Figure 5C). Feeding experiments with the fall webworm revealed that feeding different strains of Populus tomentosa (WT, Ptnac109_cr #1, Ptnac109_cr #7, and Ptnac109_cr #9) with leaves, using methods referenced from relevant insect resistance research literature (Mao et al., 2017), showed that after 3 days of feeding, the weight gain of fall webworm larvae fed with Ptnac109_cr #1, Ptnac109_cr #7, and Ptnac109_cr #9 poplar leaves was significantly lower than that of WT plants, with weight gains 42.2%, 36.5%, and 29.7% lower than those of wild-type plants, respectively. Figure 6 Phenotypic characteristics of American white moth larvae after feeding on different poplar leaves ( Figure 6 A) and statistical analysis of leaf area loss ratio ( Figure 6 B and Figure 6 C). An experiment involving feeding poplar leaves to the fall webworm revealed that different strains of Populus tomentosa (Ptnac109_cr #1, Ptnac109_cr #7, and Ptnac109_cr #9) were fed leaves, with the feeding method referring to relevant literature on insect resistance research (Mao et al., 2017). The results showed that after 16 and 24 hours of feeding, fall webworm larvae exhibited feeding preferences. The proportion of leaves consumed by Ptnac109_cr #1, Ptnac109_cr #7, and Ptnac109_cr #9 poplar leaves was significantly lower than that of the WT plants. After 24 hours of feeding, the leaf area loss was reduced by 74.6%, 83.2%, and 80.3% respectively compared to the wild type.
[0071] PtNAC109 gene CDS sequence
[0072] SEQ ID NO:1(Populus tomentosa):
[0073]
[0074] It should be noted that the above embodiments can be freely combined as needed. The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention can have various modifications and variations. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A method for enhancing the insect resistance of poplar trees using the leaf senescence-related gene NAC109, characterized in that, Includes the following steps: (1) Obtain the CDS sequence of the PtNAC109 gene. The CDS sequence of the PtNAC109 gene is shown in SEQ ID NO:1: (2) Design guide gRNA sequences; (3) Construct a vector plasmid targeting the PtNAC109 gene for editing; (4) Prepare the genetically transformed Agrobacterium infection solution; (5) Infecting Populus tomentosa plants with Agrobacterium tumefaciens; (6) Screening for resistant callus tissue; (7) Induction, bud elongation and rooting resistance buds; (8) Verify the effects of gene editing using molecular biology techniques; (9) Obtain new gene-edited poplar germplasm with enhanced insect resistance.
2. The method for enhancing poplar insect resistance using the leaf senescence-related gene NAC109 according to claim 1, characterized in that, Step (1) specifically includes the following steps: The CDS sequence of the PtNAC109 gene was amplified by PCR using wild-type Populus tomentosa cDNA as a template; primers were: Forward primer PtNAC109-F:ATGGAAAACATTTCTGGACTTG Reverse primer PtNAC109-R:TCAATAGTTCCAGAAACAATCAAG After purification, the PCR product was ligated into the T vector overnight at 4°C using T4 ligase. The ligation product was then transferred to E. coli by heat shock at 42°C for 60 seconds. Positive clones were screened on ampicillin-containing LB medium, and the PtNAC109 gene sequence was identified by sequencing.
3. The method for enhancing poplar insect resistance using the leaf senescence-related gene NAC109 according to claim 1, characterized in that, Step (2) specifically includes the following steps: The target gene fragment was cloned, and the PtNAC109 gene sequence of Populus tomentosa was analyzed. Based on the sequence, gene editing guide gRNAs were designed and screened on the CRISPR-P2.0 website. gRNA1: ATGCTAGAGCAATCGGAGATG gRNA2: GATCTACAGAGGAAAATCCC.
4. The method for enhancing poplar insect resistance using the leaf senescence-related gene NAC109 according to claim 3, characterized in that, Step (3) specifically includes the following steps: The pYLCRISPR / Cas9-N plasmid was added to E. coli TOP10 competent cells and incubated on ice for 2 minutes. After heat shock at 42°C for 60 seconds, the cells were placed on ice for 3 minutes. 500 μL of LB liquid medium was added, and the cells were centrifuged at 4000 g for 3 minutes. The precipitate was spread on LB solid medium containing Kanamycin until single colonies grew. Single colonies were picked and cultured in liquid medium. The plasmid was extracted, purified, and diluted to obtain the plasmid vector. The designed gRNA1 and gRNA2 were constructed into the gene editing vector pYLCRISPR / Cas9-N.
5. The method for enhancing poplar insect resistance using the leaf senescence-related gene NAC109 according to claim 4, characterized in that, Step (4) specifically includes the following steps: The constructed gene-editing vector was introduced into Agrobacterium EHA105 strain; Obtaining single colonies: Agrobacterium EHA105 carrying the PtNAC109 gene editing sequence was inoculated into LB solid medium and cultured at 28°C for 48 hours; Small-scale culture of Agrobacterium: A portion of a single colony was picked and inoculated into LB liquid medium and cultured for one day at 28°C and 200 rpm; Expanding Agrobacterium culture: Transfer all Agrobacterium bacteria cultured for one day to fresh LB liquid medium and continue to culture at 28℃ and 200 rpm until OD600 reaches 0.8; Secondary amplification: Agrobacterium tumefaciens after expansion culture was inoculated into new LB liquid medium at a ratio of 1:100 and cultured under the same conditions until the OD600 value was 0.6; Preparation of infection suspension: Collect EHA105 Agrobacterium after secondary culture, obtain the precipitate by centrifugation, and resuspend the precipitate with resuspension solution; then add graphene oxide solution to adjust the concentration to 0.01-0.05‰ for use in infection; the resuspension solution is WPM liquid culture medium containing 30 g / L sucrose and 100 μM / L acetylsylgenone.
6. The method for enhancing poplar insect resistance using the leaf senescence-related gene NAC109 according to claim 5, characterized in that, Step (5) specifically includes the following steps: Select one-month-old sterile poplar seedlings and cut the leaves into small cubes with sides of 0.5-1.0 cm. Soak them in the prepared suspension for 10-30 minutes, gently shaking them several times every five minutes to promote the co-culture of Agrobacterium and plant material. After infection, filter out the excess liquid, absorb the water, and then place the leaves face down in a 9 cm diameter petri dish containing co-culture medium. Co-culture for one day at 22-25℃ in complete darkness. Afterward, place the petri dish at 4-7℃ for 2 hours, and then return it to 22-25℃ to continue culturing for two more days.
7. The method for enhancing poplar insect resistance using the leaf senescence-related gene NAC109 according to claim 6, characterized in that, Step (6) specifically includes the following steps: The treated leaves were transferred to callus induction medium and incubated at 22-25℃ under a light intensity of 150 μmol·m⁻². -2 ·s -1 The cells were cultured for two weeks under a 16-hour light / 8-hour dark cycle, with the culture medium changed every week. Then, they were transferred to a callus induction medium containing resistance components and cultured for another 2-3 weeks under the same environmental conditions, with the culture medium changed regularly, until white callus formation was observed. The callus induction medium was WPM solid medium containing 30 g / L sucrose, 1.0 mg / L naphthaleneacetic acid, 2.0 mg / L zeatin, 350 mg / L Cefotaxime, 50 mg / L Kanamycin, 6.5 g / L agar, and 0.01-0.05‰ graphene oxide.
8. The method for enhancing poplar insect resistance using the leaf senescence-related gene NAC109 according to claim 7, characterized in that, Step (7) specifically includes the following steps: The surrounding white callus tissue was removed and transplanted onto a resistant shoot induction medium. The shoots were cultured under the same conditions for 4-5 weeks, with the medium changed every ten days, until green resistant shoots approximately 0.5 cm long were produced. The resistant shoot induction medium was WPM solid medium containing 30 g / L sucrose, 0.1 mg / L naphthaleneacetic acid, 2.0 mg / L zeatin, 350 mg / L cefotaxime, 50 mg / L kanamycin, 6.5 g / L agar, and 0.01-0.05‰ graphene oxide. These resistant shoot fragments were then transferred to an elongation medium, which was also WPM solid medium containing 30 g / L sucrose, 0.5 mg / L 6-BA, 350 mg / L cefotaxime, 9 mg / L kanamycin, and 6.5 g / L agar. The shoots were cultured under the same conditions for 10-20 days until they elongated to 1.0-3.0 cm. Finally, the adventitious buds are cut off and inserted into the rooting medium; continue to culture for 20-30 days until a complete root system is developed and the seedling height reaches 6-8 cm; the rooting medium is WPM solid medium containing 30 g / L sucrose, 0.05 mg / L NAA, 350 mg / L Cefotaxime, 30 mg / L Kanamycin, and 6.0 g / L agar.
9. The method for enhancing the insect resistance of poplar trees using the leaf senescence-related gene NAC109 according to claim 8, characterized in that, Step (8) specifically includes the following steps: DNA samples were extracted, and PCR amplification was performed using PtNAC109-F and PtNAC109-R primers. The PCR products were linked to a T vector and sequenced. The sequencing results were compared with the wild-type plant sequence to detect whether sequence changes occurred and whether gene editing events occurred.