Use of a polyphenol oxidase StPPO9 gene in improving plant resistance to late blight
By overexpressing the polyphenol oxidase StPPO9 gene in potatoes, the plant defense response was activated, solving the problem of insufficient resistance to late blight in potatoes and achieving biosafety and environmentally friendly disease-resistant breeding results.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- YUNNAN NORMAL UNIV
- Filing Date
- 2026-03-20
- Publication Date
- 2026-07-24
AI Technical Summary
Current technologies lack effective polyphenol oxidase genes to improve potato resistance to late blight, leading to increased use of chemical pesticides, environmental pollution, and enhanced pathogen resistance.
The polyphenol oxidase StPPO9 gene was overexpressed in plants, especially in potatoes. By cloning the StPPO9 gene and transforming potato cells using Agrobacterium-mediated transformation, the plant's defense response was activated, enhancing resistance.
It significantly improved potato resistance to late blight, reduced the disease index, and provided a biosafe and environmentally safe genetic modification program.
Smart Images

Figure CN121874256B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of genetic engineering and plant disease resistance breeding, specifically to a polyphenol oxidase. StPPO9 Application of genes in improving plant resistance to late blight. Background Technology
[0002] Late blight is caused by the pathogenic fungus Phytophthora ( Phytophthora infestans Late blight is a devastating plant disease that poses a serious threat to the production of solanaceous crops such as potatoes and tomatoes. Currently, the control of late blight mainly relies on chemical pesticides, which not only increases production costs but also leads to environmental pollution and increased pesticide resistance in pathogens. Therefore, discovering the plant's own disease-resistant genes plays a crucial role in disease-resistant breeding and is a fundamental way to achieve green and sustainable agricultural development.
[0003] Polyphenol oxidase (PPO) is a class of copper-containing redox enzymes widely found in plants, animals, and microorganisms. It primarily catalyzes the oxidation of phenolic substances (such as catechins and catechols) into quinones, which then polymerize to form brown pigments, leading to browning in fruits and vegetables or changes in color and flavor during the fermentation of tea and coffee. Furthermore, it plays an important role in plant defense responses. For example, overexpression of PPO in tomatoes... PPO The gene enhanced the plant's resistance to *Pseudomonas syringae* and inhibited... PPO The gene weakens its disease resistance; overexpression in strawberries FaPPO1 Genes can also increase PPO activity in strawberry fruits, delaying the infection process of botrytis cinerea. However, not all genes can do this. PPO Family members all possess significant or specific disease resistance functions. Currently, there is a lack of specific and highly effective disease resistance data for the potato plant. PPO Genes used to enhance potato resistance to late blight have been reported. Therefore, there is an urgent need in this field to identify key genes with significant resistance to late blight. PPO Genes, and develop their application in improving crop disease resistance. Summary of the Invention
[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a polyphenol oxidase. StPPO9 Application of genes in improving plant resistance to late blight.
[0005] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a polyphenol oxidase. StPPO9 Application of genes in improving plant resistance to late blight, specifically polyphenol oxidase. StPPO9 The gene is any one of the following 1)-3): (1) It has a nucleotide sequence as shown in SEQ ID No. 1; (2) Possesses a polynucleotide that can encode an amino acid sequence such as that shown in SEQ ID No. 2 for polyphenol oxidase; (3) It has more than 80% homology with the nucleotide sequence defined in (1) or (2), and the encoded protein has the same anti-late blight function as the polyphenol oxidase shown in SEQ ID No. 2.
[0006] Preferably, the application is achieved by overexpressing the [specific ingredient] in plants. StPPO9 This is achieved through the polyphenol oxidase gene.
[0007] Preferably, the plant is a plant of the Solanaceae family, and more preferably, it is a potato.
[0008] A second aspect of the present invention provides a method for cloning the above-mentioned polyphenol oxidase. StPPO9 A primer pair for a gene, the primer pair comprising an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID No. 3 and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 4.
[0009] A third aspect of the present invention provides a polyphenol oxidase derived from the above-mentioned polyphenol oxidase. StPPO9 Application of gene-encoded proteins in improving plant resistance to late blight.
[0010] Preferably, the protein is any one of the following a)-b): a) A polyphenol oxidase consisting of an amino acid sequence as shown in SEQ ID No. 2; b) A protein with the same function as the protein shown in SEQ ID No. 2 obtained by substituting, deleting or inserting 1-20 amino acids into the amino acid sequence shown in SEQ ID No. 2.
[0011] In a fourth aspect, the present invention provides the above-described polyphenol oxidase. StPPO9 Application of genes or recombinant expression vectors containing such genes, transgenic cell lines, and genetically engineered bacteria in the cultivation of plants resistant to late blight.
[0012] Preferably, the expression vector is pRI101; Preferably, the transgenic cell line is a plant cell, and more preferably a potato cell; Preferably, the genetically engineered bacterium is Agrobacterium.
[0013] A fifth aspect of the present invention provides a method for cultivating potatoes resistant to late blight, comprising using the aforementioned polyphenol oxidase. StPPO9The gene was introduced into potato cells and expressed to enhance their resistance to late blight.
[0014] In a sixth aspect, the present invention provides the above-described polyphenol oxidase. StPPO9 Application of genes or recombinant expression vectors containing such genes, transgenic cell lines, and genetically engineered bacteria in regulating plant resistance to late blight.
[0015] The regulation of plant resistance to late blight involves upregulating polyphenol oxidase in the plant genome. StPPO9 Gene expression enhances plant resistance to late blight and inhibits or downregulates polyphenol oxidase. StPPO9 Gene expression reduces plant resistance to late blight.
[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention reveals the potato polyphenol oxidase gene for the first time. StPPO9 Its specific functions in enhancing plant resistance to late blight provide new genetic resources for plant disease-resistant breeding. By... StPPO9 Overexpression of genes in plants (such as potatoes) can significantly activate the potato's defense response, enhance its resistance to late blight, and reduce the disease index.
[0017] This invention not only provides applications for the gene itself, but also extends to the protein it encodes, related genetic tools (such as specific primers and expression vectors), and engineered bacteria and transformants carrying the gene, forming a complete biotechnology solution that can be widely applied to the genetic improvement of disease resistance in potatoes and other crops.
[0018] This gene originates from the potato itself, and its overexpression product is a naturally occurring enzyme in the plant. Compared to exogenous insecticidal / fungalicidal proteins, it has higher biosafety and environmental safety. Attached Figure Description
[0019] Figure 1 for StPPO9 Identification results of potato overexpression lines, where A represents qRT-PCR identification. StPPO9 Transcriptional levels of genes in overexpression materials; B represents extracted genes. StPPO9-OE-13 , StPPO9-OE-16 Western blot analysis results of overexpression of total potato protein in two lines; Figure 2 For potatoes StPPO9 Overexpression materials (including) StPPO9-OE-13 and StPPO9-OE-16The results of late blight resistance identification for two transgenic lines are shown. A is a comparison of leaves 6 days after late blight inoculation; B is the relative lesion area of leaves in line A 6 days after late blight inoculation; and C is a statistical analysis of all leaves (wild-type potato Des and overexpressing strains) 6 days after late blight inoculation. StPPO9-OE-13 Overexpression StPPO9-OE-16 Average relative lesion area (16 leaves respectively); Figure 3 Induced by flg22 StPPO9 Results of ROS burst level detection in overexpression materials; Figure 4 Disease resistance marker genes in potatoes StPPO9 The expression level in the overexpression material, where A is StPR1 Gene expression level, B is StWRKY1 Gene expression levels. Detailed Implementation
[0020] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments, but this does not limit the present invention in any way. Any modifications or improvements made based on the teachings of the present invention shall fall within the protection scope of the present invention.
[0021] The processes, conditions, reagents, and experimental methods used in implementing this invention, except as specifically mentioned below, are all common knowledge and general knowledge in the field, and this invention does not have any particular limitations. Experimental methods in the embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the manufacturer.
[0022] Unless otherwise stated, all technical terms and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. However, in the event of any conflict, the specification containing the definitions shall prevail.
[0023] The following is information on the source and specifications of some of the main raw materials and reagents used in the examples: Wild-type potato Desiree (Des), provided by Wuhan Boyuan Biotechnology Co., Ltd.; Physiological race 88069 of Physiological blight pathogen, donated by Professor Wang Hongyang of Yunnan Normal University; pRI101-GFP vector provided by Professor Wang Hongyang of Yunnan Normal University; flg22, synthesized by Sangon Biotech (Shanghai) Co., Ltd.; Kanamycin, purchased from Solarbio, specification 50 mg / mL.
[0024] Example 1: Potato Disease Resistance Gene StPPO9 Cloning RNA was extracted from leaves of wild-type potato (Des) and reverse transcribed into cDNA, which was then used as a template for PCR amplification. The primers used are as follows: StPPO9-F: CTGTACAAGCCCGGGGGTACCATGATCGATAGAAGAAACGTTCTACTTG (SEQ IDNo.3); StPPO9-R: AGAGTTGTTGATTCAGAATTCCTAATCCTCAAGCACAATCTTAACACC (SEQ ID No. 4).
[0025] Specifically, the following steps are included: RNA was extracted from the leaves of 2-week-old wild-type potato (Des) using the Trizol (Invitrogen) extraction method. The procedure was described in the instructions for the Novizan Polysaccharide and Polyphenol Plant RNA Extraction Kit. The RNA was then reverse transcribed into cDNA using the Trans Script II One-Step RT-PCR Super Mix kit. The procedure was described in the instructions for the Trans Script All-in-One First-Strand cDNA Synthesis Super Mix for qPCR kit.
[0026] Using SEQ ID No. 3 and SEQ ID No. 4 as primers and cDNA as a template, PCR was performed according to the amplification system. The PCR system was 40 μL. StPPO9 PCR reaction system for the gene: 1 μL cDNA template, 20 μL 2×KOD PCR Master Mix polymerase, 1 μL StPPO9-F primer, 1 μL StPPO9-R primer, and 17 μL deionized water.
[0027] The reaction program was as follows: 98℃ pre-denaturation for 3 min → (98℃ denaturation for 20 s → 57℃ annealing for 20 s → 68℃ extension for 1 min 40 s) amplification for 34 cycles → 68℃ for 7 min → 16℃ permanent holding.
[0028] After the procedure, the band size was detected by 1% agarose gel electrophoresis, and the product was recovered and purified.
[0029] Example 2: Potato Disease Resistance Gene StPPO9 Obtaining overexpression materials (1) The result obtained in Example 1 StPPO9The gene was ligated into the pRI101-GFP vector, specifically including the following steps: the pRI101-GFP vector was double-digested with restriction endonucleases Kpn I and EcoRI, reacted at 37°C for 3 h, the band size was detected by 1% agarose gel electrophoresis, and the product was recovered and purified. The PCR product obtained in Example 1 was then used... StPPO9 The gene was ligated into the pRI101-GFP vector, which had been double-digested with Kpn I and EcoRI, using the Novizan recombinant kit to obtain the overexpression vector pRI101-StPPO9-GFP. This vector was then transformed into E. coli DH5α and screened on LB agar plates supplemented with kanamycin (50 μg / mL). The plates were incubated overnight at 37°C until single colonies grew. Single colonies were picked and verified by PCR and enzyme digestion. Positive clones were sent to Qingke Biotechnology (Kunming) Co., Ltd. for DNA sequencing verification.
[0030] Sequencing results showed that potatoes StPPO9 The gene's CDS is 1620 bp long, and its nucleic acid sequence is shown in SEQ ID No. 1, encoding a 540-amino acid protein, the amino acid sequence of which is shown in SEQ ID No. 2. The construction of potato polyphenol oxidase has been successfully confirmed. StPPO9 The gene expression vector pRI101-StPPO9-GFP was used to extract positive plasmids and transform Agrobacterium GV3101.
[0031] The sequencing primers used were pRI101-F and pRI101-R, and their sequences are as follows: pRI101-F:CACTACCAGCAGAACACC(SEQ ID No.5) pRI101-R:GAACGATCGGGGAAATTCG (SEQ ID No. 6) (2) Using Agrobacterium-mediated transformation to transfer positive vectors pRI101-StPPO9-GFP Wild-type potato Des was transformed to obtain stably expressed overexpression. StPPO9 Genetically modified plants.
[0032] The specific steps are as follows: After sterile preservation of wild-type potato shoot tips (Des) on basal medium for 3 weeks, shoot segments were used as explants and pre-cultured on pre-medium for 2 days to activate Agrobacterium tumefaciens GV3101 positive transformant strain, followed by shaking to OD. 600nmApproximately 0.5 mg of mycelium was suspended in liquid culture medium and used to infect pre-cultured explants for 10 min. The explants were then spread evenly on the culture medium and cultured in the dark at 24°C for 2 days. After 2 days, the explants were evenly transferred to the culture medium for callus induction. The culture medium was changed every two weeks until sprouting. After sprouting, when the sprouts reached about 1 cm in length, they were cut and inserted into rooting medium for rooting treatment. The seedlings were cultured at 28°C under light until most adventitious roots had developed. Finally, the rooted seedlings were removed, the culture medium was washed off, and the seedlings were planted in plug trays and grown in a greenhouse for 14 days before being transplanted to the field to obtain potatoes. StPPO9 Genetically modified material, used for subsequent identification.
[0033] Example 3: Potato Disease Resistance Gene StPPO9 Identification of overexpression materials 1. Transcription level identification Wild-type potato Des, overexpression StPPO9 RNA was extracted from transgenic potato leaves (obtained in Example 2) using the Trizol (Invitrogen) extraction method, following the instructions for the Novizan Polysaccharide and Polyphenol Plant RNA Extraction Kit. RNA was reverse transcribed into cDNA using the TransScript II One-Step RT-PCR Super Mix kit, following the instructions for the TransScript All-in-One First-Strand cDNASynthesis Super Mix for qPCR kit. Identification was performed using qRT-PCR with a transgold dye-based quantitative PCR premix. StPPO9 The expression level was determined using the following reaction system: 2 μL cDNA, 0.4 μL upstream primer qp-StActin-F / qp-StPPO9-F, 0.4 μL downstream primer qp-StActin-R / qp-StPPO9-R, 10 μL 2×Perfect Start® Green qPCR Super Mix, 0.4 μL Universal Passive Reference Dye (50×), and 6.8 μL Nuclease-free Water.
[0034] The primer sequences used for qRT-PCR are shown below: qp-StActin-F:GCTTCCCGATGGTCAAGTCA (SEQ ID No. 7); qp-StActin-R: GGATTCCAGCTGCTTCCATT (SEQ ID No. 8); qp-StPPO9-F:ATTCAGCTGCTAGAGACCCT(SEQ ID No.9); qp-StPPO9-R:TCCAACACATCACGAACCCT (SEQ ID No. 10).
[0035] See results Figure 1 In the A-group, two strains were identified in the overexpression material. StPPO9 Gene transcription levels were significantly upregulated, and significantly higher than in wild-type potatoes, respectively. StPPO9-OE-13 , StPPO9-OE-16 .
[0036] 2. Protein level identification Total protein extraction: Extraction of wild-type potato Des and genetically modified potatoes. StPPO9 After grinding potato leaves of OE-13 and OE-16 with liquid nitrogen, the powder was placed in a 1.5 mL centrifuge tube, and 200 μL of protein extraction solution was added. The mixture was vortexed and placed on ice for 30 min, then centrifuged at 15000 rpm and 4℃ for 10 min. The supernatant was transferred to a new centrifuge tube, and an equal volume of 2×SDS loading buffer was added. The tube was then incubated in a 98℃ metal bath for 10 min as the sample for subsequent Western blotting.
[0037] Western blot hybridization: After spotting, electrophoresis was performed at 80 V for 30 min, then the voltage was adjusted to 120 V and electrophoresis was continued for 1.5 h. After protein electrophoresis, the membrane was transferred at 90 V for 90 min. After the transfer, the PVDF membrane was removed and blocked with 5% skim milk for 1 h. After blocking, the primary antibody GFP was diluted 1:5000 with 3% skim milk and incubated at room temperature for 2 h. After the primary antibody incubation, the membrane was washed 3 times with PBST for 7 min each time. After washing, the secondary antibody (mouse antibody) was diluted 1:5000 with 3% skim milk and incubated at room temperature for 1 h 30 min. After the secondary antibody incubation, the membrane was washed 3 times with PBST for 7 min each time, and then chemiluminescence detection was performed.
[0038] See results Figure 1 In B, the results showed that the overexpression material StPPO9-OE-13 , StPPO9-OE-16 There is StPPO9 Gene expression proteins, StPPO9 The gene size is 1620 bp, the protein size is 59.4 kDa, and the constructed overexpression vector pRI101 tags the GFP protein, which is 26.9 kDa. Therefore, overexpression... StPPO9 In the potato material, the target protein size is 86.3 kDa.
[0039] Example 4 Overexpression StPPO9 Late blight resistance testing of genetically modified potatoes Planting of overexpression plants identified as positive in Example 3 StPPO9-OE-13 , StPPO9-OE-16 Wild-type potato (Des) grows for one month.
[0040] Used P. infestans The strain was 88069, which was grown on rye agar medium at 18°C under a 24-hour dark-light cycle for long-term preservation. For infection assays, strain 88069 was grown on rye agar medium at 18°C for 14 days for inoculation experiments.
[0041] The 88069 strain, grown for 14 days, was scraped with 5 mL of sterile water and covered with mycelial culture medium to release sporangia. The sporangia suspension was filtered through a magic filter cloth. The number of sporangia was counted under a microscope and adjusted to 100 sporangia per microliter, and then placed on ice for 3 h to release spores.
[0042] Take 10 microliters of spores and inoculate them onto the back of detached potato leaves (inoculate both sides of each leaf). Place them in a dish with moist filter paper and seal them with plastic wrap to keep them moist. Observe the lesions 4-7 days after inoculation according to the progress of the disease, and compare the lesion area of the transgenic material with that of the control leaf.
[0043] like Figure 2 Image A shows a comparison of leaves from wild-type potatoes and transgenic overexpressing potato lines 7 days after in vitro inoculation with late blight. The results show that 7 days after inoculation with late blight, overexpression was observed. StPPO9 Potato leaves have significantly fewer disease spots than wild-type potatoes.
[0044] The lesion areas of all wild-type and overexpression materials after in vitro inoculation were statistically analyzed, and graphs were plotted using GraphPad Prism 8.0.1 to obtain the relative lesion area and the average lesion area, as shown below. Figure 2 As shown in Figures B and C, the results indicate that overexpression StPPO9 The overall area of potato lesions was smaller than that of wild-type potatoes, further proving that... StPPO9 Genes enhance potato resistance to late blight.
[0045] Example 5 Overexpression StPPO9 ROS detection of genetically modified potatoes Wild-type potato Des, overexpression StPPO9Transgenic potatoes (obtained in Example 2) were treated with flg22 (a 22-amino acid peptide segment on bacterial flagellar protein with a specific function that can be recognized by pattern recognition receptors on the surface of plant cells, thereby triggering an immune response in plants), and the level of ROS was detected.
[0046] Leaves from wild-type and transgenic potatoes were taken using a punch, avoiding the veins and leaf edges. The round leaves were placed in a 96-well opaque microplate containing 200 μL of deionized water, the plate was covered, and left to stand in the dark for 12 hours. After the deionized water was removed, reaction solution (LumiNol, HRP, flg22) was added, and the ROS level was measured using a microplate reader.
[0047] The results are as follows Figure 3 As shown in the figure, the results indicate that after flg22 treatment, overexpression StPPO9 The ROS burst level in potatoes was significantly higher than in wild-type potatoes, indicating overexpression. StPPO9 Potatoes are more resistant to pathogen invasion after the disease.
[0048] Example 6 Potato disease resistance marker gene StPR1 , StWRKY1 In overexpression StPPO9 Detection of expression levels in potato plants The specific steps are as follows: Take wild-type potato Des, overexpress... StPPO9 RNA was extracted from transgenic potato leaves (obtained in Example 2) using the Trizol (Invitrogen) extraction method. The procedure was described in the instructions for the Novizan Polysaccharide and Polyphenol Plant RNA Extraction Kit. RNA was then reverse transcribed into cDNA using the TransScript II One-Step RT-PCR Super Mix kit. The procedure was described in the instructions for the TransScript All-in-One First-Strand cDNA Synthesis Super Mix for qPCR kit. The cDNA was then identified by qRT-PCR using a transgold dye-based quantitative PCR premix. StPPO9The expression level was determined using the following reaction system: 2 μL cDNA, 0.4 μL upstream primer qp-StActin-F / qp-StWRKY1-F / qp-StPR1-F, 0.4 μL downstream primer qp-StActin-R / qp-StWRKY1-R / qp-StPR1-R, 10 μL 2×Perfect Start Green qPCR Super Mix, 0.4 μL Universal Passive Reference Dye (50×), and 6.8 μL Nuclease-free Water.
[0049] The primer sequences used for qRT-PCR are shown below: qp-StActin-F:GCTTCCCGATGGTCAAGTCA (SEQ ID No. 7); qp-StActin-R: GGATTCCAGCTGCTTCCATTC (SEQ ID No. 8); qp-StWRKY1-F: GAAGAATAAAGCCGGGTCTTGG (SEQ ID No. 11); qp-StWRKY1-R:CTTACACGATTTGATCACCTCATCC(SEQ ID No.12); qp-StPR1-F: GCATCCCGAGCACAAAATTA (SEQ ID No. 13); qp-StPR1-R: GAAATCACCACTTCCCTTGG (SEQ ID No. 14).
[0050] See results Figure 4 The results showed that the transcription levels of StPR1 and StWRKY1 genes were upregulated in the overexpressing plants StPPO9-OE-13 and StPPO9-OE-16, indicating that... StPPO9 Genes enhance the disease resistance of potatoes.
[0051] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A polyphenol oxidase StPPO9 The application of genes in improving potato resistance to late blight is characterized by, The polyphenol oxidase StPPO9 The gene has the nucleotide sequence shown in SEQ ID No. 1, and the application is achieved by overexpressing the gene in potatoes. StPPO9 The polyphenol oxidase gene enhances the resistance of potatoes to late blight.
2. A polyphenol oxidase StPPO9 The application of genes in improving potato resistance to late blight is characterized by, The polyphenol oxidase StPPO9 The gene contains a polynucleotide encoding a polyphenol oxidase with the amino acid sequence shown in SEQ ID No. 2, and the application is achieved by overexpressing the polynucleotide in potatoes. StPPO9 The polyphenol oxidase gene enhances the resistance of potatoes to late blight.
3. Overexpression of polyphenol oxidase StPPO9 The application of gene-encoded proteins in improving potato resistance to late blight is characterized by, The polyphenol oxidase StPPO9 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No.
2.
4. The polyphenol oxidase according to claim 1 or 2 StPPO9 The application of genes or recombinant overexpression vectors containing such genes, transgenic plant lines, and genetically engineered bacteria in the cultivation of potatoes resistant to late blight.
5. A method for cultivating potatoes resistant to late blight, characterized in that, Includes the polyphenol oxidase as described in claim 1 or 2 StPPO9 The gene was introduced into potato plants and overexpressed to improve their resistance to late blight.
6. The polyphenol oxidase according to claim 1 or 2 StPPO9 The application of a gene, or a recombinant overexpression vector containing that gene, transgenic plant lines, or genetically engineered bacteria in regulating potato resistance to late blight, is characterized by: The regulation involves overexpressing the polyphenol oxidase. StPPO9 Gene.