Molecular marker primer set for identifying brucea javanica and brucea sumatrana and application thereof
By designing cpSSR primer sets and PCR amplification technology, the problem of distinguishing between long-stalked huperzine and wrinkled huperzine was solved, achieving simple and low-cost accurate identification, supporting the identification of genuine and counterfeit Chinese medicinal materials and species resource surveys.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- 余姚市种子种苗管理站
- Filing Date
- 2026-03-20
- Publication Date
- 2026-07-07
AI Technical Summary
The lack of accurate methods for distinguishing between long-stalked huperzine (Large-leaved huperzine) and wrinkled-edged huperzine (Small-leaved huperzine) in the market has led to a proliferation of counterfeit and substandard products by unscrupulous merchants, endangering public health and causing economic losses.
A set of cpSSR primers, including Hup3, Hup15, Hup22, and Hup26, was designed to distinguish between long-stalked huperzine and wrinkled huperzine. Molecular marker identification of huperzine species was achieved through high-throughput sequencing, primer design, PCR amplification, and polyacrylamide gel electrophoresis.
This invention provides a simple, low-cost, and highly reproducible identification method that can accurately distinguish between long-stalked huperzine and wrinkled-edged huperzine. It is applicable to the identification of genuine and counterfeit Chinese medicinal materials and species resource surveys, and supports molecular breeding research.
Smart Images
Figure CN121874396B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology, specifically relating to a molecular marker primer set for distinguishing between long-stalked huperzine and wrinkled huperzine and its application. Background Technology
[0002] Molecular markers are DNA sequence features that reflect differences in genetic diversity among individuals or populations. They act like road signs in the genome, detectable through specific techniques to track genetic variations in chromosomes, genes, or genotypes. Simple sequence repeats (SSRs) work by detecting sequences in the genome composed of multiple tandem repeats of 1-6 nucleotides as core units. Variations in the number of repeats lead to fragment length polymorphism, which is detected by PCR amplification using specially designed primers on both sides. Chloroplast SSRs (cpSSRs), a type of SSR marker, are located in the chloroplast genome. They are maternally inherited, haplotype-specific, and highly conserved, but intraspecific variations also exist in certain regions.
[0003] Currently, the most common Humulus species in the market are *Humulus longipes* (large-leaved *Humulus scandens*) and *Humulus squarrosa* (small-leaved *Humulus scandens*). The content of huperzine A in *Humulus longipes* is more than 100 times higher than that in *Humulus squarrosa*, resulting in a significant difference in commercial and medicinal value. Lacking accurate identification methods, unscrupulous merchants often pass off *Humulus squarrosa* as *Humulus longipes*, sometimes even producing counterfeit products, causing economic losses and seriously endangering public health and safety. There is an urgent need to establish an efficient and accurate technical system and platform for identifying *Humulus longipes* and *Humulus squarrosa*. This would facilitate the identification of genuine and counterfeit *Humulus longipes*, species resource surveys, and molecular breeding research. Summary of the Invention
[0004] To address the problems existing in the prior art, the purpose of this invention is to design a molecular marker primer set for distinguishing between long-stalked hue and wrinkled hue, and to develop a technical solution for its application.
[0005] The present invention is implemented using the following technical solutions:
[0006] The first aspect of this invention provides a set of cpSSR primers for distinguishing between long-stalked huperzine and wrinkled-lipped huperzine, wherein the cpSSR marker primer set includes one or more of Hup3, Hup15, Hup22, or Hup26:
[0007] The upstream primer Hup3_F nucleotide sequence of Hup3 is shown in SEQ ID NO: 1, and the downstream primer Hup3_R nucleotide sequence is shown in SEQ ID NO: 2. Repeat unit: (A)10;
[0008] The upstream primer Hup15_F nucleotide sequence is shown in SEQ ID NO: 3, and the downstream primer Hup15_R nucleotide sequence is shown in SEQ ID NO: 4. Repeat unit: (T)8;
[0009] The upstream primer Hup22_F nucleotide sequence is shown in SEQ ID NO: 5, and the downstream primer Hup22_R nucleotide sequence is shown in SEQ ID NO: 6. The repeat unit is (AT,A)22.
[0010] The upstream primer Hup26_F nucleotide sequence is shown in SEQ ID NO: 7, and the downstream primer Hup26_R nucleotide sequence is shown in SEQ ID NO: 8. The repeat unit is (G)11.
[0011] A second aspect of the present invention provides a kit containing the above-described primer set.
[0012] A third aspect of the present invention provides a method for obtaining a cpSSR primer set for distinguishing between long-stalked huperzine and wrinkled huperzine, comprising the following steps:
[0013] (1) Genomic DNA was extracted from Huperzia longipes and Huperzia foldis for high-throughput Illumina sequencing. The chloroplast genome was assembled using GetOrganelle software, and its SSR loci were predicted using bioinformatics methods.
[0014] (2) Batch design and artificial synthesis of SSR primers;
[0015] (3) Extract total DNA from Huperzia longipes and Huperzia rubra, and perform PCR amplification;
[0016] (4) Polyacrylamide gel electrophoresis separation and fragment size detection were performed to screen polymorphic SSR markers and obtain cpSSR markers for the identification of long-stalked hue and wrinkled hue.
[0017] Furthermore, in the method described above, step (1) involves predicting SSR sites in the chloroplast genomes of *Huperzia longipes* and *Huperzia scabra*, with parameter settings including single to hexanucleotide repeats of 10, 6, 5, 5, 5, and 5 times, respectively.
[0018] Further, in the method described above, the PCR amplification reaction system in step (3) is 20 μL, containing 8.2 μL of ddH2O, 10 μL of 2×Taq PCR Master Mix, 1 μL of template DNA with a concentration of 60 ng / μL, and 0.4 μL each of upstream and downstream primers with a concentration of 10 μmol / L.
[0019] Further, in the method of obtaining the PCR amplification reaction program in step (3), the reaction is as follows: 95 °C pre-denaturation for 5 min, 95 °C denaturation for 30 s, 58 °C annealing for 30 s, 72 °C extension for 45 s, for 35 cycles, and finally 72 °C extension for 7 min, and then stored at 4 °C until taken out.
[0020] A fourth aspect of the present invention provides a method for identifying *Huperzia longipes* and *Huperzia rubra* using the primer set described in the first aspect, comprising the following steps:
[0021] R.1 Collect fresh huperzine samples from various regions and extract leaf DNA;
[0022] R.2 cpSSR amplification analysis was performed using the primer set described in the first aspect;
[0023] R.3 Identify long-stalked huperzine and wrinkled huperzine based on product size.
[0024] Further, the amplification reaction system in step R.2 is 20 μL, containing 8.2 μL of ddH2O, 10 μL of 2×Taq PCR Master Mix, 1 μL of template DNA at a concentration of 60 ng / μL, and 0.4 μL each of upstream and downstream primers at a concentration of 10 μmol / L.
[0025] Further, the product size described in step R.3 is determined using an 8% non-denaturing polyacrylamide gel electrophoresis assay; the identification includes the fact that the product of Huperzine longipes is smaller than that of Huperzine rubrum in the Hup3 or Hup15 amplification results, and the product of Huperzine longipes is larger than that of Huperzine rubrum in the Hup22 or Hup26 amplification results.
[0026] The present invention has the following beneficial effects:
[0027] Using this chloroplast SSR marker primer, the long-stalked huperzine (Large-leaved huperzine) and the wrinkled-edged huperzine (Small-leaved huperzine) can be accurately identified. This method has the advantages of simple operation, low cost, and high reproducibility, and can be widely used in the identification of genuine and counterfeit Chinese medicinal materials, species resource surveys, and molecular breeding research. Attached Figure Description
[0028] Figure 1 Polyacrylamide gel electrophoresis image of PCR amplification and screening of Huperzia longipes and Huperzia rubra using primers Hup3, Hup15, Hup22 and Hup26 (M-DL2000 marker; 1-Huperzia longipes; 2-Huperzia rubra).
[0029] Figure 2The image shows a polyacrylamide gel electrophoresis result of PCR amplification of Huperzine longipes and Huperzine rubra using Hup3 primers.
[0030] Figure 3 Polyacrylamide gel electrophoresis image of PCR amplification of Huperzine longipes and Huperzine rubra using Hup15 primers.
[0031] Figure 4 Polyacrylamide gel electrophoresis image of PCR amplification of Huperzia longipes and Huperzia rubiginata using Hup22 primers.
[0032] Figure 5 Polyacrylamide gel electrophoresis image of PCR amplification of Huperzine longipes and Huperzine rubra using Hup26 primers.
[0033] Figure 6 The figure shows the results of cluster analysis of 20 Huperzia longipes and Huperzia rubra using primers Hup3, Hup15, Hup22 and Hup26.
[0034] Figure 7 The peak diagram for amplification and sequencing of Huperzia longipes and Huperzia rubiginata using primer Hup3;
[0035] Figure 8 The sequence diagram shows the amplification and sequencing peaks of Huperzia longipes and Huperzia rubiginata using primer Hup15.
[0036] Figure 9 The sequence diagram shows the amplification and sequencing peaks of Huperzia longipes and Huperzia rubiginii using primer Hup22.
[0037] Figure 10 The image shows the peaks of Hup26 primers for amplification and sequencing of Huperzia longipes and Huperzia rubra. Detailed Implementation
[0038] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, unless otherwise specified, the following embodiments and features can be combined with each other. Unless otherwise specified, the methods used in the embodiments of the present invention are conventional methods, and the reagents used are commercially available.
[0039] Example 1: Development of cpSSR marker primers for Huperzia longipes and Huperzia rubra.
[0040] I. Materials
[0041] The two varieties of *Huperzia longipes* (large-leaved *Huperzia chinensis*) and *Huperzia scabra* (small-leaved *Huperzia chinensis*) that were planted in the germplasm resource nursery in Yuyao, Zhejiang Province, and were in good growth condition were selected.
[0042] II. Methods
[0043] 1) Select the leaf material for the test sample, cut it into small pieces with sterilized scissors, put it into a mortar, add liquid nitrogen and grind it;
[0044] 2) Extract total DNA from plant materials using the DNA extraction method of the High-Efficiency Plant Genomic DNA Extraction Kit (DP350);
[0045] 3) The concentration and quality of DNA were determined using a DeNovix DS-11 spectrophotometer;
[0046] 4) After passing the DNA testing, the DNA undergoes mechanical fragmentation, end repair, A-addition to the 3' ends, and ligation with sequencing adapters. Fragment size selection is performed to construct sequencing libraries with 300bp short inserts. The constructed libraries undergo quality control; those that pass are then used for paired-end (PE) sequencing on the Illumina NovaSeq 6000 platform, with read lengths of 150bp. Each sample generates approximately 10 GB of raw data.
[0047] 5) Chloroplast genome sequence assembly
[0048] The chloroplast genome was assembled using GetOrganelle (v1.7.6.1) software to obtain chloroplast circular DNA molecules. Then, Bandange (v 0.8.1) software was used to visualize the contigs and ligation pathways of the assembled chloroplast genome. The ligated sequences were validated for IR regions using CPStools software and compared and adjusted with a reference sequence to obtain the final complete sequence.
[0049] 6) SSR site search and primer design
[0050] Simple repeat sequence (SSR) analysis was performed on the sequences using MISA software. During the SSR site search, the parameters were set to 10, 6, 5, 5, 5, and 5 times for single to hexanucleotide repeats, respectively. SSRs of *Huperzia longipes* and *Huperzia rubra* were compared and analyzed, eliminating sites that were completely identical or differed by less than 3 bp. Primers containing SSR sites were designed in bulk using Primer 3 software, with annealing temperatures (Tm) of 57–61 ℃, primer lengths of 18–27 bp, a Tm difference of ≤ 2 ℃ between upstream and downstream primers, and an expected PCR product length of 100–300 bp. Primers with secondary structures, unreasonable GC content, or unreasonable base distribution were removed. Twenty-six pairs of SSR-labeled primers were selected and manufactured by Sangon Biotech (Shanghai) Co., Ltd.
[0051] 7) SSR primer screening
[0052] First, genomic DNA from two species (Huperzia longipes and Huperzia rubra) was used as the primary material, and 26 primer pairs were initially screened. The 20 μL PCR amplification system consisted of 8.2 μL ddH2O, 10 μL 2×Taq PCR Master Mix, 1 μL template DNA (60 ng / μL), and 0.4 μL each of forward and reverse primers (10 μmol / L). The PCR amplification program was: 95 °C pre-denaturation for 5 min, 95 °C denaturation for 30 sec, 58 °C annealing for 30 s, 72 °C extension for 45 s, for 35 cycles, followed by a final extension at 72 °C for 7 min, and then storage at 4 °C until detachment. Using 1×TBE as the electrophoresis buffer, 5 µL of PCR product was added to an 8% non-denaturing polyacrylamide gel for electrophoresis at 135 V for 120–140 min. After electrophoresis, the gel was removed and stained. The staining and developing solution was prepared as follows: 60 μL DNA dye, 20 mL 1M NaCl solution, and 180 mL H2O, for a total volume of 200 mL. The gel was placed in the developing solution and gently shaken on a shaker for 30 min until fully stained. The gel was then washed with ultrapure water and placed in a gel imaging system for development and imaging.
[0053] 8) cpSSR amplification analysis
[0054] DNA was extracted from Huperzia longipes and Huperzia rubra var. ...
[0055] Table 1 SSR primer labeling information
[0056]
[0057] Primer number: Hup3, the upstream primer sequence Hup3_F is GCCGGACCACAAACCAGAAT (SEQ ID NO: 1), the downstream primer sequence Hup3_R is GGCAATGGTGTCGTTACCCA (SEQ ID NO: 2), repeat unit: (A)10.
[0058] Primer number: Hup15, the labeled upstream primer sequence Hup15_F is GCAACGAGGTGGACTCTACC (SEQ ID NO: 3), the downstream primer sequence Hup15_R is TTAACCCACGGCGAATCCAA (SEQ ID NO: 4), repeat unit: (T)8.
[0059] Primer number: Hup22, the labeled upstream primer sequence Hup22_F is CCCCGATCTGAAGTATATCCCC (SEQ ID NO: 5), the downstream primer sequence Hup22_R is CACTGGCTCGGATTTCTCGA (SEQ ID NO: 6), repeat unit: (AT,A)22.
[0060] Primer number: Hup26, the labeled upstream primer sequence Hup26_F is TCTGGGGAGGTAAGAACACCA (SEQ ID NO: 7), the downstream primer sequence Hup26_R is GAGCCCGTATTTCAGCTCCA (SEQ ID NO: 8), repeat unit: (G)11.
[0061] The results of primer Hup3 amplification are shown in Figure 1 A and Figure 7 Characteristic bands were detected in *Huperzia longipes* and *Huperzia rubra* at 250 bp–500 bp, which is consistent with our predicted result of 270 bp. The nucleotide sequences of *Huperzia longipes* and *Huperzia rubra* are shown in SEQ ID NO: 9–10.
[0062] The results of primer Hup15 amplification are shown in Figure 1 B and Figure 8 Characteristic bands were detected in *Huperzia longipes* and *Huperzia rubra* in the 100-250 bp range, which is consistent with our predicted result of 210 bp. The nucleotide sequences of *Huperzia longipes* and *Huperzia rubra* are shown in SEQ ID NO: 11-12.
[0063] The results of primer Hup22 amplification are shown in Figure 1 C and Figure 9Characteristic bands were detected in *Huperzia longipes* and *Huperzia rubra* in the 100-250 bp range, which is consistent with our predicted result of 236 bp. The nucleotide sequences of *Huperzia longipes* and *Huperzia rubra* are shown in SEQ ID NO: 13-14.
[0064] The results of primer Hup26 amplification are shown in Figure 1 D and Figure 10 Characteristic bands were detected in *Huperzia longipes* and *Huperzia rubra* at 250 bp–500 bp, which is consistent with our predicted result of 267 bp. The nucleotide sequences of *Huperzia longipes* and *Huperzia rubra* are shown in SEQ ID NO: 15-16.
[0065] Based on the combined results of cpSSR molecular marker analysis, primers Hup3, Hup15, Hup22, and Hup26 can significantly identify *Huperzia rubra* and *Huperzia longipes*.
[0066] Example 2:
[0067] I. Materials
[0068] Sequencing materials were collected from samples across China, including 20 samples of the genus *Humulus* from germplasm resource banks in Zhejiang, Yunnan, and Guizhou provinces (Table 2). These samples were preserved in the university's germplasm resource nursery, with fresh materials frozen in liquid nitrogen and then stored at -80°C. DNA was extracted from their leaves.
[0069] Table 2 Sample Information
[0070]
[0071] II. Methods
[0072] 1) SSR primer detection
[0073] Based on the gel results, primers with differences were selected, and 10 pairs of long-stalked hue and wrinkled hue were used for control experiments, following the methods described above.
[0074] Twenty-six primer pairs were initially screened for polymorphic SSR markers using DNA templates from two *Humulus* species. Preliminary screening results showed that four primer pairs successfully amplified clear bands with good reproducibility, achieving a success rate of 15%. These four primer pairs were then used to amplify PCR from 20 *Humulus* DNA samples. The products were detected using 8% non-denaturing polyacrylamide gel electrophoresis. All four primer pairs amplified clear bands. (The non-denaturing polyacrylamide gel electrophoresis images of the primers are shown below.) Figures 2-5 ).
[0075] Ultimately, a set of microsatellite molecular marker primers for the chloroplast sequences of Huperzia longipes and Huperzia rubra were obtained, including primers Hup3, Hup15, Hup22 and Hup26.
[0076] 2) cpSSR amplification analysis
[0077] DNA was extracted from Huperzia longipes and Huperzia rubra var. ...
[0078] Primer number: Hup3, the upstream primer sequence Hup3_F is GCCGGACCACAAACCAGAAT (SEQ ID NO: 1), the downstream primer sequence Hup3__R is GGCAATGGTGTCGTTACCCA (SEQ ID NO: 2), repeat unit: (A)10.
[0079] Primer number: Hup15, the labeled upstream primer sequence Hup15_F is GCAACGAGGTGGACTCTACC (SEQ ID NO: 3), the downstream primer sequence Hup15__R is TTAACCCACGGCGAATCCAA (SEQ ID NO: 4), repeat unit: (T)8.
[0080] Primer number: Hup22, the labeled upstream primer sequence Hup22_F is CCCCGATCTGAAGTATATCCCC (SEQ ID NO: 5), the downstream primer sequence Hup22__R is CACTGGCTCGGATTTCTCGA (SEQ ID NO: 6), repeat unit: (AT,A)22.
[0081] Primer number: Hup26, the labeled upstream primer sequence Hup26_F is TCTGGGGAGGTAAGAACACCA (SEQ ID NO: 7), the downstream primer sequence Hup26__R is GAGCCCGTATTTCAGCTCCA (SEQ ID NO: 8), repeat unit: (G)11.
[0082] The results of primer Hup3 amplification are shown in Figure 2 It can be observed that the products of long-stalked hue are smaller than those of wrinkled hue, which can significantly distinguish wrinkled hue and long-stalked hue from all over the country, and there are also subtle differences between hues of the same species from different geographical locations.
[0083] The results of primer Hup15 amplification are shown in Figure 3 It can be observed that the products of long-stalked hue are smaller than those of wrinkled hue, which can significantly distinguish wrinkled hue and long-stalked hue from all over the country, and there are also subtle differences between hues of the same species from different geographical locations.
[0084] The results of primer Hup22 amplification are shown in Figure 4 It can be observed that the products of long-stalked hue are larger than those of wrinkled hue, which can significantly distinguish wrinkled hue and long-stalked hue from all over the country, and there are also subtle differences between hues of the same species from different geographical locations.
[0085] The results of primer Hup26 amplification are shown in Figure 5 It can be observed that the products of long-stalked hue are larger than those of wrinkled hue, which can significantly distinguish wrinkled hue and long-stalked hue from all over the country, and there are also subtle differences between hues of the same species from different geographical locations.
[0086] In summary, based on the chloroplast genome screening of the genus *Huperzia*, four pairs of cpSSRs were obtained, which can effectively distinguish between *Huperzia latifolia* and *Huperzia longipes*, and a cluster diagram of 20 *Huperzia* samples was generated. Figure 6 Therefore, the molecular marker method designed and developed in this study has the advantages of high efficiency and wide adaptability, and can provide strong technical support for the identification of Humulus species and market regulation.
Claims
1. A cpSSR primer set for differentiating between long-stalked huperzine and wrinkled-lipped huperzine, characterized in that, The cpSSR primer set includes one or more of Hup3, Hup15, or Hup26: The upstream primer Hup3_F nucleotide sequence of Hup3 is shown in SEQ ID NO: 1, and the downstream primer Hup3_R nucleotide sequence is shown in SEQ ID NO:
2. Repeat unit: (A)10; The upstream primer Hup15_F nucleotide sequence is shown in SEQ ID NO: 3, and the downstream primer Hup15_R nucleotide sequence is shown in SEQ ID NO:
4. Repeat unit: (T)8; The upstream primer Hup26_F nucleotide sequence is shown in SEQ ID NO: 7, and the downstream primer Hup26_R nucleotide sequence is shown in SEQ ID NO:
8. The repeat unit is (G)11.
2. A kit containing the primer set as described in claim 1.
3. The application of the primer set as described in claim 1 or the kit as described in claim 2 in the identification of long-stalked huperzine and wrinkled huperzine.
4. A method for identifying *Huperzia longipes* and *Huperzia rubra* using the primer set described in claim 1, characterized in that, Includes the following steps: R.1 Collect fresh huperzine samples from various regions and extract leaf DNA; R.2 cpSSR amplification analysis was performed using the primer set described in claim 1; R.3 Identify long-stalked huperzine and wrinkled huperzine based on product size.
5. The method as described in claim 4, characterized in that, The amplification reaction system described in step R.2 is 20 μL, containing 8.2 μL of ddH2O, 10 μL of 2×Taq PCR Master Mix, 1 μL of template DNA at a concentration of 60 ng / μL, and 0.4 μL each of forward and reverse primers at a concentration of 10 μmol / L.
6. The method as described in claim 4, characterized in that, The product size described in step R.3 was determined using an 8% non-denaturing polyacrylamide gel electrophoresis assay; the identification included that the product of Huperzine longipes was smaller than that of Huperzine rubrum in the Hup3 or Hup15 amplification results, and that the product of Huperzine longipes was larger than that of Huperzine rubrum in the Hup26 amplification results.