Application of NRGN gene in preparation of medicine for treating chronic visceral pain
By inhibiting NRGN gene expression in CaMKIIα-positive neurons of layer V of the insular cortex using shRNA targeting NRGN and AAV-CaMKIIα viral vector, the problem of lacking precise analgesia strategies in existing technologies has been solved, achieving effective treatment of chronic visceral pain in IBS and avoiding central side effects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SUZHOU UNIV
- Filing Date
- 2025-12-18
- Publication Date
- 2026-04-21
AI Technical Summary
Current technologies lack precise analgesic strategies targeting central nervous system targets. Existing drugs have difficulty penetrating the blood-brain barrier and are prone to causing central nervous system side effects. The molecular regulatory network of CaMKIIα-positive neurons in the V layer of the insular cortex in chronic visceral pain has not been elucidated, resulting in poor treatment efficacy for IBS chronic visceral pain.
By using shRNA targeting NRGN and AAV-CaMKIIα viral vector, central targeted intervention is achieved by inhibiting the expression of the NRGN gene in CaMKIIα-positive neurons of the V layer of the insular cortex, combined with stereotactic injection.
It raises the pain threshold, provides sustained analgesia, fills a gap in pain mechanisms, reveals the core regulatory role of NRGN in chronic visceral pain, and avoids central side effects.
Smart Images

Figure CN121891394A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of neuropharmacology, and in particular to the application of the NRGN gene in the preparation of drugs for treating chronic visceral pain. Background Technology
[0002] Irritable bowel syndrome (IBS), a typical example of functional gastrointestinal disorders, is characterized by chronic visceral pain and has become a significant challenge in global public health. Epidemiological data shows that the global prevalence of IBS exceeds 11.2%, with over 100 million patients in my country and annual direct medical expenditures reaching 32 billion yuan. IBS is clinically characterized by the persistent coexistence of abdominal pain, bloating, and bowel irregularities. Despite the lack of organic pathological changes, it leads to a significant decline in patients' quality of life. Current clinical treatment relies on non-specific drugs such as antispasmodics (e.g., pinaverium bromide) and tricyclic antidepressants (e.g., amitriptyline), but the symptom relief rate is less than 35%. This is closely related to the incomplete understanding of its pathological mechanisms, especially the key molecular targets of central nervous system regulation of visceral pain abnormalities, which urgently need to be elucidated.
[0003] In recent years, research has focused on the bidirectional regulatory network of the "brain-gut axis," a system that integrates the dynamic interactions between the central nervous system and the enteric nervous system through the vagus nerve, the hypothalamus-pituitary-adrenal axis, and immune pathways. Advances in research on central regulatory mechanisms indicate that chronic stress (such as occupational stress and emotional trauma) can induce visceral hypersensitivity through a cascade of stress-brain remodeling-pain sensitization. The insular cortex (IC), as a higher-level integrator of visceral sensory information, shows that functional abnormalities are closely related to pain sensitization in IBS patients. At the cellular architecture level, the IC brain region can be divided into six layers (layers I-VI), with neurons in each layer exhibiting clear functional differentiation. c-Fos immunohistochemistry revealed that CRD stimulation in the IC brain region of HeCS model mice mainly occurred in layer V, primarily in CaMKIIα-positive neurons, which were significantly correlated with the severity of visceral pain behavior. However, the following gaps remain in the current research on specific molecular targets in the IC brain region: (1) Mechanism level: The molecular regulatory network of CaMKIIα positive neurons in the V layer of the insular cortex in chronic visceral pain has not yet been elucidated; (2) Intervention level: There is a lack of precise analgesic strategies targeting central targets, and existing drugs are difficult to penetrate the blood-brain barrier and are prone to causing central side effects.
[0004] The neurogranin (NRGN) gene encodes a highly conserved calmodulin-binding protein that regulates calcium ion concentration (Ca). 2+The dynamic balance of the α / calmodulin (CaM) signaling axis plays a crucial role in the regulation of synaptic plasticity, long-term potentiation (LTP), and neuronal excitability. Previous research has primarily focused on its pathological significance in central degenerative diseases; however, research on NRGN in pain modulation has long been lacking. Developing novel targeted drugs that can effectively penetrate the blood-brain barrier and avoid central side effects, thereby achieving precise treatment of chronic visceral pain in IBS, has become a critical challenge that urgently needs to be addressed in this field. Summary of the Invention
[0005] Objective: To overcome the shortcomings of the existing technology, this invention provides the application of the NRGN gene in the preparation of drugs for treating chronic visceral pain, by inhibiting the expression of the NRGN gene in CaMKIIα positive neurons of the V layer of the insular cortex to treat chronic visceral pain.
[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:
[0007] In a first aspect, the present invention provides the application of the NRGN gene in the preparation of drugs for treating chronic visceral pain.
[0008] Furthermore, the pain includes chronic visceral pain caused by functional gastrointestinal disorders.
[0009] Furthermore, the pain includes chronic visceral pain caused by irritable bowel syndrome.
[0010] Secondly, the present invention provides a drug for treating chronic visceral pain, wherein the drug treats chronic visceral pain by inhibiting the expression of the NRGN gene in CaMKIIα-positive neurons of the V layer of the insular cortex.
[0011] Furthermore, the drug comprises an shRNA that targets NRGN; the sequence of the shRNA in the 5' to 3' direction is shown in SEQ ID No. 1.
[0012] SEQ ID No.1 TCCAAGCCAGACGACGATATT
[0013] Furthermore, the drug also includes the viral vector AAV-CaMKIIα; wherein AAV-CaMKIIα is an adeno-associated virus vector carrying the CaMKIIα promoter and having a serotype of AAV2 / 9.
[0014] Preferably, the titer of AAV-CaMKIIα is ≥1×10⁻⁶. 13 GC / mL.
[0015] In some embodiments, the drug may further include pharmaceutically acceptable additives or excipients.
[0016] In some embodiments, the drug is an injectable preparation, and the injection site is the V layer of the insular cortex.
[0017] In some embodiments, the injection coordinates for the chronic visceral pain model mice are: 0.4 mm posterior to the anterior fontanelle, ±3.85 mm lateral to the midline, and 3.8 mm deep; the injection depth correction value DV = -3.85 mm is used to accurately reach the central area of the V layer of the insular cortex.
[0018] Beneficial effects: The application of the NRGN gene provided by this invention in the preparation of drugs for treating chronic visceral pain expands the biological functional spectrum of NRGN and reveals the core regulatory role of the central calcium signaling network in chronic visceral pain, providing a new theoretical basis for developing central precision analgesia strategies based on NRGN targets; this invention reveals for the first time the negative correlation between the specific upregulation of NRGN in CaMKIIα-positive neurons of layer V of the insular cortex and chronic visceral pain, filling a gap in the pain mechanism; this invention achieves central targeted intervention by restricting shRNA expression in excitatory neurons through the CaMKIIα promoter and combining it with stereotactic injection; the drug provided by this invention increases the pain threshold and has a long duration of effect. Attached Figure Description
[0019] In the attached figure, *P<0.05, **P<0.01, ***P<0.001.
[0020] Figure 1 This diagram illustrates the experimental method and results for verifying the association between NRGN gene expression and visceral pain behavior in an embodiment of the present invention. Figure 1 A diagram in the middle shows the method for establishing a mouse model of chronic heterologous stress (HeCS). Figure 1 B represents the visceral pain threshold of CON mice and HeCS mice during the HeCS modeling process (weeks 1 to 4) and after modeling is completed, with n = 8 mice per group. Figure 1 The diagram in C is a timeline diagram of the process of inducing pain through colorectal dilation in mice and performing c-Fos immunofluorescence staining. Figure 1 The image in Figure D shows representative images of c-Fos immunofluorescence staining in the IC brain region of CON mice and HeCS mice after colorectal dilation, as well as statistical graphs of the number of c-Fos positive signals, heatmaps, and percentage changes in c-Fos expression in each layer of the insular cortex. n = 3 mice per group. Figure 1 Image E shows the colocalization of c-Fos and CaMKIIα in the V layer of the insular cortex of HeCS mice and their percentage distribution, n = 3 mice.
[0021] Figure 2 This is a schematic diagram and result diagram of the optogenetic intervention experimental method in an embodiment of the present invention. Figure 2A in the diagram represents the site of optogenetic activation or inhibition of the virus injection in the V layer of the insular cortex and the location of the core implantation. Figure 2 Image B in the image represents the optogenetic expression of viruses in the V layer of the insular cortex. Figure 2 The graph in C is a statistical diagram showing the changes in visceral pain threshold after optogenetic activation of CaMKIIα neurons in the V layer of the insular cortex of CON mice, n = 6 mice. Figure 2 The graph in D is a statistical diagram showing the changes in visceral pain threshold after optogenetic inhibition of CaMKIIα neurons in the V layer of the insular cortex of HeCS mice, n = 6 mice.
[0022] Figure 3 This is a diagram showing the single-cell RNA sequencing results in an embodiment of the present invention. Figure 3 The diagram in Figure A shows the process of constructing a HeCS model in mice, and then collecting brain tissue from the V layer of the insular cortex of CON mice and HeCS mice and performing single-cell sequencing after the model was constructed. Figure 3 The image in Figure B shows the results of artificial grouping of neurons after sequencing single cells from the V layer of the insular cortex of CON mice and HeCS mice, and the grouping of all neurons into excitatory neurons and inhibitory neurons. Figure 3 C represents a volcano diagram showing the changes in excitatory neuronal genes in the V layer of the insular cortex of HeCS mice compared to CON mice. Figure 3 D is a heatmap showing the statistical changes in the genes of excitatory neurons in the V layer of the insular cortex of HeCS mice compared to CON mice, where n = 3 mice per group.
[0023] Figure 4 This figure shows the experimental results of qPCR and Western blotting verification of differentially upregulated genes in excitatory neurons of the V layer of the insular cortex of mice in the CON group and the HeCS group, as described in this embodiment of the invention. Figure 4 Figure A shows the results of the qPCR validation experiment, where n = 3 mice per group. Figure 4 Figure B shows the results of the Western blotting verification experiment of the gene NRGN, which was significantly upregulated in the V layer of the insular cortex of HeCS mice. n = 6 mice in each group. Figure 4 The graph in C is a Western blotting validation experiment showing that the gene NRGN was significantly upregulated in the V layer of the insular cortex of HeCS mice. n = 6 mice per group.
[0024] Figure 5 The figure shows the experimental results of the construction and verification of NRGN-targeting shRNA and the evaluation of its analgesic effect in this embodiment of the invention. Figure 5 In diagram A, the injection site of shRNA targeting NRGN in excitatory neurons of layer V of the insular cortex of HeCS group mice is shown. Figure 5Image B shows a representative image of shRNA expression of NRGN in excitatory neurons of layer V of the insular cortex of HeCS group mice. Figure 5 The middle C figure shows the results of visceral pain threshold detection in mice injected with shRNA targeting NRGN, where n = 10 mice per group.
[0025] Figure 6 This is a graph showing the duration of analgesic effect of shRNA targeting NRGN in an embodiment of the present invention. Figure 6 Figure A shows the duration of analgesic effect of shRNA in excitatory neurons of NRGN in the V layer of the insular cortex of mice targeted to HeCS, n = 6 mice per group. Detailed Implementation
[0026] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. The following description of at least one exemplary embodiment is merely illustrative and is in no way intended to limit the present invention or its application or use.
[0027] Unless otherwise specifically stated, the relative arrangement, numerical expressions, and values of the components and steps set forth in these embodiments do not limit the scope of the invention. It should also be understood that, for ease of description, the dimensions of the various parts shown in the drawings are not drawn to actual scale. Techniques, methods, and devices known to those skilled in the art may not be discussed in detail, but where appropriate, such techniques, methods, and devices should be considered part of the specification. In all examples shown and discussed herein, any specific values should be interpreted as merely exemplary and not as limitations. Therefore, other examples of exemplary embodiments may include different values. It should be noted that similar reference numerals and letters in the following figures denote similar items; therefore, once an item is defined in one figure, it need not be further discussed in subsequent figures.
[0028] The present invention will be further described below with reference to the embodiments.
[0029] In the following examples, AAV viruses were purchased from Wuhan Shumi Brain Science Technology Co., Ltd., and shRNA viruses were purchased from Guangzhou Paizhen Biotechnology Co., Ltd.
[0030] Example 1: Validation of the association between NRGN gene expression and visceral pain behavior
[0031] 1. Construction of animal models
[0032] Animals: Male C57BL / 6 mice (6-8 weeks old, weighing 22±2 g).
[0033] Methods for establishing a mouse model of chronic heterologous stress (HeCS): such as Figure 1 As shown in Figure A, a model was established using 6-8 week old male C57BL6 / J mice. Sixteen mice were randomly divided into two groups: HeCS and CON, with eight mice in each group. Before the model was established, visceral pain threshold was measured and serum was collected from both groups to establish a baseline (BL).
[0034] Eight mice in the HeCS group underwent HeCS modeling. Each mouse was randomly subjected to one type of stress daily for a total of 4 weeks. The stresses included 20 minutes of cold restraint, 15 minutes of forced swimming, and 4 hours of humid environment.
[0035] The CON group mice were not treated.
[0036] During the modeling period, the visceral pain threshold of mice in the CON and HeCS groups was measured weekly. In addition, the visceral pain threshold of both groups of mice was continuously monitored for 10 weeks after the modeling ended.
[0037] like Figure 1 As shown in Figure B, the visceral pain threshold of mice in the HeCS group decreased compared to that in the CON group during a 4-week period of stress.
[0038] 2. c-Fos immunofluorescence staining
[0039] like Figure 1 As shown in Figure C, c-Fos immunofluorescence staining was performed on samples taken from mice subjected to chronic heterologous stress (HeCS).
[0040] Stimulation: After modeling, mice underwent colorectal dilation (CRD; pressure 60 mmHg; 20 seconds each time, 5 minutes apart, for a total of 5 times).
[0041] Sampling: 90 minutes after CRD stimulation, the brain was perfused and harvested to prepare coronal sections (30 μm thick). Staining: The primary antibody was rabbit anti-c-Fos (1:500) + mouse anti-CaMKIIα (1:500), incubated at 4℃ for 24 hours; the secondary antibody was Alexa Fluor 488 labeled goat anti-rabbit (1:500) + Cy3 labeled goat anti-mouse (1:500), incubated at room temperature for 2 hours.
[0042] Confocal microscopy counting: stratified statistical analysis of c-Fos positive signals activated in the insular cortex.
[0043] like Figure 1 As shown in Figure D, after colorectal dilation, neurons in the CON group and HeCS group mice responding to CRD stimulation were mainly located in layer V of the insular cortex. Figure 1As shown in Figure E, the neurons in the V layer of the insular cortex labeled by CRD stimulation are mainly excitatory neurons, with a co-labeling rate of 94.07%.
[0044] 3. Validation of optogenetic intervention
[0045] AAV2 / 9-CaMKIIα-ChR2 (photoactivated) or AAV2 / 9-CaMKIIα-NpHR 3.0 (photoinhibitory) was stereotactically injected into the V layer of the insular cortex of 6 CON group and 6 HeCS group mice. The injection sites are as follows: Figure 2 As shown in Figure A, the ceramic insert was implanted into the mouse at the following locations: 0.4 mm posterior to the anterior fontanelle, ±3.85 mm lateral to the midline, and 3.75 mm deep. The light modulation parameters were: blue light (473 nm, 3 mW, 20-ms pulses, 10 Hz frequency light) or yellow light (589 nm, 5 mW, continuous light).
[0046] like Figure 2 As shown in C and D, by optogenetic regulation of the excitability of CaMKIIα neurons in the V layer of the insular cortex, the inhibition of CaMKIIα neurons in the V layer of the insular cortex of HeCS mice significantly increased the visceral pain threshold, thus alleviating visceral pain in mice; while activating CaMKIIα neurons in the V layer of the insular cortex of CON group mice significantly decreased the visceral pain threshold, thus inducing visceral pain behavior in mice.
[0047] 4. Single-cell RNA sequencing (snRNA-seq)
[0048] Sampling: The V layer of the insular cortex of mice in the HeCS and CON groups was microscopically dissected.
[0049] Library construction: Single-cell capture was performed using the DNBelab C microfluidic platform. Cells were co-encapsulated with barcoded gel beads and indexing carriers using a Y-shaped droplet system. After reverse transcription was completed within the droplets, cDNA libraries were constructed by PCR amplification.
[0050] Sequencing depth: 50,000 reads / cell (median depth); Differential gene criteria: |log2FC| ≥ 0.36, p ≤ 0.01.
[0051] like Figure 3 As shown in sections A to C, the main processes include: (1) Sample preparation and quality control: Prepare single-cell suspensions, detect activity (≥90%) by trypan blue staining, and cell concentration ≥1,000 cells / μL; (2) Single-cell capture and library construction: Use the DNBelab C microfluidic platform for droplet encapsulation, and complete reverse transcription and cDNA amplification; (3) Sequencing: Perform paired-end 150bp sequencing on the DNBSEQ-T7RS platform; (4) Bioinformatics analysis: Data quality control and genome alignment (STAR, reference genome GRCm38); Cell screening (EmptyDrops filtering, retaining cells with UMI counts exceeding the threshold); Data standardization and batch correction (logarithmic transformation + Harmony integration); Cell clustering (Seurat Louvain algorithm, PCA dimensionality reduction followed by t-SNE visualization); Differential gene and functional analysis (Wilcoxon rank-sum test + hypergeometric test enrichment analysis).
[0052] like Figure 3 As shown in Figure D, compared with the CON group mice, the expression of neurogranin (NRGN), which is related to synaptic plasticity, was significantly upregulated in the excitatory neurons of the V layer of the insular cortex of the HeCS group mice.
[0053] 5. qPCR and Western blotting were used to verify the differentially upregulated genes in excitatory neurons of the V layer of the insular cortex of mice in the CON and HeCS groups.
[0054] qPCR validation was performed using the SYBR Green method; primers are shown in Table 1.
[0055] Table 1 Primers used for qPCR validation Gene Primers Sequences (5'-3') Mdh2 Forward CAAAGAGACGGAATGCACTTAC Mdh2 Reverse CTTTCTTGATGGAGGCTTTCAG Nefl Forward CGGTCTCCTCCTCGCTGTCC Nefl Reverse GTCGTTGCTGATGGCGGCTAC Tuba1b Forward AAGGTTGGCATTAATTACCAGC Tuba1b Reverse ATCAAACTTGTGATCTAGGCGA Timp2 Forward GTTCAAAGGACCTGACAAAGAC Timp2 Reverse TCTTCTTCTGGGTGATGCTAAG Atp6v1a Forward AAAGACTGTGATTTCCCAGTCT Atp6v1a Reverse GGAGAACTTCTGACATCTCGTT Hspa5 Forward ATGATGAAGTTCACTGTGGTGG Hspa5 Reverse CTGATCGTTGGCTATGATCTCC Dynll2 Forward AGGACATTGCTGCCTATATCAA Dynll2 Reverse TAGATGAAGTGCTTTGTCTCGT Camk2n1 Forward CAGGACACCAACAACTTCTTC Camk2n1 Reverse AGCACGTCATCAATCCTATCAT Lars2 Forward TCACCCGATGGCACAGAGAGAC Lars2 Reverse TCCGAGTCAGGGCTACAAAGGC Calm1 Forward ACAAGGATGGGAATGGTTACAT Calm1 Reverse TGCAGTCATCATCTGTACGAAT Actb Forward CTACCTCATGAAGATCCTGACC Actb Reverse CACAGCTTCTCTTTGATGTCAC Nrgn Forward CCAGACGACGATATTCTTGACA Nrgn Reverse CACTCTCCGCTCTTTATCTTCT Tafa1 Forward AACACACCTTCCAGCAGCATCAC Tafa1 Reverse CCCAGCCACTTTCCCAGGTAAAC GAPDH Forward GGTTGTCTCCTGCGACTTCA GAPDH Reverse TGGTCCAGGGTTTCTTACTCC
[0056] Program: 95℃ 30 s → (95℃ 5 s + 60℃ 30 s) × 40 cycles.
[0057] like Figure 4 As shown in Figure A, the NRGN mRNA level in the V layer of the insular cortex of HeCS group mice was significantly higher than that of CON group mice. p < 0.001).
[0058] The antibodies used in Western blotting validation were rabbit anti-NRGN (1:1000) and mouse anti-GAPDH (1:5000).
[0059] like Figure 4 As shown in Figures B and C, the expression level of NRGN protein increased from 1.000 ± 0.05234 in the control group to 1.600 ± 0.08763 (gray values normalized to GAPDH). p< 0.001).
[0060] Example 2: Construction of shRNA targeting NRGN
[0061] 1. Design and viral packaging of shRNAs targeting NRGN
[0062] Target sequence: 5'-TCCAAGCCAGACGACGATATT-3' (BLAST verified to be free of off-target effects); Viral vectors: AAV2 / 9-CaMKIIα-NRGN shRNA (NRGN shRNA group), AAV2 / 9-CaMKIIα-scramble shRNA (scramble control group); Packaging parameters: 293T cell transfection (PEI method); Ultracentrifugation purification, titer 1×10⁻⁶ 13 GC / mL (qPCR quantification).
[0063] 2. Stereoscopic injection
[0064] Animals: Twenty male C57BL / 6 mice (6-8 weeks old, weighing 22±2 g) were randomly divided into two groups: the NRGN shRNA group and the scramble control group, with 10 mice in each group.
[0065] Anesthesia: 1.5% isoflurane inhalation anesthesia; Positioning device: Mouse brain stereotaxic instrument; Stereoscopic injection: such as Figure 5 As shown in Figure A, shRNA or scramble targeting NRGN was injected into the V layer of the mouse insular cortex (AP: -0.4 mm, ML: ± 3.85 mm, DV: -3.85 mm) using a glass microneedle (tip diameter 20 μm) at a rate of 30 nL / min; 150 nL was injected unilaterally into each mouse; the needle was left in place for 10 minutes after injection to prevent backflow.
[0066] Example 3: Evaluation of the analgesic effect of shRNA targeting NRGN
[0067] All virus-injected mice were subjected to a four-week stress stress period (as described in Example 1), and visceral pain thresholds were measured four weeks later. In this example, colorectal dilatation threshold (CRDT) was measured in mice.
[0068] 1. Behavioral testing (colorectal dilatation threshold, CRDT)
[0069] process:
[0070] Animal adaptation: Before the experiment began, the mice were placed in the testing device for three consecutive days for adaptation training to reduce the interference of environmental stress on behavioral outcomes.
[0071] Preoperative preparation: Mice were fasted for 12 hours before the formal test. During the test, the animals were lightly anesthetized with isoflurane and placed in an independent transparent observation chamber.
[0072] Balloon insertion: A homemade elastic CRD balloon (approximately 2 cm long and 1.8 mm in diameter) is gently inserted into the colon and rectum through the anus after being lubricated with sterile paraffin oil. The insertion depth is 1 cm proximal to the anal margin.
[0073] Equipment connection: The balloon is connected to a high-precision pressure sensor and a controllable inflation system via a polyethylene infusion tubing to ensure the stability of pressure control and transmission.
[0074] Adaptation and Testing: Testing began 30 minutes after the animals had adapted to the chamber. Pressure was increased in 5 mmHg increments (each increment held for 5 seconds) until a clear visceral motor reflex was observed.
[0075] Threshold determination: The colorectal distension threshold (CRDT) is defined as the lowest distension pressure that reliably elicits a visceral motor reflex (manifested as a violent contraction of the abdominal muscles). Each mouse was measured five times, with a three-minute interval between each measurement. The final threshold was the average of the five measurements.
[0076] Blinding principle: All behavioral observations and records are conducted under blinding to avoid subjective bias.
[0077] Core equipment: CRD balloon, inflation tubing, pressure sensor and automatic pressure control / recording system.
[0078] Key parameters: The pressure increment is 5 mmHg / step, and the threshold criterion is the minimum stable pressure that induces visceral motor reflex (VMR).
[0079] like Figure 5 As shown in Figure C, shRNA targeting NRGN significantly knocked down NRGN expression levels in the V layer of the insular cortex, resulting in a significant increase in CRDT levels (28.56 ± 0.7010) in the NRGN shRNA group mice compared to the scramble control group (15.44 ± 0.7687). p < 0.001).
[0080] 2. Timeliness Verification
[0081] CRDT values of mice were measured on days 1, 3, 7, and 14 after injection of shRNA targeting NRGN, using the methods described above (1. Behavioral testing).
[0082] like Figure 6 As shown, the analgesic effect lasted for ≥14 days after a single dose.
[0083] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. Application of NRGN gene in the preparation of drugs for treating chronic visceral pain.
2. The application according to claim 1, characterized in that, The pain includes chronic visceral pain caused by functional gastrointestinal disorders.
3. The application according to claim 2, characterized in that, The pain includes chronic visceral pain caused by irritable bowel syndrome.
4. A drug for treating chronic visceral pain, characterized in that, The drug treats chronic visceral pain by inhibiting the expression of the NRGN gene in CaMKIIα-positive neurons of the V layer of the insular cortex.
5. The application according to claim 4, characterized in that, The drug comprises an shRNA that targets and knocks down NRGN gene expression; the sequence of the shRNA in the 5' to 3' direction is shown in SEQ ID No.
1.
6. The application according to claim 5, characterized in that, The drug also includes the viral vector AAV-CaMKIIα; AAV-CaMKIIα is an adeno-associated virus vector carrying the CaMKIIα promoter and having a serotype of AAV2 / 9.
7. The drug according to claim 6, characterized in that, The titer of AAV-CaMKIIα is ≥1×10⁻⁶. 13 GC / mL.
8. The drug according to claim 6, characterized in that, The drug also includes pharmaceutically acceptable additives or excipients.
9. The drug according to claim 6, characterized in that, The drug is an injectable preparation, and the administration area is the V layer of the insular cortex.