Pharmaceutical composition for inducing gonad exhaustion of paralichthys olivaceus and application of pharmaceutical composition

Abstract

The invention belongs to the technical field of biology, and particularly relates to a pharmaceutical composition for inducing gonad exhaustion of paralichthys olivaceus and application of the pharmaceutical composition. The pharmaceutical composition comprises docetaxel and cis-platinum, the mass ratio of docetaxel to cis-platinum is 1: 1, and the total concentration of docetaxel and cis-platinum is 100-200 mu g / mL. By optimizing the medicine proportion and the administration scheme, the problems of low survival rate and large injury of fish bodies in the existing gonad exhaustion method are solved, and efficient and stable preparation of the paralichthys olivaceus germline stem cell transplantation receptor can be realized. By controlling the ratio of docetaxel to cis-platinum, the administration concentration, the injection frequency, the action period and the like, the invention aims to solve the problems of insufficient exhaustion effect, low fish survival rate or serious gonad injury and the like in the existing receptor preparation, and provides reliable technical support for establishing a stable and efficient paralichthys olivaceus germline stem cell transplantation receptor system.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a pharmaceutical composition for inducing gonadal depletion in turbot and its application. Background Technology

[0002] To protect and sustainably utilize the germplasm resources of the important marine economic fish, the turbot (Paralichthys olivaceus), in addition to traditional breeding and ecological aquaculture, reproductive stem cell transplantation technology has become a core biotechnology for achieving genetic improvement of turbot, accelerating the breeding of superior varieties, and preserving excellent genes. It undertakes the important mission of shortening the breeding cycle, directional integration of superior traits, and improving the efficiency of the aquaculture industry.

[0003] In the practice of turbot reproductive stem cell transplantation, the preparation of high-quality sterile recipients is a crucial prerequisite for successful transplantation and the colonization, differentiation, and gamete production of exogenous germ cells. Currently, commonly used methods for preparing fish sterile recipients mainly rely on physical radiation or chemical treatment of the gonads. However, these methods generally suffer from unstable treatment effects, significant impacts on fish survival and health, incomplete gonad depletion, or severe tissue damage, thus limiting the practical application efficiency and reproducibility of reproductive stem cell transplantation technology.

[0004] Currently, there are several methods for preparing adult fish recipients: (1) Triploid method, disadvantage: endogenous germ cells are present, and the endogenous germ cells need to be depleted before transplantation; (2) Reproductive gene knockout / knockdown method, which needs to be carried out during the embryonic period, and it takes a long time to reach sexual maturity, facing risks such as disease and intolerance caused by changes in the breeding environment; (3) Hybrid sterility method: not all fish are sterile after hybridization, and it takes a long time for hybridization to reach sexual maturity, and it cannot be obtained at any time; (4) Chemotherapy drugs are usually combined with high temperature. At extreme temperatures, fish are intolerant, and the bacterial content increases, thereby increasing the risk of fish death. Among them, busulfan is a commonly used gonad depletion drug, but its effect is unstable and has large side effects, resulting in a high mortality rate of recipient fish.

[0005] In summary, there is an urgent need to develop a specific method for preparing infertile recipients that is tailored to the reproductive physiology of turbot, can efficiently induce the depletion of gonadal reproductive stem cells, and has minimal impact on the survival of recipient fish. Summary of the Invention

[0006] I. Purpose of the Invention

[0007] The purpose of this invention is to provide a pharmaceutical composition for inducing gonadal depletion in turbot. By optimizing the drug ratio, dosage concentration, injection frequency, and action period, this invention solves the problems of insufficient depletion effect, low fish survival rate, or severe gonadal damage in existing recipient preparation, and provides reliable technical support for establishing a stable and efficient turbot reproductive stem cell transplantation recipient system.

[0008] II. Technical Solution

[0009] To achieve the above objectives, the present invention is implemented through the following solution:

[0010] The present invention provides a pharmaceutical composition for inducing gonadal depletion in turbot, the pharmaceutical composition comprising docetaxel and cisplatin;

[0011] The total concentration of docetaxel and cisplatin in the pharmaceutical composition is 100-200 μg / mL;

[0012] In the actual operation of the present invention, the total concentration of docetaxel and cisplatin in the pharmaceutical composition is preferably 150 μg / mL;

[0013] The mass ratio of docetaxel to cisplatin in the pharmaceutical composition is 1:1.

[0014] In this invention, the pharmaceutical composition further comprises a pharmaceutically acceptable solvent, including dimethyl sulfoxide.

[0015] The present invention provides the use of the above-described pharmaceutical composition in inducing gonadal depletion in turbot.

[0016] The present invention also provides the use of the above-described pharmaceutical composition in the preparation of turbot infertility receptors.

[0017] The present invention also provides the application of the above-mentioned pharmaceutical composition in turbot reproductive stem cell transplantation.

[0018] The present invention also provides the application of the above-mentioned pharmaceutical composition in reducing the expression levels of the dnd gene and dazl gene in turbot.

[0019] This invention provides a method for preparing gonadally depleted turbot, the method comprising the following steps:

[0020] The above-mentioned drug composition was injected into the gonads of turbot.

[0021] The injections are administered once every two weeks.

[0022] The number of injections is four consecutive injections.

[0023] In this invention, the turbot is a 16-month-old turbot.

[0024] In this invention, the preparation method further includes the step of anesthetizing the turbot before injection;

[0025] The anesthetic agent is MS-222, with a concentration of 180-220 ppm, and the anesthesia time is 2-3 minutes.

[0026] The present invention also provides a turbot sterility receptor, which is prepared by the above-described preparation method.

[0027] In the actual practice of reproductive stem cell transplantation, the conventional method is to use busulfan combined with high-temperature gonadal ablation, which suffers from a high mortality rate of experimental materials. However, this invention has discovered that preparing infertile recipients, "surrogate parents," for reproductive stem cell transplantation is more effective than using busulfan, eliminating the need for high-temperature ablation treatment and minimizing damage to experimental materials. In particular, the combined use of docetaxel and cisplatin provided by this invention has shown greater facilitator apoptosis of endogenous germ cells in turbot gonads and reduced damage rates. Overall, this invention has developed a novel method for preparing infertile turbot recipients. Attached Figure Description

[0028] Figure 1 The survival rate of juvenile turbot under different drug treatments;

[0029] The figure shows a comparison of survival rates, proving that the proposed solution (combined drug use) is superior to busulfan in terms of survival rate;

[0030] Figure 2 Comparison of vacuolation rates in different testicular groups;

[0031] Figure 3 Comparison of vacuolar rates among different ovarian groups;

[0032] Figure 4 Histological observations were conducted for different groups;

[0033] In the figure, A, C, E, G, I, and K represent testes; B, D, F, H, J, and L represent ovaries; A and B represent the negative control group (DMSO), C and D represent the docetaxel group, E and F represent the cisplatin group, G and H represent the combination therapy group, I and J represent the busulfan group, and K and L represent the blank control group.

[0034] Figure 5 Comparison of gonadal indices among different groups of male fish;

[0035] Figure 6 Comparison of gonadal indices among different groups of female fish;

[0036] Figure 7 The relative expression levels of reproductive genes in different groups of male and female fish;

[0037] In the picture, a, c, e, and g are female fish, and b, d, f, and h are male fish.

[0038] Figure 8 This is a graph showing the transcriptome sequencing results;

[0039] In the figure, A, B, C, and D are volcano plots of combined drug and blank (male), busulfan and blank (male), combined drug and blank (female), and busulfan and blank (female), respectively; C, D, E, and F are bubble plots of KEGG pathway enrichment analysis of combined drug and blank (male), busulfan and blank (male), combined drug and blank (female), and busulfan and blank (female), respectively; G, H, I, and J are bubble plots of GO analysis of combined drug and blank (male), busulfan and blank (male), combined drug and blank (female), and busulfan and blank (female), respectively. Detailed Implementation

[0040] The present invention will be further described in detail below with reference to specific embodiments. These embodiments are only used to explain the present invention and are not intended to limit the scope of the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0041] Example

[0042] 1. Research Content

[0043] Gonadal depletion experiments were conducted on 16-month-old male and female turbot using docetaxel, cisplatin, a combination of docetaxel and cisplatin, and busulfan. The effects of different drugs on gonadal depletion in turbot were compared in order to find the optimal drug for preparing turbot reproductive stem cell transplant recipients.

[0044] 2. Research Methods

[0045] 2.1 Experimental Fish

[0046] All experimental fish were sourced from the Beidaihe Experimental Station of the Chinese Academy of Fishery Sciences, totaling 226 individuals. The total length of all fish was 46.99 ± 3.16 cm, and their weight was 0.93 ± 0.17 kg. Before the experiment, the fish were moved to a 25m... 2 The experimental ponds were acclimatized to the experimental environment for one month, and routine management and rearing were carried out in preparation for subsequent experiments. The number of experimental fish and the drug concentration are shown in Table 1.

[0047] Table 1. Fish used in the experiment and drug concentration

[0048]

[0049] 2.2 Experimental Methods

[0050] Gonadal depletion experiments were conducted starting December 6, 2024. Fish were injected into the gonads of turbot through the genital pore at the concentrations shown in Table 1, once every two weeks for a total of four injections. A natural temperature blank control group and a negative control group (injected with the same volume of dimethyl sulfoxide as the treatment group) were set up concurrently. During the experiment, the fish were anesthetized with 200 ppm MS-222 for 2–3 minutes. After the injection, the fish were placed in the rearing pond.

[0051] 2.3 Histological observation of gonads

[0052] After the final injection, the fish were cultured at natural temperature for half a month to complete the gonadal depletion experiment. Samples were collected to identify the degree of germ cell depletion in the gonads of turbot. Four samples were collected from each group, including four samples from each sex, and four samples from each sex in the natural temperature blank control group of the same size. The sample fish were anesthetized with an excessive amount of ethylene glycol phenyl ether, weighed, and the gonads were weighed. The middle part of the left and right gonads was fixed with 4% paraformaldehyde, and then subjected to routine dehydration, paraffin embedding, and serial sectioning with a section thickness of 5 μm. The tissue sections were stained with hematoxylin and eosin (HE), mounted with neutral resin, and observed and photographed under a microscope.

[0053] 2.4 Analysis of Reproductive Gene Expression

[0054] Real-time RT-PCR was used to determine the mRNA expression levels of reproductive-related genes such as vasa, dazl, and dnd in each group to detect the degree of germ cell depletion in the turbot-treated group. Histological samples were collected, and gonadal samples from each group were also collected and fixed with RNA fixer at 4°C for 24 hours. The fixative was then removed and the samples were stored at -80°C until subsequent experiments. Q-PCR primers for turbot vasa and the internal control β-actin were designed using Primer 5.0 software; the primer sequences are shown in Table 2.

[0055] RNA was extracted according to the RNAiso Plus Total RNA Reagent (TaKaRa) kit. Using total RNA as a template, cDNA was synthesized according to the PrimeScript® RT reagent kit with gDNA Eraser. The cDNA samples obtained from reverse transcription were diluted 5-20 times, and expression analysis was performed on all samples using the SYBR® method. Amplification was performed in a 96-well fluorescent plate using a LightCycler 480 Real-time PCR instrument. The total reaction volume was 20 μl, including 10 μl of 2×SYBR Premix Ex Taq, 0.4 μl each of forward and reverse primers, 2 μl of diluted cDNA, and 7.2 μl of ddH₂O. The quantitative PCR reaction program included 95℃, 30 s; 95℃, 5 s, 60℃, 30 s, 40 cycles; and 95℃, 5 s, 60℃, 1 min, used to detect the melting curve. 2 -△△CT The relative expression levels of the samples were analyzed using this method.

[0056] Table 2 Primer Sequences for Real-Time Quantitative PCR

[0057] Primer name Sequence (5´-3´) serial number Q-vasa-F GAGGACTTGGAGGAGGTTA SEQ ID NO.1 Q-vasa-R GAGAGTTGGAGGAATGTAGG SEQ ID NO.2 Q-dnd-F GCCATAGTAGCCTTCTCCT SEQ ID NO.3 Q-dnd-R GGATGCCATACGATTGAGAT SEQ ID NO.4 Q-dazl-F CTTGCTGCTCACCTGTAG SEQ ID NO.5 Q-dazl-R GTAGTTCACTGGCATCTGT SEQ ID NO.6 Q-nanos3-F CTCCGCTCATCAGCCTTTA SEQ ID NO.7 Q-nanos3-R GGTTTTGGCACTTGTTTC SEQ ID NO.8 Q-oct4-F CGTGGAGACGCTGGAGAA SEQ ID NO.9 Q-oct4-R GGCTGCTGGTAGTGGTGAT SEQ ID NO.10 Q-β-actin-F CGTGCGTGACATTAAGGA SEQ ID NO.11 Q-β-actin-R ATTGCCGATGGTGATGAC SEQ ID NO.12

[0058] 2.5 Data Analysis

[0059] Data were analyzed using SPSS 22.0. One-way ANOVA was used to examine the differences in survival rate, vacuolation rate, and reproductive gene expression among each specification group, with p < 0.05 considered statistically significant.

[0060] 3. Research Results

[0061] 3.1 Survival rate of recipient fish

[0062] Depend on Figure 1 It can be seen that the survival rate varies significantly under different treatment methods: after treatment with docetaxel and cisplatin, the survival rate is relatively high, at 80% and 86.67% respectively. The survival rate decreases significantly under combined drug treatment and busulfan treatment, at 50.98% and 51.22% respectively. The survival rate is highest in the DMSO and blank control group, approaching 100%, with no significant difference between the two. This indicates that the present invention has advantages in balancing efficacy and safety.

[0063] 3.2 Histological observation and fertility analysis

[0064] The vacuolar follicle rate of the testes and ovaries shows ( Figure 2 , Figure 3The combined medication group had the highest vacuolation rate, significantly higher than other groups. The vacuolation rates for male fish treated with the combined medication and busulfan were 55.03% and 53.07%, respectively, while for female fish they were 55.17% and 39.06%, respectively. The vacuolation rates for DMSO and the control group were lower, at 14.66% and 10.09% for male fish, and 4.76% and 3.21% for female fish. The vacuolation rates for the docetaxel and cisplatin groups were at a moderate level, with cisplatin slightly higher than docetaxel, at 40.33% and 49.57% for male fish, and 19% and 24.08% for female fish.

[0065] By observing the gonadal index ( Figure 5 , Figure 6 ) and histological morphology ( Figure 4 The study found that the gonadal index of male fish treated with the combined medication was lower than that of other groups, while there was no significant difference among the female fish groups. After treatment with the combined medication and busulfan, the testes of male fish showed significant vacuolation, and the spawning plates of female fish were more wrinkled than before the experiment. The ovarian cavity of the combined medication group was further enlarged. Treatment with docetaxel and cisplatin also showed corresponding changes, but the effects were less pronounced than those of the combined medication and busulfan groups. The drug-treated groups showed more significant changes compared with the negative control group (DMSO) and the blank group.

[0066] 3.3 Analysis of Reproductive Gene Expression

[0067] Depend on Figure 7 It was found that by comparing the expression levels of reproductive genes in female turbot of different groups, the expression level of the vasa gene in the docetaxel, cisplatin, and combined drug treatment groups was significantly lower than that in the negative control group and the blank group (p<0.05). The expression level of the dnd gene in the docetaxel group was also significantly lower than that in the negative control group and the blank group (p<0.05). The expression levels of other reproductive genes did not change significantly (p>0.05). The expression level of the nano3 gene in the busulfan group was significantly lower than that in the blank group. The expression levels of other reproductive genes did not change significantly (p>0.05).

[0068] Comparison of reproductive gene expression levels in male turbot from different groups revealed that the expression level of the vasa gene in the docetaxel, cisplatin, combined treatment, and busulfan groups was significantly lower than that in the negative control group and the blank control group (p<0.05). Furthermore, the expression levels of dnd, dazl, nano3, and oct4 genes in the docetaxel group, dazl, nano3, and oct4 genes in the cisplatin group, and dnd and dazl genes in the combined treatment and busulfan groups were also significantly lower than those in the negative control group and the blank control group (p<0.05). The expression levels of other reproductive genes did not change significantly (p>0.05). These results indicate that the expression levels of vasa and dnd genes were significantly reduced in the combined treatment group (p<0.05), demonstrating a definite depletion effect.

[0069] 3.4 Transcriptome Sequencing Analysis

[0070] Transcriptome sequencing results as follows Figure 8 As shown, in the male turbot samples, compared with the control group, a total of 6,588 differentially expressed genes were observed in the combined drug treatment group, of which 4,086 were upregulated and 2,502 were downregulated. In the sulfamethoxazole group, a total of 13,472 differentially expressed genes were observed, of which 7,968 were upregulated and 5,504 were downregulated. KEGG pathway enrichment analysis showed that, compared with the control group, the differentially expressed genes in the combination drug group were mainly enriched in the cell adhesion molecules, Salmonella infection, phagosome, and cytokine-cytokine receptor interaction pathways, while the differentially expressed genes in the busulfan group were mainly enriched in the cell adhesion molecules, calcium signaling pathway, regulation of actin cytoskeleton, and cytokine-cytokine receptor interaction pathways. GO functional enrichment analysis showed that the differentially expressed genes in the combination drug group were significantly enriched in membrane, response to stimulus, and cellular response to stimulus, while the differentially expressed genes in the busulfan group were significantly enriched in membrane, cellular response to stimulus, and cell communication.

[0071] In female fish samples, compared with the control group, the combined drug treatment group showed 1508 differentially expressed genes, of which 693 were upregulated and 815 were downregulated, while the busulfan group showed 2172 differentially expressed genes, of which 1578 were upregulated and 594 were downregulated. KEGG pathway enrichment analysis showed that, compared with the control group, the differentially expressed genes in the combined drug treatment group were mainly enriched in the cytoskeleton in muscle cells and the phagosome pathway, while the differentially expressed genes in the busulfan group were mainly enriched in the calcium signaling pathway, the MAPK signaling pathway, the neuroactive ligand-receptor interaction, and the cytoskeleton in muscle cells. GO functional enrichment analysis showed that the differentially expressed genes in the combined drug treatment group were significantly enriched in response to stimuli, while the differentially expressed genes in the busulfan group were significantly enriched in signal transduction, cell communication, and stimulus-cell response.

[0072] 4. Discussion

[0073] Reproductive stem cell transplantation breaks through the limitations of traditional breeding, playing a positive and important role in shortening breeding cycles and protecting endangered species. The preparation of infertile recipients through gonadal depletion provides a necessary prerequisite for the subsequent implementation of technologies such as reproductive stem cell transplantation. Previous studies have reported and provided practical experience in using busulfan to deplete the gonads of turbot. This study further explores this area, aiming to select alternative chemotherapy drugs with more significant depletion effects and fewer side effects. The results show that docetaxel, cisplatin, combination therapy (docetaxel + cisplatin), and busulfan exhibit significant gradient differences in their effects on the depletion of reproductive stem cells in turbot. These differences are highly correlated with the effects of the drugs on fish survival, gonadal tissue morphology, and reproductive gene expression, reflecting the relationship between the drug's mechanism of action and the tolerance of reproductive stem cells.

[0074] In terms of the intensity of germline stem cell depletion, the combined treatment with busulfan showed the strongest depletion effect. After treatment with the combined treatment and busulfan, male fish exhibited significant testicular vacuolation and a decrease in gonadal index, while female fish showed shrinkage of the spawning plate and expansion of the ovarian cavity. This indicates that a large number of germline stem cells underwent apoptosis, and the gonadal tissue could not maintain its normal morphology. At the level of reproductive genes, the expression of vasa (which regulates the self-renewal of germline stem cells) and nano3 (which participates in the differentiation of germline stem cells) was downregulated, further confirming the drug's inhibitory effect on germline stem cell function at the molecular level, showing obvious depletion characteristics. In addition, the vacuolation rate of female fish in the busulfan group was lower than that of male fish in the same group, indicating that female turbot germline stem cells may have higher tolerance to the drug. This sex difference may be related to differences in the division cycle, metabolic pathways, or protective signaling pathways of male and female germline stem cells, which requires further investigation.

[0075] Cisplatin and docetaxel alone were significantly less effective at depleting germline stem cells than their combination with busulfan. When used alone, the turbot generally maintained good survival rates, with moderate vacuolation of the gonadal tissue and only downregulation of the vasa gene. This suggests that the drugs may only mildly inhibit the proliferation efficiency of germline stem cells, rather than causing mass death; the stem cell pool could still maintain basic functions, thus no obvious signs of depletion were observed. This mild effect may be related to the specificity of the drug's target. Although toxicity to germline stem cells exists, the concentration or duration of action when used alone did not reach the threshold that would break through the stem cell's self-repair capacity, thus only causing local functional inhibition.

[0076] The blank control group and the DMSO negative control group showed no obvious signs of germline stem cell depletion, which not only verified the safety of the solvent DMSO for germline stem cells, but also highlighted the stability of the germline stem cell pool of turbot under normal physiological conditions. The stable expression of reproductive genes and the intact gonadal structure in both groups indicate that the turbot's own germline stem cell regulatory mechanisms (such as self-renewal signaling pathways and apoptosis inhibition mechanisms) can effectively maintain the number and activity of stem cells.

[0077] Further transcriptomic analysis of the combined and busulfan drugs revealed that the combined drug tends to act on immune-related pathways (such as phagosomes) and responses to stimuli, potentially playing a role in immune regulation and the body's adaptation to stimuli. Busulfan, on the other hand, primarily affects cell signaling (such as calcium and MAPK signaling), cytoskeleton regulation, and cell communication, exhibiting a more pronounced regulation of basic cellular physiological activities and signal transduction networks. Furthermore, both drugs showed sex-specific effects, which may be related to sex differences in physiological structure, metabolic levels, and gene expression patterns between males and females. This suggests that future research and applications should fully consider the impact of sex on drug efficacy to more accurately assess and utilize drug effects.

[0078] In summary, the effects of the four drugs on the depletion of germline stem cells in turbot can be summarized as follows: combination therapy is slightly stronger than busulfan, while the combination of both drugs is significantly stronger than docetaxel and cisplatin alone. This gradient is related to both the cytotoxicity of the drugs themselves and may involve synergistic effects between the drugs. This result provides an important reference for the artificial regulation of germline stem cells in fish. If a gentle inhibition of germline stem cell activity is required, cisplatin or docetaxel alone may be a suitable choice; if a more thorough depletion of germline stem cells is required (such as recipient preparation before germ cell transplantation), combination therapy or busulfan is more promising. However, further in-depth research into the molecular mechanisms of drug action is needed to more precisely target and regulate turbot germline stem cells through drugs.

[0079] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A pharmaceutical composition for inducing gonadal depletion in turbot, characterized in that, The pharmaceutical composition includes docetaxel and cisplatin; The total concentration of docetaxel and cisplatin in the pharmaceutical composition is 100-200 μg / mL; The mass ratio of docetaxel to cisplatin in the pharmaceutical composition is 1:

1.

2. The pharmaceutical composition according to claim 1, characterized in that, The pharmaceutical composition further comprises a pharmaceutically acceptable solvent, including dimethyl sulfoxide.

3. The application of the pharmaceutical composition in inducing gonadal depletion in turbot, characterized in that, The pharmaceutical composition is the pharmaceutical composition according to claim 1.

4. The application of the pharmaceutical composition in the preparation of turbot infertility receptors, characterized in that, The pharmaceutical composition is the pharmaceutical composition according to claim 1.

5. The application of the pharmaceutical composition in turbot reproductive stem cell transplantation, characterized in that, The pharmaceutical composition is the pharmaceutical composition according to claim 1.

6. The drug composition reduces the risk of flounder. dnd Gene dazl Its application in gene expression levels is characterized by, The pharmaceutical composition is the pharmaceutical composition according to claim 1.

7. A method for preparing gonadally depleted turbot, characterized in that, The preparation method includes the following steps: Inject the pharmaceutical composition of claim 1 into the gonads of turbot; The injections are administered once every two weeks. The number of injections is four consecutive injections.

8. The preparation method according to claim 7, characterized in that, The turbot mentioned is a 16-month-old turbot.

9. The preparation method according to claim 7, characterized in that, The preparation method also includes the step of anesthetizing the turbot before injection; The anesthetic agent is MS-222, with a concentration of 180-220 ppm, and the anesthesia time is 2-3 minutes.

10. A turbot sterility receptor, characterized in that, The turbot sterility receptor is prepared by the preparation method described in any one of claims 7 to 9.

Images