Application of COL11A2 gene

Abstract

The invention provides application of a COL11A2 gene, namely application of a reagent for regulating and controlling expression and / or functions of the COL11A2 gene in preparation of a product for regulating and controlling formation and / or differentiation of astrocytes. According to the application disclosed by the invention, the regulation effect of the COL11A2 gene on the generation and differentiation of the astrocytes is determined for the first time, a new research direction is provided for the regeneration of the astrocytes, and a new thought is provided for the treatment of neurodegenerative diseases caused by astrocyte dysfunction.

Description

Technical Field

[0001] This invention relates to the field of biotechnology. Specifically, this invention relates to novel uses of the COL11A2 gene. More specifically, this invention relates to the use of the COL11A2 gene in regulating astrocyte formation and / or differentiation, and the use of the COL11A2 gene in the prevention and / or treatment of diseases. Background Technology

[0002] Astrocytes are the most numerous type of glial cell in the central nervous system, playing multiple crucial roles in brain function. Abnormal astrocyte function leads to neuronal dysfunction, inducing neurodegenerative diseases, including Parkinson's disease, Alzheimer's disease, Huntington's disease, and amyotrophic lateral sclerosis (ALS). Therefore, regulating astrocyte function has become a potential approach for treating neurodegenerative diseases.

[0003] COL11A2 is one of the 29 members of the collagen family and a component of the extracellular matrix. Besides its structural role, influencing tissue mechanical properties, structure, and shape, collagen proteins interact with cells through several receptor families and regulate cell proliferation, migration, and differentiation (Ricard-Blum, 2011). Dominant or recessive mutations in this gene in humans can lead to skeletal and joint abnormalities, particularly hearing loss. These diseases include otospinal epiphyseal dysplasia (OSMED), Stickler syndrome type III, and non-syndromic hearing loss.

[0004] Collagen also plays a crucial role in brain development. Early studies reported that collagen members play a role in regulating the development of the cerebral cortex; for example, COL1A2 is involved in cortical folding, and COL3A1 functions in the formation of cortical network structures. Specifically, regarding glial cells, the extracellular matrix, including certain collagen members, is believed to have a potential impact on glial cell generation.

[0005] Furthermore, an RNA-seq analysis involving mouse brain and non-brain tissues found that COL11A2 showed relatively high expression in astrocytes. However, the function of COL11A2 in glial cells and whether it is a key gene directly affecting astrogenesis still lack direct experimental evidence and verification. Summary of the Invention

[0006] Therefore, in view of the shortcomings of the prior art, the purpose of this invention is to provide the use of the COL11A2 gene in regulating astrocyte formation and / or differentiation, and the use of the COL11A2 gene in the prevention and / or treatment of diseases.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] This invention provides the use of reagents that regulate COL11A2 gene expression and / or function in the preparation of products for regulating astrocyte formation and / or differentiation.

[0009] In this invention, the full name of the COL11A2 gene is "collagen type XI alpha 2 chain," which is located on human chromosome 6 and porcine chromosome 7, encoding the alpha 2 chain of type XI collagen. In the GeneBank database, the human gene ID is 1302, and the porcine gene ID is 100520915.

[0010] In some embodiments of the present invention, the reagents that regulate the expression and / or function of the COL11A2 gene are used to inhibit the formation and / or differentiation of the astrocytes.

[0011] In a preferred embodiment of the present invention, the reagent for regulating the expression and / or function of the COL11A2 gene is a reagent for knocking down the COL11A2 gene.

[0012] Preferably, the reagent for knocking down the COL11A2 gene is shRNA or a vector containing the shRNA.

[0013] More preferably, the forward primer of the shRNA is as shown in SEQ ID NO: 1: CCTGGTTTGAAGGGAAATGAA; the reverse primer of the shRNA is as shown in SEQ ID NO: 2: TTCATTTCCCTTCAAACCAGG.

[0014] More preferably, the vector is a lentiviral vector; even more preferably, the lentiviral vector is a pSicoR vector.

[0015] In another preferred embodiment of the present invention, the reagent for regulating the expression and / or function of the COL11A2 gene is a reagent for knocking out the COL11A2 gene.

[0016] Preferably, the reagent for knocking out the COL11A2 gene is sgRNA or a vector containing the sgRNA.

[0017] More preferably, the forward primer of the sgRNA is as shown in SEQ ID NO: 3: CACCGAGGGTGTCCGACAGCTGGGC; the reverse primer of the sgRNA is as shown in SEQ ID NO: 4: AAACGCCCAGCTGTCGGACACCCTC.

[0018] More preferably, the carrier is a target carrier; even more preferably, the target carrier is a PX458 carrier.

[0019] In other embodiments of the invention, the reagents regulating COL11A2 gene expression and / or function are used to promote the formation and / or differentiation of the astrocytes.

[0020] In another preferred embodiment of the present invention, the reagent for regulating the expression and / or function of the COL11A2 gene is an overexpression vector containing the full-length coding region sequence of the COL11A2 gene, as shown in SEQ ID NO: 5.

[0021]

[0022]

[0023]

[0024]

[0025] Preferably, the overexpression vector is a pCDH-CMV-MCS-EF1-copGFP vector; more preferably, the overexpression vector is a pCDH-CMV-MCS-EF1-copGFP vector with a 3×Flag tag.

[0026] In various embodiments of the present invention, the product is a reagent kit or a drug.

[0027] The present invention also provides the use of reagents for regulating COL11A2 gene expression and / or function in the preparation of medicaments for the prevention and / or treatment of diseases, wherein the diseases are neuronal and / or glial cell dysfunctions, and / or neurodegenerative diseases.

[0028] Preferably, the disease is selected from one or more neurodegenerative diseases such as Parkinson's disease, Alzheimer's disease, Huntington's disease, and amyotrophic lateral sclerosis (ALS).

[0029] The present invention has at least the following beneficial effects:

[0030] This invention utilizes pig-derived cells, which are more closely related to humans, and human cell lines to investigate the effects of the COL11A2 gene on astrocytes, and for the first time clarifies that the COL11A2 gene plays a regulatory role in the generation and differentiation of astrocytes.

[0031] This invention provides a new research direction for astrocyte regeneration through the COL11A2 gene and its encoded protein, and also offers new ideas for the prevention and / or treatment of neurodegenerative diseases caused by astrocyte dysfunction. Attached Figure Description

[0032] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein:

[0033] Figure 1 This study demonstrates the effect of COL11A2 knockdown on the generation of astrocytes from porcine neural stem cells. A shows the expression level of GFAP in COL11A2-knockdown pNSC-derived astrocytes analyzed by Western blot; B shows the morphology of GFAP-positive astrocytes derived from COL11A2-knockdown pNSCs analyzed by immunofluorescence staining; C shows the number of astrocytes co-labeled with GFAP and GFP; and D shows the total protrusion length analysis of GFAP- and GFP-co-labeled astrocytes. KD represents knockdown.

[0034] Figure 2 This study demonstrates the effect of COL11A2 overexpression on the generation of astrocytes from porcine neural stem cells. A shows the expression level of GFAP in astrocytes derived from COL11A2-overexpressing pNSCs analyzed by Western blot; B shows the morphology of GFAP-positive astrocytes derived from COL11A2-overexpressing pNSCs analyzed by immunofluorescence staining; C shows the number of astrocytes co-labeled with GFAP and GFP; and D shows the total protrusion length analysis of astrocytes co-labeled with GFAP and GFP. OE represents overexpression.

[0035] Figure 3 This study demonstrates the effect of COL11A2 knockout on the differentiation of human embryonic stem cells into astrocytes. In Figure A, Western blot analysis shows the expression level of COL11A2 after COL11A2 knockout in hESCs; Figure B shows the morphology of GFAP-positive astrocytes derived from COL11A2 knockout hESCs using immunofluorescence analysis; and Figure C shows the total protrusion length analysis results of GFAP-positive astrocytes derived from COL11A2 knockout hESCs. KO represents knockout. Detailed Implementation

[0036] The present invention will be further described below with reference to the accompanying drawings and embodiments. It should be understood that the embodiments are only used to further illustrate and explain the present invention, and are not intended to limit the present invention.

[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0038] Cell line origin:

[0039] The porcine neural stem cells (pNSCs) used in the following examples were obtained in the inventors' laboratory using Bama miniature pigs. The isolation, culture, and culture medium composition of the porcine neural stem cells were based on the materials and methods described in the paper “Kim E, Hwang SU, Yoon JD, Kim H, Lee G, Hyun SH. Isolation and characterization of GFAP-positive porcineneural stem / progenitor cells derived from a GFAP-CreER(T2)transgenic piglet. BMC Vet Res 14, 331 (2018)”.

[0040] The human embryonic stem cells (WIBR3 hESCs) used in the following examples were donated to the laboratory of Wang Haoyi, Institute of Zoology, Chinese Academy of Sciences. WIBR3 hESCs were cultured in 6-well cell culture plates (Corning) coated with Matrigel (Corning). Essential 8 was used. TM Culture medium (Gibco) was used, and cells were cultured in an incubator at 37°C and 5% CO2. The culture medium was changed daily. Cells were passaged every four days, first incubated with 0.5 mM EDTA for 3 minutes, and then dissociated into small clumps for passage.

[0041] Example 1: Knockdown of the COL11A2 gene in porcine neural stem cells

[0042] 1. Construction of shRNA lentiviral plasmids

[0043] 1) Design shRNA primers and commission Tianyi Huiyuan Biotechnology Co., Ltd. to synthesize them. Centrifuge the synthesized primers at 12,000 rpm for 10 min and dissolve them in ddH2O to 100 pM.

[0044] shRNA forward primer (shRNA-F): CCTGGTTTGAAGGGAAATGAA (SEQ ID NO: 1)

[0045] shRNA reverse primer (shRNA-R): TTCATTTCCCTTCAAACCAGG (SEQ ID NO: 2)

[0046] 2) Prepare the mixture according to Table 1 and perform primer annealing. Place the reaction system in water at 95°C and wait for the temperature to drop to room temperature.

[0047] Table 1 Annealing reaction system

[0048] name volume shRNA-F (100pM) 10μL shRNA-R (100pM) 10μL <![CDATA[ddH2O]]> 80uL Total volume 100uL

[0049] 3) Prepare the ligation reaction system according to Table 2. After double digestion with HpaI and XhoI, the pSicoR vector (Addgene, 11579) was ligated with the annealing product.

[0050] Table 2 Connection Reaction System

[0051] name Volume or mass Annealing primer 0.3uL pSicoR vector after enzyme digestion 50ng T4 DNA ligase 1μL 10× ligase buffer 1μL <![CDATA[ddH2O]]> Add to 10μL

[0052] 4) Incubate at 16℃ for 4 to 6 hours, then transform according to the E. coli competent DH5α instructions, and plate onto ampicillin-resistant LB plates. Incubate overnight upside down at 37℃. Pick single clones for colony PCR identification. The reaction system is shown in Table 3, and the reaction procedure is shown in Table 4. Then, send the samples to Tianyi Huiyuan Company for Sanger sequencing to identify whether they are positive clones.

[0053] Table 3 PCR reaction system

[0054] name volume 2×Taq PCR MasterMix 10μL Forward primer F 1μL Reverse primer R 1μL bacterial solution 1μL <![CDATA[ddH2O]]> Add to 20μL

[0055] Forward primer F:

[0056] CAGCACAAAAGGAAAACTCACC (SEQ ID NO: 6)

[0057] Reverse primer R:

[0058] GGCTATGAACTAATGACCCCGT (SEQ ID NO: 7)

[0059] Table 4 PCR reaction procedure

[0060]

[0061] 5) Inoculate the positive clone bacterial culture into 200 mL LB liquid medium, incubate overnight at 37°C with shaking, collect the bacterial cells, and perform plasmid extraction using the endotoxin-free plasmid extraction kit (DP120) from Beijing Tiangen Biotech Co., Ltd., following the instructions.

[0062] 2. Virus packaging and titer determination

[0063] 1) Virus Packaging

[0064] 293T cells were seeded in 6-well plates, and plasmid transfection was initiated when the cell density reached 80%. The successfully constructed plasmids and packaging plasmids psPAX2 (Addgene, 12260) and pMD2.G (Addgene, 12259) were transfected into 293T cells using GenEscort I transfection reagent (WIS 1100) from Huiji Biotechnology Co., Ltd. Supernatants were collected at 24h, 48h, and 72h, centrifuged at 3000rpm for 5min, and the virus supernatant was retained and stored at -20℃.

[0065] 2) Titer determination

[0066] 293T cells were seeded in 24-well plates. When the cell density reached 80%, 10 μL of virus solution was added. After 48 hours, the number of cells exhibiting green fluorescence was observed and counted under a fluorescence microscope, and the viral titer was calculated using the formula: Virus titer = (Percentage of fluorescent cells / Virus volume) × Initial cell density × 10⁻⁶. 3 Calculate the viral titer.

[0067] 3. Infection of porcine neural stem cells

[0068] pNSCs were seeded into 6-well plates and cultured for 24 h, followed by lentiviral infection with an MOI of 5. Polybrene was added to a final concentration of 2 μg / mL. The differentiation medium was replaced after 12 h.

[0069] Example 2: Effects of COL11A2 gene knockdown on the morphology and number of porcine neural stem cells differentiating into astrocytes

[0070] COL11A2 knockdown pNSCs were differentiated into glial cells using the following method: when porcine neural stem cells (pNSCs) reached 70-80% confluence, the culture medium was replaced with glial cell differentiation medium. The glial cell differentiation medium consisted of DMEM / F12 medium (Gibco), 1% N2 supplement (Gibco), 2% B27 supplement (Gibco), and 1% fetal bovine serum (FBS, Gibco). The medium was replaced two days after cell inoculation.

[0071] Three days after COL11A2 knockdown pNSCs differentiated into glial cells, the expression levels of COL11A2 protein and GFAP (glial fibrillary acidic protein) were detected by Western blot.

[0072] The steps for Western blot are as follows:

[0073] 1) Protein extraction: Place the sample in RIPA lysis buffer (Beyotime, P0013K), vortex to mix, and then lyse on ice for 20 min. Add protease inhibitor cocktail (Thermo Fisher Scientific, 78442) to prevent protein degradation and lyse on ice for 20 min.

[0074] 2) Add an equal volume of 2×Laemmli sample buffer (Bio-Rad Laboratories, 1610737) to the lysed protein and boil for 5 min.

[0075] 3) SDS-polyacrylamide gel electrophoresis (8% separating gel and 5% stacking gel, respectively) was performed at 80V for 30 min, then 120V for 1 h to separate proteins.

[0076] 4) Use a Bio-rad semi-dry electroporator to transfer the total protein on the gel onto a PVDF (polyvinylidene fluoride) membrane. Set the parameters to 20V and 30-35min.

[0077] 5) At room temperature, the PVDF membrane was sealed by shaking with 5% skim milk powder on a shaker for 2 hours, and then incubated overnight at 4°C with primary antibody. The membrane was washed 3 times with TBST for 5 minutes each time.

[0078] 6) Incubate the secondary antibody at room temperature for 50 min. Wash the membrane three times with TBST, 5 min each time.

[0079] 7) The specific proteins on the PVDF membrane were exposed using an ECL luminescence kit (Thermo Fisher Scientific, 34577) in a Tanon chemiluminescence imaging system (formerly Pinghao Biotechnology, Tanon 5200).

[0080] The results of Western blot are as follows: Figure 1 As shown in Figure A, knocking down COL11A2 leads to a reduction in GFAP expression.

[0081] Morphological changes in astrocytes were analyzed using immunofluorescence staining. The steps of immunofluorescence staining are as follows:

[0082] 1) Remove the cell smear from the 24-well plate, remove the culture medium, and wash the cells three times with sterile PBS;

[0083] 2) Discard the PBS and fix with 4% PFA at room temperature for 20 min;

[0084] 3) Discard the PFA, and wash with PBS at room temperature three times, 5 min each time;

[0085] 4) After removing the PBS, block with 0.1% PBST (Triton X-100) containing 5% BSA at room temperature for 1 h;

[0086] 5) Incubate the primary antibody overnight at 4℃;

[0087] 6) Remove the primary antibody and wash three times with PBS at room temperature for 5 minutes each time;

[0088] 7) Incubate the secondary antibody at room temperature in the dark for 1.5-2 hours;

[0089] 8) Remove the secondary antibody and wash three times with PBS at room temperature for 5 minutes each time;

[0090] 9) Add DAPI solution to the slide and stain for 1 min. After removing the solution, wash with PBS at room temperature 3 times, 5 min each time.

[0091] 10) The sample was photographed under a Zeiss LSM780 laser confocal microscope.

[0092] The results of immunofluorescence staining are as follows Figure 1 As shown in B, C, and D, consistent with changes in protein expression, immunofluorescence staining analysis of astrocyte morphological changes revealed that in the COL11A2 knockdown group, the number of astrocytes co-labeled with GFAP (glial fibrillary acidic protein) and GFP (green fluorescent protein) and the total protrusion length were significantly reduced.

[0093] These results indicate that COL11A2 knockdown inhibits the generation and differentiation of porcine neural stem cells into astrocytes.

[0094] Example 3: Overexpression of the COL11A2 gene in porcine neural stem cells

[0095] The full-length CDS sequence of pig COL11A2 (synthesized by Changsha Youbao Biotechnology Co., Ltd.) was cloned into the pCDH-CMV-MCS-EF1-copGFP vector (Youbao Biotechnology, VT1479) with a 3×Flag tag to construct an overexpression plasmid.

[0096] The virus packaging and titer determination, as well as the infection steps for porcine neural stem cells, are the same as in Example 1.

[0097] Example 4: Effects of COL11A2 gene overexpression on the morphology and number of porcine neural stem cells differentiating into astrocytes

[0098] After 3 days of differentiation of COL11A2-overexpressing pNSCs into glial cells, the specific method was the same as in Example 2.

[0099] The expression levels of COL11A2 and GFAP were detected using Western blot. The results are as follows: Figure 2 As shown in Figure A, it can be seen that overexpression of COL11A2 promotes the expression of GFAP.

[0100] Morphological changes in astrocytes were analyzed using immunofluorescence staining, and the results were as follows: Figure 2 As shown in B, C, and D. Immunofluorescence staining analysis of astrocyte morphological changes showed that in the COL11A2 overexpression group, the number of astrocytes co-labeled with GFAP and GFP and the total protrusion length were significantly increased.

[0101] These results indicate that COL11A2 overexpression promotes the generation and differentiation of porcine neural stem cells into astrocytes.

[0102] Example 5: Establishment of a human embryonic stem cell line with COL11A2 gene knockout

[0103] 1. Design of sgRNA and construction of targeting vectors

[0104] sgRNA primers were designed targeting the human COL11A2 gene. The annealing reaction system was prepared according to Table 5, and the mixture was reacted at 95℃ for 5 min, then allowed to cool naturally to room temperature. The primers were then ligated to the BbsI-digested PX458 vector backbone (Addgene, 152199) (reaction system shown in Table 6). After transformation into competent E. coli cells, positive clones were screened by PCR (reaction system and procedure shown in Tables 3 and 4, respectively), followed by plasmid extraction for transfection. The specific methods for transformation and plasmid extraction were the same as in Example 1.

[0105] The sgRNA primers are as follows:

[0106] sgRNA forward primer (sgRNA-F): CACCGAGGGTGTCCGACAGCTGGGC (SEQ ID NO: 3)

[0107] sgRNA reverse primer (sgRNA-R): AAACGCCCAGCTGTCGGACACCCTC (SEQ ID NO: 4)

[0108] Table 5 Annealing Reaction System

[0109] name volume sgRNA-F (100 μM) 1μL sgRNA-R (100 μM) 1μL <![CDATA[ddH2O]]> 8μL Total volume 10μL

[0110] Table 6 Connection Reaction System

[0111] name Volume or mass Annealed products 4μL PX458 vector digested with enzymes 50ng T4 DNA ligase 1μL 10× ligase buffer 1μL <![CDATA[ddH2O]]> Add to 10μL

[0112] 2. Transfection of human embryonic stem cells

[0113] hESCs were digested with Accutase (STEMCELL, 07920) for 3 min. The plasmid was then transferred via Entranster... TM hESCs were transfected using the -E transfection reagent via a Lonza Nucleofector 2B electroporator. Transfected cells were seeded into 6-well Matrigel-coated cell culture plates and cultured using Essential 8 microplates containing 10 μM of the ROCK inhibitor Y27632 (Selleck, S1263). TM Culture medium (Gobio, 05990). After 24 hours, replace the culture medium with standard Essential 8. TM Culture medium. After 3 days, GFP-positive cells were sorted by flow cytometry and seeded at a density of 500 cells per well on 6-well Matrigel-coated cell culture plates. After 7 days, once the cells had formed clones, they were sent to Qingke Biotechnology Co., Ltd. for sequencing identification. The reaction system and procedure are shown in Tables 3 and 4, respectively. The results are as follows: Figure 3 As shown in Figure A, it can be seen that COL11A2 was successfully knocked out.

[0114] Example 6: Effect of COL11A2 gene knockout on the differentiation of human embryonic stem cells into astrocytes

[0115] COL11A2 knockout hESCs were differentiated into hNPCs after 7 days. The differentiation of hESCs into hNPCs and the culture methods were based on the materials and methods described in the article "Zhang W, et al. SIRT6 deficiency results in developmental retardation in cynomolgus monkeys. Nature 560, 661-665 (2018)".

[0116] Then, continue culturing in astrocyte differentiation medium for 23 days to form astrocytes. Specific method: For human astrocyte differentiation, when hNPCs are cultured to approximately 80% confluence, the hNPCs medium is converted to astrocyte induction medium. The astrocyte differentiation medium consists of the following components: DMEM / F12 medium (Gibco), containing 2% B27 supplement (Gibco), 1% N2 supplement (Gibco), 10 ng / mL BDNF (Peprotech), and 10 ng / mL GDNF (Peprotech). After 2 days of culture, 1 μg / mL Laminin (Sigma) is added. After 4 days of culture, 10 ng / mL hLIF (Gibco) or 10% FBS (Gibco) is added, and the medium is changed every two days.

[0117] Immunofluorescence assay was performed, and the results were as follows: Figure 2 As shown in B and C, the results indicate that astrocytes derived from COL11A2 knockout hESCs have significantly shorter processes. These results suggest that COL11A2 knockout affects the differentiation of human astrocytes.

Claims

1. Use of reagents that regulate COL11A2 gene expression and / or function in the preparation of products for regulating astrocyte formation and / or differentiation.

2. The use according to claim 1, characterized in that, The reagent that regulates the expression and / or function of the COL11A2 gene is used to inhibit the formation and / or differentiation of the astrocytes.

3. The use according to claim 2, characterized in that, The reagent that regulates the expression and / or function of the COL11A2 gene is a reagent that knocks down the COL11A2 gene; preferably, the reagent that knocks down the COL11A2 gene is shRNA or a vector containing the shRNA. More preferably, the forward primer of the shRNA is shown in SEQ ID NO: 1, and the reverse primer of the shRNA is shown in SEQ ID NO: 2; More preferably, the vector is a lentiviral vector; even more preferably, the lentiviral vector is a pSicoR vector.

4. The use according to claim 2, characterized in that, The reagent that regulates the expression and / or function of the COL11A2 gene is a reagent that knocks out the COL11A2 gene; preferably, the reagent that knocks out the COL11A2 gene is sgRNA or a vector containing the sgRNA. More preferably, the forward primer of the sgRNA is shown in SEQ ID NO: 3, and the reverse primer of the sgRNA is shown in SEQ ID NO: 4; More preferably, the carrier is a target carrier; even more preferably, the target carrier is a PX458 carrier.

5. The use according to claim 1, characterized in that, The reagent that regulates the expression and / or function of the COL11A2 gene is used to promote the formation and / or differentiation of the astrocytes.

6. The use according to claim 5, characterized in that, The reagent used to regulate the expression and / or function of the COL11A2 gene is an overexpression vector containing the full-length coding region sequence of the COL11A2 gene; preferably, the overexpression vector is the pCDH-CMV-MCS-EF1-copGFP vector.

7. The use according to any one of claims 1 to 6, characterized in that, The product is a reagent kit or a drug.

8. Use of reagents that regulate COL11A2 gene expression and / or function in the preparation of drugs for the prevention and / or treatment of diseases.

9. The use according to claim 8, characterized in that, The disease is a disorder of neuronal and / or glial cell function, and / or a neurodegenerative disease.

10. The use according to claim 9, characterized in that, The disease is selected from one or more of Parkinson's disease, Alzheimer's disease, Huntington's disease, and amyotrophic lateral sclerosis (ALS).

Images