Method for editing and enhancing anti-tumor function of tumor infiltrating lymphocytes based on CRISPR-Cas9 system

Abstract

The invention provides a method for editing and enhancing the anti-tumor function of tumor infiltrating lymphocytes based on a CRISPR-Cas9 system, and belongs to the field of biological medicine. Through multi-target collaborative editing, the obtained tumor infiltrating lymphocyte shows remarkably enhanced survival, proliferation and killing capabilities in a tumor microenvironment, and functional inhibition mediated by immune checkpoint molecule up-regulation and immunosuppressive factors can be effectively overcome, so that the clearance potential of the tumor infiltrating lymphocyte to solid tumors is greatly improved; the technology not only provides a novel immune cell product which is stronger in function and more durable for clinic, but also lays a solid process foundation for developing a next-generation individualized and universal tumor immunotherapy scheme, and has an important transformational medical value and a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a method for enhancing the anti-tumor function of tumor-infiltrating lymphocytes based on the CRISPR-Cas9 system. Background Technology

[0002] Tumor-infiltrating lymphocyte (TIL) therapy is an adoptive cellular immunotherapy strategy. The basic process involves isolating infiltrating lymphocytes from the patient's tumor tissue, expanding them in vitro, and then reinfusing them into the patient to attack the tumor. These cells can theoretically recognize tumor-associated antigens, but their function is often severely restricted in the complex tumor microenvironment. One major limiting factor is the immune checkpoint pathway, such as PD-1 / PD-L1 and TIM-3. When these receptors on the surface of T cells bind to their corresponding ligands on tumor cells or immune cells, they transmit inhibitory signals, leading to T cell exhaustion or dysfunction, and an inability to effectively perform their killing task. Another key limiting factor is the presence of various immunosuppressive factors in the tumor microenvironment, such as transforming growth factor-β, which can directly inhibit T cell activation and proliferation and induce differentiation into a tolerance phenotype. Traditionally expanded TILs, even after reinfusion, are still susceptible to these inhibitory mechanisms, resulting in limited efficacy or relapse.

[0003] In recent years, the development of gene editing technology, especially the CRISPR-Cas9 system, has provided a powerful tool for precisely modifying immune cells, making it possible to knock out specific genes to enhance cellular function. How to systematically and specifically modify TIL cells using gene editing technology to enable them to resist multiple inhibitions in the tumor microenvironment, thereby achieving stronger and more durable anti-tumor activity, is a key issue that urgently needs to be explored and resolved in this field. Summary of the Invention

[0004] The purpose of this invention is to provide a method for enhancing the anti-tumor function of tumor-infiltrating lymphocytes based on the CRISPR-Cas9 system, which solves the technical problem that existing tumor-infiltrating lymphocyte therapies are subject to the influence of immune checkpoint signals and immunosuppressive factors in the tumor microenvironment, resulting in suppressed cell function and difficulty in continuously and effectively killing tumor cells.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a CRISPR-Cas9 gene editing system for enhancing immune evasion resistance of tumor-infiltrating lymphocytes. The system comprises sgRNA targeting the PDCD-1, TIM-3, and SMAD7 genes, as well as the Cas9 nuclease.

[0006] Preferably, in the CRISPR-Cas9 gene editing system described above, the sequence of the sgRNA targeting the PDCD-1 gene is shown in any one of SEQ ID NO: 1 to SEQ ID NO: 7.

[0007] Preferably, in the CRISPR-Cas9 gene editing system described above, the sequence of the sgRNA targeting the TIM-3 gene is shown in any one of SEQ ID NO: 8 to SEQ ID NO: 14.

[0008] Preferably, in the CRISPR-Cas9 gene editing system described above, the sequence of the sgRNA targeting the SMAD7 gene is shown in any one of SEQ ID NO: 15 to SEQ ID NO: 23.

[0009] Preferably, in the CRISPR-Cas9 gene editing system described above, the sgRNA and the gene encoding the Cas9 nuclease are constructed on a lentiviral vector or an adeno-associated virus vector.

[0010] Preferably, in the above-mentioned CRISPR-Cas9 gene editing system, the lentiviral vector is the pLentiCRISPRv2 vector containing the puromycin resistance gene, and the adeno-associated virus vector is the pX601 vector containing the green fluorescent protein reporter gene.

[0011] The present invention also provides a tumor-infiltrating lymphocyte that enhances immune evasion resistance, wherein the PDCD-1 gene, TIM-3 gene and SMAD7 gene of the tumor-infiltrating lymphocyte are knocked out or inactivated by the CRISPR-Cas9 gene editing system described above.

[0012] The present invention also provides a method for preparing the above-mentioned tumor-infiltrating lymphocytes with enhanced immune evasion resistance, comprising the following steps: introducing the above-mentioned CRISPR-Cas9 gene editing system vector into tumor-infiltrating lymphocytes isolated from tumor tissue and cultured in the logarithmic growth phase by electroporation transfection or liposome transfection.

[0013] Preferably, in the above method, the voltage of the electroporation transfection method is 100V to 300V and the pulse time is 1ms to 10ms; in the liposome transfection method, the mass ratio of liposomes to the CRISPR-Cas9 gene editing system vector is 1:1 to 5:1; the tumor-infiltrating lymphocytes are cultured using RPMI 1640 medium containing 10% to 20% fetal bovine serum and 100U / mL to 200U / mL IL-2, under conditions of 37°C and 5% CO2; and / or, after the introduction step, the method further includes a step of culturing the tumor-infiltrating lymphocytes in a medium containing puromycin to screen for positive cells; and / or, after the introduction step, the method further includes a step of in vitro expansion culture of the tumor-infiltrating lymphocytes; the in vitro expansion culture uses a medium containing 10% to 20% fetal bovine serum and 200U / mL to 400U / mL IL-2. The RPMI 1640 medium for IL-2; after the in vitro expansion culture step, the method further includes a step of co-culturing the expanded tumor-infiltrating lymphocytes with tumor cells at a ratio of 1:1 to 20:1.

[0014] The present invention also provides the use of the above-described tumor-infiltrating lymphocytes with enhanced immune evasion resistance in the preparation of pharmaceutical compositions for treating tumors.

[0015] The beneficial effects of this invention are: This invention, through multi-target synergistic editing, enables the obtained tumor-infiltrating lymphocytes to exhibit significantly enhanced survival, proliferation, and killing capabilities in the tumor microenvironment. It can effectively overcome functional inhibition mediated by the upregulation of immune checkpoint molecules and immunosuppressive factors, thereby greatly enhancing their potential to eliminate solid tumors. This technology not only provides clinicians with a novel immune cell product that is more powerful and durable, but also lays a solid technological foundation for the development of next-generation personalized and universal tumor immunotherapy regimens, possessing significant translational medical value and broad application prospects. Attached Figure Description

[0016] Figure 1 The following is an in vitro verification diagram of the CRISPR-Cas9 system editing the PDCD-1, TIM-3, and SMAD7 genes in an embodiment of the present invention, wherein: A is an agarose gel electrophoresis diagram of the in vitro cleavage experiment; B is a statistical bar chart of the corresponding sgRNA cleavage efficiency; C is a schematic diagram of the exon structure of the PDCD1, HAVCR2, and SMAD7 genes and the sgRNA target sites. Figure 2The following is a graph showing the results of detecting the expression levels of surface proteins on gene-edited TIL cells in this embodiment of the invention: A is a flow cytometry histogram of PDCD-1, TIM-3, and SMAD7 protein expression in the edited group and the control group; B is a statistical graph showing the proportion of PDCD-1, TIM-3, and SMAD7 positive cells; C is a statistical graph showing the average fluorescence intensity of PDCD-1, TIM-3, and SMAD7. Figure 3 The following are the results of in vitro functional evaluation of edited TIL cells in this embodiment of the invention: A is a graph showing the changes in the tumor cell killing rate of edited and control TIL cells at different time points under different effector-to-target ratios; B is a graph showing the detection results of IFN-γ and TNF-α secretion levels in the supernatant of edited and control TIL cells after co-culture; C is a graph showing the changes in fluorescence intensity of the proliferation of edited and control TIL cells at different time points based on CFSE staining. Figure 4 The figures shown are functional evaluation results of edited TIL cells in a simulated inhibitory microenvironment in this embodiment of the invention. Specifically: A is a graph showing the tumor cell killing rate of edited and control TIL cells over time at different effector-to-target ratios in the presence of exogenous TGF-β; B is a comparison of IFN-γ secretion levels in the co-culture system in the presence of exogenous TGF-β; C is a graph showing the tumor cell killing rate of edited and control TIL cells over time at different effector-to-target ratios in target cells with high PD-L1 expression; and D is a comparison of IFN-γ secretion levels in the co-culture system with high PD-L1 expression. Figure 5 The following diagram shows the results of the off-target effects, safety, and transformation risk assessment of gene-edited TIL cells in this embodiment of the invention: A is a bioinformatics prediction statistical diagram of potential off-target sites of each sgRNA; B is a comparison diagram of karyotype analysis of TIL cells in the editing group and the control group; C is a diagram of the soft agar colony formation experiment results; and D is a diagram of the qPCR results of the replication lentivirus detection. Detailed Implementation

[0017] This invention provides a CRISPR-Cas9 gene editing system for enhancing immune evasion resistance in tumor-infiltrating lymphocytes. The CRISPR-Cas9 system is a revolutionary gene editing tool derived from the acquired immune mechanisms of bacteria and archaea. It targets specific DNA sequences via guide RNA (sgRNA) and utilizes the Cas9 nuclease to generate double-strand breaks, thereby achieving gene knockout, insertion, or repair through the cell's own DNA repair mechanisms. In this invention, the system comprises sgRNA targeting the PDCD-1, TIM-3, and SMAD7 genes, and a Cas9 nuclease. The Cas9 nuclease can be SpCas9, commonly used in the field and derived from Streptococcus pyogenes, or variants with similar functions that recognize NGG PAM sequences, such as SaCas9 and NmCas9; it can also be engineered Cas9 variants with higher specificity or smaller molecular weight, such as eSpCas9 or Cas9-HF1.

[0018] In a preferred embodiment, the sgRNA sequence targeting the PDCD-1 gene (also known as the PD-1 gene) is shown in any one of SEQ ID NO: 1 to SEQ ID NO: 7. PD-1 (programmed death receptor 1) is an important immune checkpoint protein, primarily expressed on the surface of activated T cells. When it binds to its ligands PD-L1 or PD-L2, it transmits an inhibitory signal, leading to T cell dysfunction. Editing this gene aims to reduce or eliminate the sensitivity of TIL cells to this inhibitory signal. The sequences shown in SEQ ID NO: 1 to SEQ ID NO: 7 are highly efficient sgRNA candidate sequences designed for different exon regions of the PD-1 gene (e.g., exons 2, 3, and 4). Further, among these sequences, sgRNAs targeting the near-N-terminal coding region of exon 2 or 3 are preferred, such as SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 4, as they may more effectively induce gene inactivation. These sequences have been validated in vitro for their ability to effectively guide the Cas9 protein to cleave the target gene.

[0019] In a preferred embodiment, the sgRNA targeting the TIM-3 gene (also known as the HAVCR2 gene) has the sequence shown in any one of SEQ ID NO: 8 to SEQ ID NO: 14. TIM-3 (T cell immunoglobulin and mucin domain-3) is another key immune checkpoint receptor, highly expressed on exhausted T cells, and its activation suppresses T cell function and promotes immune tolerance. The sequences shown in SEQ ID NO: 8 to SEQ ID NO: 14 are sgRNAs designed to target different exons of the TIM-3 gene. Preferred sequences are those targeting exons encoded by its extracellular domain or transmembrane region, such as SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 11.

[0020] In a preferred embodiment, the sgRNA targeting the SMAD7 gene has the sequence shown in any one of SEQ ID NO: 15 to SEQ ID NO: 23. SMAD7 is a key negative regulator of the TGF-β signaling pathway; inhibiting this pathway weakens the TGF-β-mediated immunosuppressive effect, thereby enhancing the anti-tumor function of T cells. The sequences shown in SEQ ID NO: 15 to SEQ ID NO: 23 target different exons of the SMAD7 gene. Preferred sequences are those targeting key functional regions of the gene, such as SEQ ID NO: 15, SEQ ID NO: 18, or SEQ ID NO: 20.

[0021] In a preferred embodiment, the sgRNA and the gene encoding the Cas9 nuclease are constructed on a suitable expression vector to ensure efficient delivery to TIL cells and stable or transient expression therein. The vector is preferably a viral vector, such as a lentiviral vector or an adeno-associated virus (AAV) vector, both of which can effectively infect a variety of mammalian cells, including primary T cells. Lentiviral vectors can integrate exogenous genes into the host genome, achieving long-term stable expression, and are suitable for scenarios requiring persistent editing effects. AAV vectors typically exist in episome form, with a lower integration risk and better safety; their serotypes (e.g., AAV2, AAV6, AAV9) can be selected according to the target cell type. Besides viral vectors, non-viral delivery systems such as plasmid DNA, mRNA, or ribonucleoprotein complexes can also be considered depending on the specific application.

[0022] Further preferably, the lentiviral vector is a pLentiCRISPRv2 vector containing a puromycin resistance gene. pLentiCRISPRv2 is one of the widely used lentiviral vectors in the art for CRISPR-Cas9 editing, typically containing an sgRNA expression cassette driven by the U6 promoter, a Cas9 expression cassette driven by the EF1α or CMV promoter, and a puromycin resistance gene for selection. Puromycin is an aminonucleoside antibiotic that inhibits protein synthesis, kills unsuccessfully transduced cells, and thus enriches cells successfully introduced into the vector. The adeno-associated virus vector is a pX601 vector containing a green fluorescent protein reporter gene. pX601 is a commonly used AAV vector for CRISPR-Cas9 delivery, containing a reporter gene (such as GFP), facilitating direct observation and sorting of successfully transduced cells via flow cytometry or fluorescence microscopy. GFP (green fluorescent protein) is a fluorescent protein derived from jellyfish that emits green light when excited by blue light and is a commonly used reporter molecule in cell biology.

[0023] This invention also provides tumor-infiltrating lymphocytes that enhance immune evasion resistance. These tumor-infiltrating lymphocytes are derived from the patient's tumor tissue and represent a heterogeneous population of T lymphocytes capable of recognizing tumor-associated antigens. Through processing with the aforementioned CRISPR-Cas9 gene editing system, the PD-1, TIM-3, and SMAD7 genes of the TIL cells are effectively knocked out or inactivated. "Knockout or inactivation" means that gene editing causes frameshift mutations, large-segment deletions, or disruption of key functional domains in the coding sequence of the target gene, thereby preventing the gene from expressing a fully functional protein or significantly reducing its expression level. The resulting TIL cells of this invention exhibit significantly reduced expression of PD-1 and TIM-3 proteins on their surface, along with decreased sensitivity to TGF-β-mediated inhibitory signals.

[0024] This invention also provides a method for preparing the aforementioned tumor-infiltrating lymphocytes with enhanced immune evasion resistance. The method includes the core step of introducing the constructed CRISPR-Cas9 gene-editing system vector into tumor-infiltrating lymphocytes isolated from tumor tissue and cultured in vitro to the logarithmic growth phase via physical or chemical transfection. The tumor tissue sources include, but are not limited to, fresh surgically resected solid tumor specimens, such as melanoma, non-small cell lung cancer, ovarian cancer, and colorectal cancer. TIL cell isolation can be achieved using a combination of mechanical disruption and enzymatic digestion (e.g., collagenase, hyaluronidase), followed by density gradient centrifugation (e.g., Ficoll) to enrich the lymphocytes. In vitro culture is typically performed in a specialized culture medium (e.g., RPMI 1640, AIM-V) supplemented with serum (e.g., fetal bovine serum), cytokines (e.g., high-dose IL-2), and antibiotics to maintain cell viability and promote proliferation. The logarithmic growth phase refers to the stage in which cells are highly active and proliferate rapidly. Typically, the cell density is between 0.5×10^6 / mL and 2×10^6 / mL, and the viability of cells is greater than 90%. At this time, the cells have a strong ability to take up and tolerate exogenous substances.

[0025] In a preferred embodiment, the introduction step is achieved via electroporation or liposome transfection. Electroporation uses brief, high-intensity electrical pulses to create reversible micropores in the cell membrane, allowing exogenous nucleic acid molecules to enter the cell. This method is highly efficient, especially suitable for difficult-to-transfect primary immune cells. Commonly used electroporators include the Lonza 4D-Nucleofector and Bio-Rad Gene Pulser. The voltage for electroporation is preferably 100V to 300V, more preferably 150V to 250V, and even more preferably 180V to 220V. The pulse duration is preferably 1ms to 10ms, more preferably 2ms to 8ms, and even more preferably 3ms to 5ms. Specific optimization procedures can be performed according to the recommendations of the selected electroporator model and accompanying reagent kit (such as Lonza's P3 Primary Cell Solution). Liposome transfection utilizes cationic liposomes to form complexes with negatively charged nucleic acids, which then enter the cell via memory action. This method is relatively simple to operate and may have lower cytotoxicity. In the liposome transfection method, the mass ratio of liposomes to the CRISPR-Cas9 gene editing system vector (usually plasmid DNA) is preferably 1:1 to 5:1, more preferably 2:1 to 4:1, and even more preferably 2.5:1 to 3.5:1. The incubation time is usually 4-6 hours.

[0026] In a preferred embodiment, the tumor-infiltrating lymphocytes are cultured in RPMI 1640 medium containing 10% to 20% fetal bovine serum (FBS) and 100 U / mL to 200 U / mL IL-2. FBS provides various growth factors, hormones, nutrients, and adhesion factors required for cell growth, and its concentration is further preferably 12% to 18%, more preferably 15%. IL-2 (interleukin-2) is a key cytokine for T cell growth and survival, and its concentration is further preferably 120 U / mL to 180 U / mL, more preferably 150 U / mL. Culture conditions are typically in a humidified incubator at 37°C with 5% CO2.

[0027] In a preferred embodiment, following the introduction step, the tumor-infiltrating lymphocytes are further cultured in a medium containing puromycin to screen for positive cells. The concentration of puromycin is typically from 0.5 μg / mL to 5 μg / mL, preferably from 1 μg / mL to 3 μg / mL, and more preferably 2 μg / mL. The screening period is typically from 5 to 10 days, preferably 7 days, during which the drug-containing fresh medium is periodically replaced to maintain screening pressure and remove dead cells.

[0028] In a preferred embodiment, following the introduction step, the tumor-infiltrating lymphocytes are further expanded in vitro to obtain the required number of cells for treatment. The culture medium used for the in vitro expansion culture can be the same as the aforementioned culture medium, i.e., RPMI 1640 medium containing 10% to 20% fetal bovine serum (preferably 15%) and 200 U / mL to 400 U / mL IL-2 (preferably 200 U / mL). The expansion culture is typically carried out in culture flasks, culture bags, or bioreactors, with cell growth maintained by periodically adding fresh culture medium and cytokines. The expansion cycle can last for several weeks until the cell number reaches the order of 10^8 to 10^10.

[0029] In a preferred embodiment, following the in vitro expansion and culture step, a further step is included: co-culturing the expanded tumor-infiltrating lymphocytes with tumor cells at a ratio of 1:1 to 20:1. This step can serve as a functional quality control assay before release of the cell product, used to evaluate its in vitro killing activity. The effector-to-target ratio (E:T) is further preferably 5:1 to 15:1, more preferably 10:1. The tumor cells can be selected from tumor cell lines matched to the patient's tumor type, such as A375 (melanoma), H1299 (non-small cell lung cancer), etc. The co-culture time is typically 24 to 72 hours.

[0030] This invention also provides the use of the aforementioned tumor-infiltrating lymphocytes with enhanced immune evasion resistance in the preparation of pharmaceutical compositions for treating tumors. The pharmaceutical composition comprises a therapeutically effective amount of the engineered TIL cells as the active ingredient, and pharmaceutically acceptable carriers, diluents, or excipients. "Pharmaceutically acceptable carriers" refer to substances that do not significantly irritate the body in the pharmaceutical formulation and do not interfere with the biological activity of the active ingredient, including but not limited to isotonic agents (such as sodium chloride, glucose), buffers (such as phosphate buffered saline, HEPES), stabilizers (such as human serum albumin, dextran), cryoprotectants (such as DMSO, hydroxyethyl starch), etc. The pharmaceutical composition can be formulated into an injectable dosage form suitable for intravenous infusion, such as a cell suspension. The tumor is preferably a solid tumor, including but not limited to melanoma, non-small cell lung cancer, renal cell carcinoma, ovarian cancer, cervical cancer, head and neck squamous cell carcinoma, gastric cancer, hepatocellular carcinoma, colorectal cancer, etc. More preferably, the tumor is a solid tumor that is sensitive to or resistant to immune checkpoint inhibitors. The administration of the pharmaceutical composition typically involves intravenous infusion of the engineered TILs after a lymphocyte-clearing pretreatment of the patient (e.g., using cyclophosphamide and fludarabine), possibly supplemented with supportive therapy using cytokines such as IL-2.

[0031] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0032] Example 1. sgRNA Design and Validation 1.1 Target sequence determination Reference sequences of human PD-1 (NM_005018.3), TIM-3 (HAVCR2) (NM_032782.5), and SMAD7 (NM_005904.4) genes were obtained from the NCBI database. Sequences within the key functional domains of the coding regions (CDS) of each gene were selected as target regions, with exon 2-4 being the preferred selection.

[0033] 1.2 sgRNA Design Using bioinformatics tools such as CRISPR Design Tool, Benchling, or CRISPOR, input the target gene sequence and set the parameters: sgRNA length 20nt, GC content 40%-60%, avoid more than 4 consecutive identical bases, screen for candidate sgRNA sequences 20nt upstream of the PAM sequence (NGG), ensuring no homology with other regions of the genome (low off-target risk). Design 3-5 candidate sgRNA sequences for each gene, and record their chromosomal location, sequence, and potential off-target sites.

[0034] (1) The CDS region sequence of exons 2–4 of the PDCD1 gene (RefSeq: NM_005018.3) was extracted. Based on the SpCas9 PAM sequence NGG, each exon sequence was scanned, and sgRNAs (20 nt) were selected and named as follows: PDCD1_ex2_sg1: TTCTCCCCAGCCCTGCTCGT (PAM: GG), as shown in SEQ ID NO.1; PDCD1_ex2_sg2: CCCTGCTCGTGGTGACCGA A (PAM: GG), as shown in SEQ ID NO.2; PDCD1_ex2_sg3: CCTGCTCGTGGTGACCGAAG (PAM: GG), as shown in SEQ ID NO.3; PDCD1_ex3_sg1: CCACCCCAGCCCCTCACCCA (PAM: GG), as shown in SEQ ID NO.4; PDCD1_ex3_sg2: GCCCCTCACCCAGGCCAGCC (PAM: GG), as shown in SEQ ID NO.5; PDCD1_ex3_sg3: GCCGGCCAGTTCCAAACCCT (PAM: GG), as shown in SEQ ID NO.6; PDCD1_ex4_sg1: CAATAGGAGCCAGGCGCACC (PAM: GG), as shown in SEQ ID NO.7; (2) For TIM-3 (NM_032782.5), sgRNA (20 nt) was screened out and named as follows: HAVCR2_ex2_sg1: AGGTCACTCAGAAGTGGAAT (PAM: GG), as shown in SEQ ID NO.8; HAVCR2_ex2_sg2: TCAGAAGTGGAATACAGAGC (PAM: GG), as shown in SEQ ID NO.9; HAVCR2_ex2_sg3: GAGGTCGGTCAGAATGCCTA (PAM: GG), as shown in SEQ ID NO.10; HAVCR2_ex3_sg1: ACCCCTGCACCGACTCGGCA (PAM: GG), as shown in SEQ ID NO.11; HAVCR2_ex3_sg2: TGCAGCCTTTCCAAGGATGC (PAM: GG), as shown in SEQ ID NO.12; HAVCR2_ex3_sg3: CCAGGATGCTTACCACCAGG (PAM: GG), as shown in SEQ ID NO.13; HAVCR2_ex4_sg1: GAGACACAGACACTGGGGAG (PAM: GG), as shown in SEQ ID NO.14; (3) For SMAD7 (NM_005904.4), sgRNA (20 nt) was screened out and named as follows: SMAD7_ex2_sg1: CCCCCCCCCTCCTTACTCCAG (PAM: TGG), as shown in SEQ ID NO.15; SMAD7_ex2_sg2:CTCCTTACTCCAGATACCCG (PAM:TGG), as shown in SEQ ID NO.16; SMAD7_ex3_sg1:ACTGTCCAGATGCTGTGCCT (PAM:TGG), as shown in SEQ ID NO.17; SMAD7_ex3_sg2:TGCCTTCCTCCGCTGAAACA (PAM:GGG), as shown in SEQ ID NO.18; SMAD7_ex3_sg3: CCTGGCCCCTGGGGGGCTTT (PAM: AGG), as shown in SEQ ID NO.19; SMAD7_ex4_sg1: GGAGCCTGGGGATCGGTCACA (PAM: TGG), as shown in SEQ ID NO.20; SMAD7_ex4_sg2: GCTCGGACAGCTCAATTCGGA (PAM: GGG), as shown in SEQ ID NO.21; SMAD7_ex4_sg3: GTGGTACACAAGGTGTTCCCC (PAM: GGG), as shown in SEQ ID NO.22; 1.3 sgRNA Synthesis Based on the screening results, a biotechnology company was commissioned to synthesize sgRNA oligonucleotide chains, with complementary restriction enzyme sites added to both ends of the sequence. BsmBI (also known as Esp3I) was selected as the cloning restriction enzyme site, and the design followed the standard sticky ends of the pLentiCRISPRv2 vector. The synthesized sgRNA was dissolved in RNase-free water, the concentration was adjusted to 100 μM, and stored at -80℃.

[0035] 1.4 Verification of in vitro cutting efficiency Construction of the target sequence reporter vector: A gene fragment (approximately 500 bp in length) containing the sgRNA target sequence is amplified by PCR, and the amplified fragment is cloned into the multiple cloning site of the pUC19 vector to construct a recombinant plasmid. Primer design principles: Primer length 18–24 bp, GC content 40–60%, Tm temperature 58–62℃, avoiding hairpin structures and obvious dimers.

[0036] Example primers are as follows (PDCD1 Exon 2 region): Forward: 5'-AGTGCTGCCATCTGCTCTGA-3', as shown in SEQ ID NO.23; Reverse: 5'-CAGGAGGGCTGAGGTTGTAG-3', as shown in SEQ ID NO.24; PCR reaction system (25 μL): 12.5 μL 2× Phanta Max Master Mix, 1 μL forward primer (10 μM) 1 μL reverse primer (10 μM) 1 μL template DNA (50 ng) Add ddH2O to a final volume of 25 μL.

[0037] PCR thermal cycling conditions: 95℃ for 3 minutes; Then perform 30–35 cycles: 95℃ 15 s, 58℃ 15-30 s, 72℃ 30 s; Finally, extend the heat to 72°C for 5 minutes.

[0038] In vitro cleavage reaction: Reaction system (20 μL): Cas9 protein (1 μg), sgRNA (2 μL), target sequence recombinant plasmid (1 μg), 10×CutSmart Buffer (2 μL), ddH2O added, incubated at 37℃ for 1 hour, and heated at 65℃ for 10 minutes to terminate the reaction; Cleavage efficiency detection: The reaction products were separated by 1.5% agarose gel electrophoresis. The gray value ratio of the cleaved band and the uncleaved band was analyzed using ImageJ software. sgRNA sequences with cleavage efficiency >80% were screened for subsequent experiments.

[0039] 2. Detailed steps for vector construction 2.1 Selection of Carrier Frame The lentiviral vector selected was pLentiCRISPRv2 (Takara Bio, 631253), which contains a Cas9 expression cassette and a puromycin resistance gene. The adeno-associated virus vector selected was pX601 (BioWind, 84040), which contains a Cas9 expression cassette and a GFP reporter gene. The vectors were stored at -20°C and thawed on ice before use.

[0040] 2.2 Vector digestion Take 10 μg of vector plasmid, add 2 μL of BsmBI restriction endonuclease (10 U / μL), 5 μL of 10×NEBuffer 3.1, and ddH2O to make up to 50 μL. Digest the enzyme in a water bath at 37℃ for 3 hours, and heat at 65℃ for 20 minutes to inactivate the enzyme activity. The digestion product is subjected to 1% agarose gel electrophoresis, and the linearized vector backbone is recovered by gel extraction (using a gel extraction kit).

[0041] 2.3 sgRNA Annealing and Ligation sgRNA annealing: Take 10 μL (100 μM) each of forward and reverse sgRNA, add 5 μL of 10×NEBuffer 2, and bring the volume to 50 μL with ddH2O; heat at 95℃ for 5 minutes, and cool naturally to room temperature to form double-stranded sgRNA; Ligation reaction: Reaction system (20 μL): linearized vector (50 ng), annealed sgRNA (5 μL), T4 DNA ligase (1 μL), 10×T4 ligase buffer (2 μL), ddH2O added; ligation overnight at 16℃.

[0042] 2.4 Transformation and Screening Add 5 μL of ligation product to 50 μL of Stbl3 competent cells, incubate on ice for 30 minutes, heat shock at 42°C for 45 seconds, immediately incubate on ice for 2 minutes, add 450 μL of LB medium, and incubate at 37°C for 1 hour. Spread 100 μL of the bacterial culture onto an LB agar plate containing ampicillin (100 μg / mL), incubate at 37°C overnight, pick single colonies, and inoculate into 5 mL of LB liquid medium containing ampicillin. Incubate at 37°C and 220 rpm for 12 hours.

[0043] 2.5 Vector sequencing validation Recombinant plasmids were extracted using a plasmid extraction kit and sequenced using universal vector primers (such as the U6 promoter primer for pLentiCRISPRv2: 5'-GAGGGCCTATTTCCCATGATT-3', as shown in SEQ ID NO.25). The sequencing results were compared with the designed sequence to confirm that the sgRNA was correctly inserted and without mutations. Positive clones were then screened and expanded for culture.

[0044] 3. TIL Cell Editing and Screening 3.1 TIL Cell Preparation TIL cells were isolated from the patient's tumor tissue and cultured in RPMI 1640 medium containing 10% fetal bovine serum, 100 IU / mL penicillin, 100 μg / mL streptomycin, and 300 IU / mL IL-2 until the cells reached the logarithmic growth phase (cell density 0.5-1 × 10⁻⁶). 6 (cells / mL, viability >90%), used for transfection experiments.

[0045] 3.2 Electroporation transfection Parameter settings (applicable to Lonza 4D-Nucleofector system): Cell suspension preparation: Take 1×10 6 Centrifuge TIL cells at 1500 rpm for 5 minutes, discard the supernatant, resuspend in 100 μL of P3 Primary Cell Solution, add 2 μg of recombinant plasmid, gently mix, and transfer to an electroporation cup. Select program EH-100 for electroporation. Immediately after electroporation, add 500 μL of preheated medium, transfer to a 6-well plate, and incubate at 37°C in a 5% CO2 incubator.

[0046] 3.3 Liposome Transfection Reagent preparation: Lipofectamine 3000 was diluted with Opti-MEM medium at a ratio of 1:50; Transfection system: Add 5×10 to each well of a 24-well plate. 5Add 1 μg of recombinant plasmid and 2 μL of Lipofectamine 3000 to each TIL cell (liposome to vector mass ratio 2:1), incubate at 37°C for 4-6 hours, then replace with fresh culture medium and continue incubation for 48 hours.

[0047] 3.4 Screening for positive cells Drug screening (for lentiviral vectors): 48 hours after transfection, puromycin (final concentration 2 μg / mL) was added for screening for 7 days, with the drug-containing culture medium changed every 2 days. Flow cytometry screening (for adeno-associated virus vector): 72 hours after transfection, cells were collected, washed twice with PBS, and the proportion of GFP-positive cells was detected using flow cytometry. GFP-positive cells were then sorted. + cell; PCR verification: Genomic DNA was extracted from the selected cells and amplified by PCR using target gene-specific primers (product length 300-500 bp). The amplified products were analyzed by T7E1 enzyme digestion to calculate the editing efficiency; Sequencing verification: The PCR product was cloned into the T vector, and 10 single clones were selected for sequencing to confirm the gene editing effect.

[0048] 4. Cell function testing 4.1 Co-culture of tumor cells and TIL cells Target tumor cell lines (such as melanoma A375 cells and lung cancer H1299 cells) were selected and cultured in RPMI 1640 medium containing 10% fetal bovine serum to the logarithmic growth phase. The ratio of TIL cells to tumor cells was adjusted to 1:1, 5:1, and 10:1, and the cells were seeded in 96-well plates (5 × 10⁶ tumor cells per well). 3 (each), and incubated at 37℃ in a 5% CO2 incubator for 24-72 hours.

[0049] 4.2 Killing Activity Detection MTT assay: After co-culture, add 20 μL of MTT solution (5 mg / mL) to each well, continue culturing for 4 hours, discard the supernatant, add 150 μL of DMSO to each well, shake for 10 minutes, and measure the absorbance at 490 nm using a microplate reader. Calculate the killing rate: Killing rate (%) = (1 - OD value of experimental group / OD value of control group) × 100%; LDH release assay: Follow the instructions of the LDH detection kit, collect the culture supernatant, add the substrate mixture, and react at room temperature in the dark for 30 minutes. Add the stop solution, and use an ELISA reader to detect the absorbance at 490 nm. Calculate the kill rate: Kill rate (%) = (OD value of experimental group - OD value of spontaneous release group) / (OD value of maximum release group - OD value of spontaneous release group) × 100%.

[0050] 4.3 Cytokine secretion detection Collect the supernatant after 48 hours of co-culture, centrifuge at 12000 rpm for 10 minutes at 4°C, and take the supernatant. ELISA assay: The levels of IFN-γ, TNF-α (pro-inflammatory factor) and TGF-β (inhibitory factor) were detected. The antibody was coated, the sample was added, incubated and colored according to the kit instructions. The absorbance value at 450 nm was detected by microplate reader. The cytokine concentration was calculated according to the standard curve. Each experiment was set up with 3 replicates and the experiment was repeated 3 times. The differences in data were statistically analyzed.

[0051] 4.4 Cell viability and proliferation detection CFSE staining was used: edited TIL cells were stained with 5 μM CFSE for 10 minutes and co-cultured with tumor cells. Cells were collected at 24, 48 and 72 hours, respectively. CFSE fluorescence intensity was detected by flow cytometry, cell proliferation index was analyzed, and the survival and proliferation ability of TIL cells in the tumor microenvironment were evaluated.

[0052] The experimental results of this invention are as follows: The validation results of CRISPR-Cas9 system editing of PDCD1, TIM-3 (HAVCR2) and SMAD7 genes are as follows: Figure 1 As shown. Among them, Figure 1 The in vitro cleavage experiment of A, as shown by agarose gel electrophoresis, shows that sgRNA designed for each target gene can guide the Cas9 protein to effectively cleave the target sequence. Figure 1 The cleavage efficiency statistics of B further quantified the in vitro cleavage activity of each sgRNA; Figure 1 C illustrates the exon structures of the three genes PDCD1, HAVCR2, and SMAD7, as well as the target sites of the sgRNA selected in this invention, in schematic form.

[0053] The effects of gene editing on TIL cell phenotype, such as Figure 2 As shown. Figure 2 A uses flow cytometry histograms to show the changes in fluorescence intensity distribution of PD-1, TIM-3, and SMAD7 proteins in the cell population before and after editing; Figure 2 B calculated the proportion of positive cells expressing the above proteins after editing; Figure 2C statistically analyzed the changes in average fluorescence intensity. The overall results indicate that gene editing significantly reduced the expression levels of PD-1, TIM-3, and SMAD7.

[0054] The functional evaluation results of edited TIL cells are shown in the figure. Figure 3 Cell proliferation index analysis using CFSE staining showed that the edited TIL cells exhibited stronger proliferative potential in the co-culture system, and their survival and proliferation abilities in the tumor microenvironment were significantly enhanced. Specifically, Figure 3 A shows the curves of tumor cell killing rate changes of TIL cells in the editing group and the control group at 24 h, 48 h, and 72 h under different effector-to-target ratios; Figure 3 B compared the levels of IFN-γ and TNF-α secreted by TIL cells in the editing group and the control group after co-culture for 48 h; Figure 3 C visually characterized the stronger proliferation of TIL cells in the editing group by the changes in CFSE fluorescence intensity at 0 h, 24 h, 48 h, and 72 h.

[0055] The functional evaluation results in the simulated tumor immunosuppressive microenvironment are shown below. Figure 4 . Figure 4 A shows the tumor cell killing rate changes of TIL cells in the editing group and the control group at multiple time points under different effector-target ratios (E:T = 1, 5, 10) in the presence of exogenous TGF-β. Figure 4 B compared the mean IFN-γ levels in the co-culture system under these conditions. Figure 4 C shows the tumor cell killing rate changes at multiple time points for the edited group and the control group TIL cells under high PD-L1 expression target cells. Figure 4 D compared the mean IFN-γ levels in the co-culture system under these conditions. The above results consistently indicate that the edited group TIL cells maintained significantly enhanced anti-tumor function in the simulated suppressive tumor microenvironment.

[0056] The results of the off-target effects, safety, and transformation risk assessment of gene-edited TIL cells are as follows: Figure 5 . Figure 5 A represents the predicted number of potential off-target sites for each sgRNA, stratified by the number of mismatches. Figure 5 B shows the comparison of karyotype analysis results of TIL cells before and after editing; Figure 5 C represents the results of the soft agar colony formation experiment; Figure 5 D represents the qPCR detection result of replicating lentivirus (RCL). Comprehensive evaluation shows that the editing system used in this invention has high specificity, and the edited cells exhibit good performance in terms of karyotype stability, risk of abnormal proliferation, and viral safety.

[0057] As demonstrated by the above embodiments, this invention provides an experimentally validated CRISPR-Cas9 system capable of efficiently editing the PD-1, TIM-3, and SMAD7 genes in tumor-infiltrating lymphocytes, as well as engineered cells obtained using this system. The specific sgRNA used in this system exhibits highly efficient target gene cleavage capability in vitro and successfully achieves significant knockdown of target protein expression at the cellular level. Tumor-infiltrating lymphocytes edited by this system show a significant reduction in the expression of key inhibitory receptors and demonstrate significantly enhanced tumor cell killing activity, cytokine secretion capacity, and proliferative potential compared to unedited cells in in vitro functional experiments. Their functional advantages are particularly pronounced under conditions simulating a tumor immunosuppressive microenvironment.

[0058] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A CRISPR-Cas9 gene editing system for enhancing immune evasion resistance of tumor-infiltrating lymphocytes, characterized in that, The system contains sgRNA targeting the PDCD-1, TIM-3, and SMAD7 genes, as well as the Cas9 nuclease.

2. The CRISPR-Cas9 gene editing system according to claim 1, characterized in that, The sequence of the sgRNA targeting the PDCD-1 gene is shown in any one of SEQ ID NO: 1 to SEQ ID NO:

7.

3. The CRISPR-Cas9 gene editing system according to claim 1, characterized in that, The sequence of the sgRNA targeting the TIM-3 gene is shown in any one of SEQ ID NO: 8 to SEQ ID NO:

14.

4. The CRISPR-Cas9 gene editing system according to claim 1, characterized in that, The sequence of the sgRNA targeting the SMAD7 gene is shown in any one of SEQ ID NO: 15 to SEQ ID NO:

23.

5. The CRISPR-Cas9 gene editing system according to any one of claims 1 to 4, characterized in that, The sgRNA and the gene encoding the Cas9 nuclease are constructed on a lentiviral vector or an adeno-associated virus vector.

6. The CRISPR-Cas9 gene editing system according to claim 5, characterized in that, The lentiviral vector is a pLentiCRISPRv2 vector containing a puromycin resistance gene, and the adeno-associated virus vector is a pX601 vector containing a green fluorescent protein reporter gene.

7. A tumor-infiltrating lymphocyte that enhances immune evasion resistance, characterized in that, The PDCD-1, TIM-3, and SMAD7 genes of the tumor-infiltrating lymphocytes are knocked out or inactivated by the CRISPR-Cas9 gene editing system as described in any one of claims 1 to 6.

8. A method for preparing tumor-infiltrating lymphocytes with enhanced immune evasion resistance as described in claim 7, characterized in that, The procedure includes the following steps: introducing the CRISPR-Cas9 gene editing system vector according to any one of claims 1 to 6 into tumor-infiltrating lymphocytes isolated from tumor tissue and cultured in the logarithmic growth phase via electroporation or liposome transfection.

9. The method according to claim 8, characterized in that, The voltage of the electroporation transfection method is 100V to 300V and the pulse time is 1ms to 10ms; In the liposome transfection method, the mass ratio of liposomes to the CRISPR-Cas9 gene editing system vector is 1:1 to 5:1; The tumor-infiltrating lymphocytes were cultured in RPMI 1640 medium containing 10% to 20% fetal bovine serum and 100 U / mL to 200 U / mL IL-2 at 37°C with a CO2 concentration of 5%. And / or, after the said importation step, the step of culturing the tumor-infiltrating lymphocytes in a culture medium containing puromycin to screen for positive cells is also included; And / or, after the introduction step, the method further includes an in vitro expansion culture of the tumor-infiltrating lymphocytes; the in vitro expansion culture is performed using an RPMI 1640 medium containing 10% to 20% fetal bovine serum and 200 U / mL to 400 U / mL IL-2. Following the in vitro expansion and culture step, the method further includes a step of co-culturing the expanded tumor-infiltrating lymphocytes with tumor cells at a ratio of 1:1 to 20:

1.

10. Use of the tumor-infiltrating lymphocytes with enhanced immune evasion resistance as described in claim 7 in the preparation of a pharmaceutical composition for treating tumors.

Images