SV molecular marker related to chicken semi-eviscerating weight and leg muscle weight characters and application of SV molecular marker

By designing SV molecular markers related to semi-eviscerated weight and leg muscle weight in chickens, and using primer sets for PCR amplification and electrophoresis detection, the shortcomings of existing technologies for selecting and breeding chicken carcass traits have been overcome, enabling accurate identification and efficient breeding of chicken carcass traits.

CN121896367AActive Publication Date: 2026-04-21SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202610101829.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-26
Publication Date
2026-04-21
Estimated Expiration
2046-01-26

AI Technical Summary

Technical Problem

In the current technology, the relationship between chicken semi-eviscerated weight and leg muscle weight traits and the MED21 gene has not been fully explored, resulting in a lack of effective molecular markers for chicken carcass trait selection breeding, making it difficult to accurately identify and breed chickens with high semi-eviscerated weight and high leg muscle weight.

Method used

A molecular marker SV associated with semi-eviscerated weight and leg muscle weight in chickens was designed. PCR amplification was performed using a primer set, and the marker was then detected by electrophoresis to accurately identify carcass traits in chickens. A kit product was provided for breeding selection.

Benefits of technology

It enables accurate prediction and stable screening of semi-eviscerated weight and leg muscle weight traits in chickens, laying the foundation for the breeding of chickens with high semi-eviscerated weight and high leg muscle weight, and providing a new molecular marker-assisted selection method.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121896367A_ABST
    Figure CN121896367A_ABST
Patent Text Reader

Abstract

The invention discloses an SV molecular marker related to chicken semi-eviscerating weight and leg muscle weight characters and application of the SV molecular marker, and belongs to the technical field of poultry breeding. The SV molecular marker provided by the invention is a section of 447 bp insertion variation located on a No.1 chromosome of a chicken T2T genome, and the nucleotide sequence of the SV molecular marker is as shown in SEQ ID NO.1. The invention designs a primer group with a nucleotide sequence as shown in SEQ ID NO.2-3, and develops a method for detecting the SV molecular marker. Experimental results show that the chicken semi-eviscerating weight character and the chicken leg muscle weight character can be accurately identified by utilizing the primer group and the detection method provided by the invention, and accurate prediction and stable screening of the chicken semi-eviscerating weight character and the chicken leg muscle weight character are realized. The invention provides a new molecular marker for assistant selective breeding of chicken carcass traits, and lays a foundation for breeding of chicken with heavy half eviscerating weight and high leg muscle.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of poultry breeding technology, and in particular to an SV molecular marker related to the semi-eviscerated weight and leg muscle weight traits of chickens and its application. Background Technology

[0002] In the commercial poultry industry, chickens are a core poultry breed, and their carcass performance indicators (such as breast muscle weight, leg weight, semi-eviscerated yield, and fully eviscerated yield) directly determine the economic benefits of the breeding process.

[0003] Genome variation is a key genetic source of phenotypic differences among individuals. Based on the size of the variant fragments, genome variation can be divided into three categories: single nucleotide polymorphisms (SNPs), insertions and deletions (Indels), and structural variations (SVs). Structural variations (SVs) are defined as changes in the length or orientation of DNA sequences longer than 50 bp within the genome. These variations encompass various types, including insertions (INS), deletions (DELs), inversions (INVs), duplications (DUPs), and translocations (TRAs).

[0004] The MED21 gene (Mediator Complex Subunit 21) encodes the core subunit of the Mediator Complex, a key molecular bridge in eukaryotic transcriptional regulation that connects transcription factors to RNA polymerase II, thereby regulating transcription initiation. SVs, as an important type of genomic variation, play a crucial role in the regulation of carcass traits in chickens; however, the relationship between carcass traits such as semi-eviscerated weight and leg muscle weight and the MED21 gene has not been fully explored. Summary of the Invention

[0005] The purpose of this invention is to provide an SV molecular marker related to chicken semi-eviscerated weight and leg muscle weight traits and its application, in order to solve the problems existing in the prior art. The primer set and detection method provided by this invention can accurately identify chicken semi-eviscerated weight and leg muscle weight traits. This invention provides a new molecular marker for assisted selection breeding of chicken carcass traits and lays the foundation for the breeding of chickens with high semi-eviscerated weight and high leg muscle weight.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] The present invention provides an SV molecular marker associated with chicken carcass traits, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] The present invention also provides a primer set for amplifying the above-mentioned SV molecular marker, comprising an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.3.

[0009] This invention provides an application of the above-mentioned primer set in the preparation of products for identifying chicken carcass traits, wherein the chicken carcass traits are semi-eviscerated weight and leg muscle weight.

[0010] Furthermore, the product is a reagent kit.

[0011] This invention provides a product for identifying the characteristics of chicken carcasses, comprising the aforementioned primer set.

[0012] Furthermore, the product is a reagent kit.

[0013] This invention provides an application of the above-mentioned primer set or the above-mentioned product in identifying chicken carcass traits, wherein the chicken carcass traits are semi-eviscerated weight and leg muscle weight.

[0014] This invention provides a method for identifying the characteristics of chicken carcasses, comprising the following steps:

[0015] DNA was extracted from the chicken to be tested, and PCR amplification was performed using the primer set or the product described above to obtain the amplification product.

[0016] The PCR amplification products were subjected to electrophoresis, staining, and development, and the bands were interpreted.

[0017] The carcass characteristics of the chicken are semi-eviscerated weight and leg muscle weight;

[0018] The interpretation band is:

[0019] If a single band of 114 bp is amplified, then the chicken to be tested is a chicken with low semi-eviscerated weight and low leg muscle weight.

[0020] If two bands of 114 bp and 561 bp are amplified, then the chicken to be tested is a chicken with high semi-eviscerated weight and high leg muscle weight.

[0021] This invention provides an application of the above-mentioned primer set or the above-mentioned product in the breeding of chicken carcass traits, wherein the chicken carcass traits are semi-eviscerated weight and leg muscle weight.

[0022] This invention provides a method for selecting and breeding chickens based on carcass traits, comprising the following steps:

[0023] DNA was extracted from the chicken to be tested, and PCR amplification was performed using the primer set or the product described above to obtain the amplification product.

[0024] The PCR amplification products were subjected to electrophoresis, staining, and development, and the bands were interpreted.

[0025] The carcass characteristics of the chicken are semi-eviscerated weight and leg muscle weight;

[0026] The interpretation band is:

[0027] If two bands of 114 bp and 561 bp are amplified, the chicken to be tested is retained for breeding.

[0028] The present invention discloses the following technical effects:

[0029] The SV molecular marker provided by this invention is a 447 bp insertion variant located in region 69554798 of chromosome 1 of the chicken T2T genome (GCA_024206055.2), and its nucleotide sequence is shown in SEQ ID NO.1. This invention designed a primer set with nucleotide sequences shown in SEQ ID NO.2-3 and developed a method for detecting this SV molecular marker. Experimental results show that the primer set and detection method provided by this invention can accurately identify chicken semi-eviscerated weight and leg muscle weight traits, achieving precise prediction and stable screening of these traits. This invention provides a new molecular marker for assisted selection breeding of chicken carcass traits, laying the foundation for the breeding of chickens with high semi-eviscerated weight and high leg muscle weight. Attached Figure Description

[0030] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0031] Figure 1 A schematic diagram illustrating the location of SV molecular markers on chromosomes and primer design;

[0032] Figure 2 The image shows the agarose gel electrophoresis results of this invention; where M is the DNA marker, "++" represents homozygous low half-weight and low leg weight types, and "+-" represents heterozygous high half-weight and high leg weight types. Detailed Implementation

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0035] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0036] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This specification and embodiments are merely exemplary.

[0037] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0038] Example 1: Development of SV Molecular Markers

[0039] The inventors constructed an F2 generation population by crossbreeding Xinghua chickens with recessive White Locker chickens. Sequence analysis of the F2 generation revealed an SV molecular marker in the chicken MED21 gene, with its nucleotide sequence shown in SEQ ID NO. 1, which was named MED21-447INS. This SV molecular marker is located in region 69554798 on chromosome 1 of the chicken T2T genome (GCA_024206055.2), and is a 447 bp insertion variant. Figure 1 As shown.

[0040] SEQ ID NO.1:

[0041] TGGCATTGGCTCTTCCCTGCCAAGCAGTCCGGCCCAGCCCTGAGTGTACAACCATCGTCAGCAACAACCAAACATCGGTTCACCATCAGACTTCTCTGGGCTGAAACCAGGACATGTTTGTAGAACTTAGCTTAGTTTGAGCATGACTTCTTAAGAACTATTTGCCCAGGTCTTAAGAACTTGGGTAATAGTTTTAAAAAGTATCGGAAGCTGTTTTATTTTC TCTCATTTGTAATTGAGTTGGAATAAGTTTGAGTAGTTTTAAATTTGGTAGAAGTTTTATTTCACCAACTTTGTCTAATGGAAAAACATTTTGGTTCAGGAATAAATTATGGAAAAGAAATACGGCTAAATAATATTTTCATGTGAAATATGCTATTTAATGGGAAGGTCTGAATAAACTATCCTGACATCTTATAGGGACCTTTCAGTAACTGTGTGGGGAA.

[0042] Example 2: Application of SV molecular markers

[0043] 1. Materials and Methods

[0044] 1.1 Animal Samples

[0045] A total of 474 80-day-old Ma Huang chickens were selected, and 2 mL of subcutaneous venous blood was collected and stored at -80℃ for DNA extraction. The following carcass traits were recorded: live weight, shank length, shank circumference, carcass weight, subcutaneous fat thickness, intramuscular fat width, semi-eviscerated weight, fully eviscerated weight, abdominal fat weight, breast muscle weight, leg muscle weight, breast muscle pH, leg muscle pH, breast muscle L value, breast muscle a value, breast muscle b value, leg muscle L value, leg muscle a value, leg muscle b value, dressing percentage, semi-eviscerated percentage, fully eviscerated percentage, abdominal fat percentage, breast muscle percentage, and leg muscle percentage.

[0046] 1.2 Main Reagents

[0047] Blood DNA Extraction Kit (Brand: OMEGA; Catalog No.: D3392; Guangzhou Feiyang Biotechnology Co., Ltd.), 2×ES Taq Master Mix (Dye) (Brand: Kangwei Century; Catalog No.: CW0690M; Kangwei Century Biotechnology Co., Ltd.), DNA marker (Brand: Tsingke; Catalog No.: MD101; Jiangsu Novizan Biotechnology Co., Ltd.), High Purity Low Electroosmotic Agarose (Brand: Qingke; Catalog No.: TSJ001; Beijing Qingke Biotechnology Co., Ltd.)

[0048] 1.3 Experimental Methods

[0049] 1.3.1 Primer Design

[0050] Primers were designed using the Primer-BLAST tool from NCBI (National Center for Biotechnology Information Search database) for the 300 bp upstream and downstream regions of the SV molecular marker (MED21-447INS) sequence obtained in Example 1. Primer synthesis services were provided by Guangzhou Qingke Biotechnology Co., Ltd. Primer sequence information is shown in Table 1. The amplification products were 114 bp or 561 bp in length.

[0051] Table 1. Primer sequences for PCR amplification

[0052] Primer name Primer sequence (5'-3') Serial Number MED21-F TAAAGCAGGCATGTCTAGC SEQ ID NO.2 MED21-R GGTTTCCTGAGAAGAAGTGA SEQ ID NO.3

[0053] 1.3.2 Blood Sample DNA Extraction

[0054] Extract DNA from blood samples according to the instructions of the blood sample DNA extraction kit.

[0055] 1.3.3 PCR amplification of SV molecular markers

[0056] Using the genomic DNA from the blood samples of the 474 chickens mentioned above as templates, PCR amplification was performed using the primers shown in Table 1, and the PCR amplification products were collected.

[0057] Reaction system: 2 μL template DNA, 15 μL 2×ES Taq Master Mix (Dye), 1.2 μL upstream primer, 1.2 μL downstream primer, 10.6 μL ddH2O.

[0058] Reaction procedure: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 15 s, 34 cycles; 72℃ final extension for 5 min; store at 4℃.

[0059] 1.3.4 Gel electrophoresis and genotyping

[0060] The PCR amplification products were detected by 1.5% agarose gel electrophoresis, and genotyping was performed based on the electrophoresis results.

[0061] 1.3.5 Association analysis between SV molecular markers and carcass traits

[0062] Association analysis was performed on the SV molecular markers and the corresponding genotypes of individuals using SPSS 26.0.

[0063] 2. Results

[0064] 2.1 PCR amplification and gel electrophoresis of SV molecular markers

[0065] The above 474 chicken individuals were selected, and PCR amplification was performed using blood sample DNA from each individual as a template. The obtained PCR products were detected by agarose gel electrophoresis, and the electrophoresis results were analyzed and recorded. Some results are shown below. Figure 2 As shown.

[0066] The nucleotide sequence of the 114 bp PCR product is shown in SEQ ID NO.4, specifically as follows:

[0067] TAAAGCAGGCATGTCTAGCCTGCAGGCCACATGCATCCCAGCACAGCTTGCAATGTGACCACCCCCTGCCCTGCACCACTGTGGGGATAAATACTCACTTCTTCTCAGGAAACC.

[0068] The nucleotide sequence of the 561 bp PCR product is shown in SEQ ID NO.5, specifically:

[0069] .

[0070] 2.2 Association analysis between SV molecular markers and carcass traits

[0071] Association analysis was performed between this SV molecular marker and carcass traits (breast angle, breast depth, breast width, live weight, tibia length, tibia circumference, body oblique length, keel length, comb height, carcass weight, subcutaneous fat thickness, intramuscular fat width, semi-eviscerated weight, fully eviscerated weight, abdominal fat weight, wing weight, breast muscle weight, leg muscle weight, chicken foot weight, breast muscle shear force, leg muscle shear force, drip loss rate, cooking loss rate, breast muscle pH value, leg muscle pH value, breast muscle L value, breast muscle a value, breast muscle b value, leg muscle L value, leg muscle a value, leg muscle b value, dressing percentage, semi-eviscerated percentage, fully eviscerated percentage, abdominal fat percentage, breast muscle percentage, leg muscle percentage, etc.).

[0072] The results are shown in Table 2. The results showed a significant correlation between SV molecular markers and semi-eviscerated weight (P<0.05), with significant differences in semi-eviscerated weight between the "++" and "+-" types (P<0.05). Therefore, when the amplification product band was 114 bp, it represented a homozygous low semi-eviscerated weight chicken; when the amplification product bands were 114 bp and 561 bp, it represented a heterozygous high semi-eviscerated weight chicken.

[0073] Table 2 Association between SV molecular markers and carcass traits

[0074]

[0075] Note: In the table, + indicates no insertion, - indicates insertion, and different superscript letters (a or b) indicate significant differences (P<0.05).

[0076] The results are shown in Table 3. The results showed a significant correlation between SV molecular markers and leg weight (P<0.05), with significant differences in leg weight between the "++" and "+-" types (P<0.05). Therefore, when the amplification product band was 114 bp, it indicated a homozygous low-leg-weight chicken; when the amplification product bands were 114 bp and 561 bp, it indicated a heterozygous high-leg-weight chicken.

[0077] Table 3 Association between SV molecular markers and carcass traits

[0078]

[0079] Note: In the table, + indicates no insertion, - indicates insertion, and different superscript letters (a or b) indicate significant differences (P<0.05).

[0080] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. An SV molecular marker associated with chicken carcass traits, characterized in that, The nucleotide sequence of the SV molecular marker is shown in SEQ ID NO.

1.

2. A primer set for amplifying the SV molecular marker of claim 1, characterized in that, This includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.

3.

3. The application of the primer set according to claim 2 in the preparation of products for identifying chicken carcass traits, characterized in that, The carcass characteristics of the chicken are semi-eviscerated weight and leg muscle weight.

4. The application as described in claim 3, characterized in that, The product in question is a reagent kit.

5. A product for identifying the characteristics of chicken carcasses, characterized in that, Includes the primer set as described in claim 2.

6. The product as described in claim 5, characterized in that, The product in question is a reagent kit.

7. The application of the primer set as described in claim 2 or the product as described in claim 5 or 6 in identifying chicken carcass traits, characterized in that, The carcass characteristics of the chicken are semi-eviscerated weight and leg muscle weight.

8. A method for identifying the characteristics of chicken carcasses, characterized in that, Includes the following steps: DNA was extracted from the chicken to be tested, and PCR amplification was performed using the primer set described in claim 2 or the product described in claim 5 or 6 to obtain the amplification product; The PCR amplification products were subjected to electrophoresis, staining, and development, and the bands were interpreted. The carcass characteristics of the chicken are semi-eviscerated weight and leg muscle weight; The interpretation band is: If a single band of 114 bp is amplified, then the chicken to be tested is a chicken with low semi-eviscerated weight and low leg muscle weight. If two bands of 114 bp and 561 bp are amplified, then the chicken to be tested is a chicken with high semi-eviscerated weight and high leg muscle weight.

9. The application of the primer set as described in claim 2 or the product as described in claim 5 or 6 in chicken carcass trait breeding, characterized in that, The carcass characteristics of the chicken are semi-eviscerated weight and leg muscle weight.

10. A method for selecting chickens based on carcass traits, characterized in that, Includes the following steps: DNA was extracted from the chicken to be tested, and PCR amplification was performed using the primer set described in claim 2 or the product described in claim 5 or 6 to obtain the amplification product; The PCR amplification products were subjected to electrophoresis, staining, and development, and the bands were interpreted. The carcass characteristics of the chicken are semi-eviscerated weight and leg muscle weight; The interpretation band is: If two bands of 114 bp and 561 bp are amplified, the chicken to be tested will be retained for breeding.

Citation Information

Patent Citations

  • Molecular marker related to chicken carcass traits and application

    CN116590431A

  • Application of multiple-effect molecular marker for simultaneously indicating abdominal fat character, leg muscle character and reproduction character of chicken

    CN118460727A

  • EP300 gene single nucleotide polymorphism molecular marker related to chicken carcass traits and application thereof

    CN120158522A

  • Molecular marker of IGF2BP1 gene related to chicken body size trait and use thereof, and breeding method

    US20240018603A1