Development and application of linked molecular marker of corn kernel dehydration main effect QTLqKMC4

By developing molecular markers based on KASP technology, the moisture content and dehydration rate of maize kernels were detected, solving the problem of excessive moisture content in maize kernels. This enabled efficient breeding and rapid screening of maize varieties suitable for mechanized harvesting, improving breeding and selection efficiency.

CN121896384APending Publication Date: 2026-04-21NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NORTHWEST A & F UNIV
Filing Date
2024-10-18
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

In existing technologies, the high moisture content of corn kernels at harvest time limits the development of mechanized corn harvesting, and there is a lack of effective molecular markers for assisted breeding to improve breeding efficiency.

Method used

Molecular markers based on KASP technology were developed. By detecting the genotype of specific SNP sites in the maize genome, especially the SNP site located at 173,028,507 bp on maize chromosome 4, PCR amplification was performed using primer combinations and fluorescence detection was performed to determine the moisture content and dehydration rate of maize kernels. Maize with the CC genotype was selected as the parent for breeding.

Benefits of technology

It enables efficient and rapid identification of corn kernel moisture content and dehydration rate, improves breeding efficiency, and allows for the rapid screening of corn varieties suitable for mechanized harvesting, thereby reducing production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005090618030000061
    Figure BDA0005090618030000061
  • Figure BDA0005090618030000091
    Figure BDA0005090618030000091
  • Figure BDA0005090618030000101
    Figure BDA0005090618030000101
Patent Text Reader

Abstract

The invention discloses development and application of a linked molecular marker of a corn kernel dehydration major QTL (Quantitative Trait Loci). The invention belongs to the field of genetic breeding, and relates to development and application of a linked molecular marker of a corn kernel dehydration major QTL (Quantitative Trait Loci). The method for identifying or assisting in identifying the water content and / or the dehydration rate of the corn kernels comprises the steps that the genotype of an SNP site in a to-be-detected corn genome is detected, the water content and / or the dehydration rate of the corn kernels are identified or assisting in identifying according to the genotype, the SNP site is a site on a corn chromosome 4, the nucleotide variety of the SNP site is C or T, and the SNP site is a site on a corn chromosome 4. The nucleotide is the 20th nucleotide of the sequence 1 in the sequence table. The method established by the invention can be used for predicting the water content and / or dehydration rate of corn kernels, can be used for early screening of corn to be screened, and can be used for corn molecular marker-assisted breeding. The method has important application value in digging corn germplasm resources with low corn kernel water content and high dehydration rate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic breeding and relates to the development and application of linkage molecular markers for major QTLs of maize kernel dehydration. Background Technology

[0002] Corn is one of the world's most important food crops, serving as food, feed, and industrial raw material, playing a vital role in human production and daily life. Agricultural mechanization is a crucial measure for achieving agricultural modernization, encompassing the mechanization of the entire crop growth cycle. While some developed countries, such as the United States and Germany, have already achieved mechanized corn harvesting, my country currently faces technical challenges, namely, excessively high moisture content in the corn kernels at harvest time. A moisture content of 15-25% in the corn kernels at harvest time is ideal for mechanized harvesting, minimizing breakage and impurity rates. Therefore, researching genes that accelerate kernel dehydration and developing new corn varieties suitable for mechanized harvesting are important research directions for corn in my country.

[0003] Currently, several QTL loci associated with grain dehydration have been identified, involving all ten maize chromosomes. Molecular markers can be developed to assist field breeding targeting specific QTL loci, reducing the randomness of field selection and increasing breeding efficiency. However, no corresponding molecular markers have been developed for most dehydration-related QTL loci, limiting the development of mechanized maize harvesting. Therefore, developing dehydration-related molecular markers and combining them with field breeding is an effective method for rapidly selecting maize varieties suitable for mechanized harvesting.

[0004] SNP markers are widely distributed across the maize genome, possessing advantages such as large numbers and rich polymorphism, making them suitable for high-throughput, rapid detection of genotypes at specific loci. KASP (Kompetitive Allele-Specific PCR) uses fluorescent probes to specifically identify specific genomic loci, enabling high-throughput detection of SNP sites at a lower cost. KASP results can be directly read using a fluorescence microplate reader or quantitative PCR instrument, eliminating the need for costly, low-throughput methods such as electrophoresis, making it suitable for genotyping in large-scale field populations. Therefore, developing high-throughput KASP markers related to grain dehydration is of great significance for promoting the identification of maize grain dehydration sites and improving field breeding efficiency. Summary of the Invention

[0005] The problem to be solved by this invention is how to identify or assist in the identification of corn kernel moisture content and / or dehydration rate in high throughput.

[0006] To address the above technical problems, this invention first provides a method for identifying or assisting in the identification of maize kernel moisture content and / or dehydration rate, comprising detecting the genotype of SNP loci in the genome of the maize to be tested, identifying or assisting in the identification of maize kernel moisture content and / or dehydration rate based on the genotype of the SNP loci, wherein the genotype of the SNP loci is CC, CT, or TT, wherein CC is a homozygous type of the SNP loci being C, and TT is a homozygous type of the SNP loci being T; CT is a heterozygous type of the SNP loci being C and T, and the kernel moisture content of the maize to be tested with the genotype CC at the SNP loci is lower than and / or the dehydration rate is faster than that of the maize to be tested with the genotypes TT and / or CT at the SNP loci.

[0007] The genome sequence of maize variety B73 (RefGen_v3) was used as the reference genome, and the SNP site was located at 173,028,507 bp on maize chromosome 4 (specifically, the 20th nucleotide of sequence 1 in the sequence listing).

[0008] As one implementation, the method for identifying or assisting in the identification of corn kernel moisture content and dehydration rate may include the following steps:

[0009] (1) Using the genomic DNA of the maize to be tested as a template, KASP amplification was performed using a primer composition; the primer composition consisted of primer A, primer B and primer C;

[0010] Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-42 of sequence 2 in the sequence listing;

[0011] Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-41 of sequence 3 in the sequence listing.

[0012] Primer C is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence listing;

[0013] (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP in the corn to be tested;

[0014] (3) Identify the kernel moisture content and / or dehydration rate of the maize to be tested based on the genotype results: The kernel moisture content of the maize to be tested with the genotype CC at the SNP site is lower than and / or the dehydration rate is faster than that of the maize to be tested with the genotype TT at the SNP site.

[0015] The application of the above methods in maize breeding also falls within the scope of protection of this invention.

[0016] This invention also provides a method for maize breeding.

[0017] The maize breeding method provided by the present invention includes detecting the genotype of the SNP site in the maize genome, selecting maize with the genotype CC at the SNP site as the parent for breeding, wherein the genotype CC is a homozygous type of the SNP site with nucleotide C.

[0018] In this invention, the purpose of the corn breeding is to select and cultivate corn varieties with rapidly dehydrated kernels.

[0019] As an implementation method, maize breeding methods may include the following steps:

[0020] (1) Using the genomic DNA of the maize to be tested as a template, KASP amplification was performed using the above primer set;

[0021] (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP site in the maize to be tested;

[0022] (3) Select maize germplasm with genotype CC for breeding maize with superior grain moisture content and / or dehydration rate.

[0023] In the above method, the primer dissolution and preparation method can be as follows: First, dilute the three primers to 100mM with ddH2O, and then prepare the primer working solution as follows: 12μL of primer A, 12μL of primer B, 30μL of primer C, and 46μL of ddH2O. This solution is used as the KASP-labeled primer working solution and stored at -20℃ for later use.

[0024] In the above method, the PCR reaction system can be as follows: 2×KASP Mastermix volume is 2μL, primer mix volume is 0.056μL, genomic DNA concentration is about 100ng / μL volume is 1μL, and ultrapure water is added to make up to 4μL.

[0025] In the above methods, PCR amplification can be performed on a high-throughput PCR instrument.

[0026] In the above method, the PCR reaction procedure can be as follows:

[0027] Step 1: Pre-denaturation at 94℃ for 15 min;

[0028] Step 2: Denaturation at 94℃ for 20 seconds, annealing for 20 seconds (the first annealing temperature is 61℃, and the temperature decreases by 0.6℃ for each cycle) for a total of 10 cycles; denaturation at 94℃ for 20 seconds, annealing at 55℃ for 1 minute for a total of 32 cycles;

[0029] The method described above for determining the genotype of the SNP in the maize sample is as follows: After the PCR reaction, a fluorescence signal reader and a fluorescence detection system are used to convert the fluorescence signal into analyzable values ​​to read the fluorescence data of the reaction products (data reading temperature is below 40℃). The fluorescence scanning results are then used to perform genotyping using KlusterCaller software. TT base types exhibit FAM fluorescence, distributed near the Y-axis; CC base types exhibit HEX fluorescence, distributed near the X-axis; samples with no detected signal are distributed near the origin.

[0030] This invention also provides the application of a substance for detecting KASP polymorphisms or genotypes in the maize genome in any of the following:

[0031] (1) To identify or assist in the identification of corn kernel moisture content and / or dehydration rate;

[0032] (2) Maize breeding;

[0033] (3) Prepare products for identifying or assisting in the identification of corn kernel moisture content and / or dehydration rate;

[0034] (4) Prepare products for maize breeding;

[0035] The SNP site is a site on maize chromosome 4, and its nucleotide type is C or T, which is the 20th nucleotide of sequence 1 in the sequence listing.

[0036] This invention also provides products for detecting polymorphisms or genotypes of SNP sites in the maize genome.

[0037] The product provided by this invention for detecting the polymorphism or genotype of the SNP sites in the maize genome contains the aforementioned substances for detecting the polymorphism or genotype of SNP sites in the maize genome, and the product is any one of the following:

[0038] C1) Products that detect single nucleotide polymorphisms or genotypes related to corn kernel moisture content and / or dehydration rate;

[0039] C2) Products used to identify or assist in identifying the moisture content and / or dehydration rate of corn kernels;

[0040] C3) Products used in maize breeding.

[0041] In the above applications, methods, and products, the substance may be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chips. The SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on one-step reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.

[0042] Optionally, the substance is D1), D2), or D3):

[0043] D1) The substance described is a primer composition for amplifying maize genomic DNA fragments including the SNP sites;

[0044] D2) The substance described is a PCR reagent containing the primer composition described in D1);

[0045] D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0046] Optionally, the amplification may be PCR amplification. The primer composition consists of primer A, primer B, and primer C.

[0047] The kit described in D3 may also include KASP Master Mix.

[0048] In the above applications, methods, and products, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive markers, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading). The primer composition described herein may be a primer composition consisting of single-stranded DNA with nucleotide sequences of positions 22-42 of sequence 2 in the sequence listing, single-stranded DNA with nucleotide sequences of positions 22-41 of sequence 3 in the sequence listing, and single-stranded DNA with nucleotide sequences of sequence 4 in the sequence listing. Alternatively, the primer composition may be a primer set consisting of single-stranded DNA shown in sequence 2, sequence 3, and sequence 4 in the sequence listing. Sequence 2 in the sequence listing consists of 42 nucleotides, with nucleotides 1-21 being the FAM sequence (as a marker) and nucleotides 22-42 being the specific sequence; sequence 3 in the sequence listing consists of 41 nucleotides, with nucleotides 1-21 being the HEX sequence (as a marker) and nucleotides 22-41 being the specific sequence.

[0049] The present invention also provides a DNA molecule, the nucleotide sequence of which is shown in Sequence 1 of the sequence listing.

[0050] The applications of the aforementioned DNA molecules also fall within the scope of protection of this invention. Specifically, the applications may be any of the following:

[0051] (1) To identify or assist in the identification of corn kernel moisture content and / or dehydration rate;

[0052] (2) Maize breeding;

[0053] (3) Prepare products for identifying or assisting in the identification of corn kernel moisture content and / or dehydration rate;

[0054] (4) Prepare products for maize breeding.

[0055] Optionally, in the above applications, the DNA molecule serves as a detection target.

[0056] The substance that detects the SNP site polymorphism and genotype can be combined with other substances (such as substances that detect single nucleotide polymorphisms or genotypes of other molecular markers related to corn kernel moisture content and / or dehydration rate) to prepare a product for identifying corn varieties with corn kernel moisture content and / or dehydration rate.

[0057] In this document, the breeding objectives may include developing maize with low kernel moisture content and / or a rapid dehydration rate. The maize may be a pure line or an inbred line.

[0058] This invention provides a primer composition and a method for identifying or assisting in the identification of maize kernel moisture content and / or dehydration rate using the primer composition. The method established by this invention can be used to predict maize kernel moisture content and / or dehydration rate, for early screening of maize to be screened, and for marker-assisted breeding of maize. It has significant application value in the research of identifying maize germplasm resources with low kernel moisture content and rapid dehydration rate, and in the breeding of maize varieties with low kernel moisture content and rapid dehydration rate. Attached Figure Description

[0059] Figure 1 Phenotypes of grain moisture content for the fast-dehydrating parent KA105 and the slow-dehydrating parent KB020.

[0060] Figure 2 This is a map showing the distribution of grain moisture content in a population of recombinant inbred lines.

[0061] Figure 3 This is a distribution diagram of grain dehydration rate in a population of recombinant inbred lines.

[0062] Figure 4 This is the QTL positioning map for the primary QTLqKMC4.

[0063] Figure 5 The phenotypic plot and phenotypic T-test results of KASP-labeled KASP_KMC4 in the recombinant inbred line population (RIL population).

[0064] Figure 6 The phenotypic plot and phenotype T-test results of KASP-labeled KASP_KMC4 in the associated population were presented. Detailed Implementation

[0065] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0066] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0067] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0068] The maize inbred lines KA105 and KB020 in the following examples were developed by the Key Laboratory of Maize Biology and Genetic Breeding, College of Agriculture, Northwest A&F University, and have been described in: Zhao Z, He K, Feng Z, et al. Evaluation of Yield-Based Low Nitrogen Tolerance Indices for Screening Maize (Zea mays L.) Inbred Lines[J]. Agronomy, 2019, 9(5): 240. DOI: 10.3390 / agronomy9050240. The biological material is available to the public from the applicant and is used only for repeating the experiments of this invention and shall not be used for any other purpose.

[0069] The KA105×KB020 recombinant inbred line population in the following examples was obtained by single-seed transfer.

[0070] The 110 maize inbred lines from the associated population in the following examples have been described in: Qu J, Xu S, Gou X, Zhang H, Cheng Q, Wang X, Ma C, Xue J. 2022. Time-resolved multiomics analysis of the genetic regulation of maize kernel moisture. The Crop Journal. This biological material is available to the public from the applicant and is intended solely for the purpose of replicating experiments of this invention and may not be used for any other purpose.

[0071] The following examples use EXCEL software to process the data. The experimental results are expressed as mean ± standard deviation. The T-test is used to distinguish the differences between independent samples. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference.

[0072] Example 1: Obtaining the SNP marker chip site Affx-291408970 and KASP marker primer set related to maize kernel moisture content and dehydration rate.

[0073] 1. Determination of moisture content and dehydration rate of corn kernels

[0074] In May 2021, KA105 and KB020 and their recombinant inbred line populations (a total of 208 families) were sown at the Guancun Maize Experimental Base of Northwest A&F University in Yangling, Shaanxi Province. Each family was planted in 2 rows with a row length of 5m, with two replicates, for a total of 840 rows, which were used for genetic analysis and gene mapping of grain dehydration.

[0075] Normal field management was carried out. All individual plants were self-pollinated, and the pollination date was recorded. Grain moisture content was measured using the needle prick method at 35, 42, 49, and 56 days post-pollination. The grain dehydration rate was determined using the area under the dehydration curve (AUDDC) method. The formula for calculating the grain dehydration rate is as follows:

[0076]

[0077] Where: n is the number of times the kernel moisture content is measured; i is the i-th measurement; M is the corn kernel moisture content, %; t is the number of days after physiological maturity; t i denoted as the number of days after physiological maturity when the water content is measured for the i-th time.

[0078] The results are as follows Figure 1 As shown, the grain moisture content of the rapid dehydration inbred line KA105 was significantly lower than that of KB020, with average grain moisture contents of 38.9%, 37.7%, 35.7%, and 31.0% (35 days, 42 days, 49 days, and 56 days), while the average grain moisture content of KB020 was 42.2%, 41.2%, 36.9%, and 34.0% (35 days, 42 days, 49 days, and 56 days).

[0079] 2. QTL mapping related to maize kernel moisture content and dehydration rate, and discovery of chip locus Affx-291408970.

[0080] 1) 208 materials were planted in the culture room, and 200 seedling materials were obtained. At the three-leaf stage, leaves were taken for DNA extraction. A total of 200 DNA samples of maize inbred lines were extracted, of which 138 DNA samples were used for subsequent KASP typing.

[0081] The results are as follows Figure 2 and Figure 3 As shown, the recombinant inbred line population of KA105×KB020 (RIL population) exhibits a normal distribution on the distribution map of grain moisture content and dehydration rate, which conforms to the quantitative trait segregation, indicating that this trait is controlled by multiple genes.

[0082] 2) Based on SNP data obtained from the maize 6H60K chip and phenotypic data measured in the field, linkage analysis was performed on the molecular marker genotype data of the RIL population using QTLIciMapping software to construct a molecular marker genetic linkage map. Based on this map and phenotypic data of 208 RIL populations under three environments, QTL detection was performed. A QTL locus was detected on maize chromosome 4, located between SNP molecular markers Affx-291408970 and Affx-291436521, with a physical distance of approximately 181 KB. The contribution rate of this QTL was 7.49-9.09%, and the additive effect was (-0.68)-(-6.24)( Figure 4 Furthermore, the rapid dehydration gene originates from the parent KA105, and this QTL is named qKMC4.

[0083] 3. Linkage analysis of KASP tag KASP_KMC4

[0084] DNA was extracted from the recombinant inbred line population KA105×KB020 and the two parents using the CTAB method for marker identification. First, SNP markers were mined within the QTL interval based on previously determined maize 60K SNP marker information. Then, KASP marker primers were designed for the SNP markers using the online platform Primer3 (https: / / bioinfo.ut.ee / primer3-0.4.0 / ). The primers were then mixed with KASP Mix for PCR amplification, and the amplification results were analyzed using KlusterCaller software.

[0085] Analysis revealed that the SNP site Affx-291408970 is linked to the QTL site qKMC4, which was named KASP_KMC4 for marker-assisted selection breeding. The SNP site Affx-291408970 is position 20 of sequence 1, and its nucleotide type is C or T. The 'y' in sequence 4 of the sequence listing represents C or T.

[0086] 4. Obtaining the primer set for the KASP-tagged KASP_KMC

[0087] A primer set for detecting the KASP marker KASP_KMC4 based on KASP technology was designed, referred to as the KASP primer set. The KASP primer set consists of two upstream primers (primer A and primer B) and one downstream primer (primer C). The specific KASP primer set sequence is as follows:

[0088] Primer A: 5'- GAAGGTGACCAAGTTCATGCT TCGTGTTGGTTCAGGATTGCT-3'(Sequence 2)

[0089] Primer B: 5'- GAAGGTCGGAGTCAACGGATTCGTGTTGGTTCAGGATTGCC-3' (sequence 3)

[0090] Primer C: 5'-AGTTAGGCAGCTGCTTGATTTTCG-3' (Sequence 4)

[0091] PCR product: 5'-CGTGTTGGTTCAGGATTGCyACTCGAAAATCAAGCAGCTGCCTAACT-3' (sequence 1), where y represents C or T.

[0092] Primer A is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the fragment with SNP site Affx-291408970 as T. The fluorescent signal of the FAM group can be read using a fluorescence signal reader.

[0093] Primer B is a primer with a HEX fluorescent tag sequence (underlined bases) at the 5' end, and primer C amplifies the fragment with SNP site Affx-291408970 as C. The fluorescent signal of the HEX group can be read using a fluorescence signal reader.

[0094] The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The KASP Master Mix was purchased from Beijing Jiacheng Biotechnology Co., Ltd.

[0095] Example 2: Establishment of a method for detecting the genotype of SNP marker Affx-291408970 using KASP markers

[0096] The KASP marker KASP_KMC4 was used to detect different allele types of maize kernel moisture content and dehydration rate at physical location 173,028,507 on maize chromosome 4 (SNP site Affx-291408970).

[0097] 1. PCR amplification system and procedure

[0098] Genomic DNA was extracted from common maize leaves using the CTAB method and dissolved in 100 μL of ddH2O. The DNA was then subjected to 1% agarose gel electrophoresis for quality assessment; the extracted DNA was required to be free of obvious impurities, have clear bands, and show no degradation. After DNA concentration determination, it was uniformly diluted to 100 ng / μL, and PCR amplification was performed using the diluted maize genomic DNA as a template.

[0099] Prepare the primer mix: 12 mM each of primer A and primer B (see Example 1 for specific sequences), and 30 mM of primer C (see Example 1 for specific sequences).

[0100] PCR amplification reaction system (4μL): PCR reagent composition: 2×KASP Mastermix volume is 2μL, primer mix volume is 0.056μL, genomic DNA concentration is about 100ng / μL volume is 1μL, and ultrapure water is added to 4μL.

[0101] The PCR reaction program was the Touchdown program: 94℃ pre-denaturation for 15 min, 94℃ denaturation for 20 s; 61℃ annealing for 60 s, decreasing by 0.6℃ per cycle, for 10 cycles; 94℃ denaturation for 20 s, 55℃ annealing for 60 s, for 32 cycles.

[0102] 2. Genotyping

[0103] After the PCR reaction is complete, the terminal fluorescence reading is read in a FLUOstar Omega microplate reader. Then, the data is imported into KlusterCaller software for genotyping. If the genotyping is not obvious, it is generally necessary to add 3 more cycles before genotyping.

[0104] The FAM excitation wavelength is 485 nm, and the emission wavelength is 520 nm. The HEX excitation wavelength is 535 nm, and the emission wavelength is 556 nm. The system reference fluorescence ROX excitation wavelength is 575 nm, and the emission wavelength is 610 nm.

[0105] The results are as follows Figure 5 As shown: If only the FAM group shows a fluorescent signal (blue fluorescence), the genotype of the maize sample Affx-291408970 is TT (i.e., the SNP site Affx-291408970 in the maize genome is homozygous for T); if only the HEX group shows a fluorescent signal (red fluorescence), the genotype of the maize sample Affx-291408970 is CC (i.e., the SNP site Affx-291408970 in the maize genome is homozygous for C); if a green fluorescent signal is shown, the genotype of the maize sample Affx-291408970 is CT (i.e., the SNP site Affx-291408970 in the maize genome is heterozygous for both C and T); if a yellow signal is shown, it indicates a failed genotyping.

[0106] Example 3: Application of KASP_KMC3 in assisting the identification of maize kernel moisture content and dehydration rate, and in maize breeding.

[0107] In 2019, phenotypic identification of 110 inbred lines from related populations was conducted at the Guancun Maize Experimental Base of Northwest A&F University, Yangling District, Xianyang City, Shaanxi Province. A completely randomized block design was adopted, with a row length of 4.5 m, row spacing of 0.6 cm, and plant spacing of 20 cm. Normal field management was carried out, and all individual plants were self-pollinated, with pollination dates recorded. The kernel moisture content was measured using the oven drying method at 35, 42, 49, and 56 days after pollination, and the kernel dehydration rate was determined using the AUDDC method. Kernel moisture content (%) = [(W1-W2) / W1] × 100%.

[0108] Test method: Uniformly grown ears of grain were selected at 35, 42, 49, and 56 days after self-pollination. The grains were immediately threshed after sampling. One hundred intact grains were taken and their fresh weight (W1) was measured using an electronic balance (unit: 0.0001g). The grains were then blanched in a 105℃ oven for 30 minutes and dried in an 85℃ oven until constant weight (three consecutive measurements with consistent values). The dry weight (W2) was then measured and recorded. The grain moisture content can be calculated by substituting the weights into the formula above.

[0109] Simultaneously, samples were collected during the seedling stage, and total DNA was extracted from maize leaves. The KASP_KMC4 marker genotype detection method was referenced in Example 2. The results are shown in Table 1. CC indicates that the genotype of SNP locus Affx-291408970 in the maize material is CC, TT indicates that the genotype of SNP locus Affx-291408970 in the maize material is TT, and CT indicates that the genotype of SNP locus Affx-291408970 in the maize material is CT.

[0110] Table 1. Genotypes of KASP_KMC4 markers and phenotypic information on maize kernel moisture content and dehydration rate of 110 related inbred lines.

[0111]

[0112]

[0113]

[0114]

[0115] Note: NA indicates missing data.

[0116] The genotype of the SNP site Affx-291408970 was determined using the molecular marker KASP_KMC4, and the genotypes of each individual plant were obtained. The results were shown in Table 1 and... Figure 6KASP marker detection revealed that among the 110 inbred lines in the associated population, 55 inbred lines were QTL qKMC4 allele type TT (i.e., the SNP locus Affx-291408970 has the TT genotype), with grain moisture content of 41.03±4.02 (42 days post-pollination) and 33.74±5.77 (49 days post-pollination), and grain dehydration rate of 261.72±32.32 (42-49 days post-pollination); 45 inbred lines were QTL qKMC4 allele type TT. The qKMC4 allele type CC (genotype CC at SNP locus Affx-291408970) had a grain moisture content of 38.78±4.30 (42 days post-pollination) and 31.86±4.96 (49 days post-pollination), and a grain dehydration rate of 247.21±29.65 (42-49 days post-pollination). The 10 inbred lines were QTL qKMC3 allele type CT (genotype CT at SNP locus Affx-291408970), with a grain moisture content of 40.82±2.45 (42 days post-pollination) and 34.25±5.07 (49 days post-pollination), and a grain dehydration rate of 262.75±25.21 (42-49 days post-pollination).

[0117] In addition, a T-test was conducted combining the grain moisture content and dehydration rate phenotypes of each inbred line, and the results showed that ( Figure 6 The grain moisture content of inbred lines carrying the CC genotype was significantly lower than that of inbred lines carrying the TT genotype (p < 0.01), and the grain dehydration rate of inbred lines carrying the CC genotype was significantly faster than that of inbred lines carrying the TT genotype (p < 0.05). Figure 6 There was no significant difference in grain moisture content and grain dehydration rate between inbred lines carrying the CT genotype and those carrying the CC genotype (p > 0.05). Figure 6 There was no significant difference in grain moisture content and grain dehydration rate between inbred lines carrying the CT genotype and those carrying the TT genotype (p > 0.05). These results indicate that this molecular marker can be used to eliminate inbred lines with slow dehydration in the field, saving production costs and significantly improving selection efficiency. It allows for the rapid screening of inbred lines with fast grain dehydration for subsequent breeding.

[0118] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for identifying or assisting in the identification of moisture content and / or dehydration rate of corn kernels, characterized in that: This includes detecting the genotype of SNP sites in the maize genome to be tested, and identifying or assisting in the identification of maize kernel moisture content and / or dehydration rate based on the genotype. The SNP site is a site on maize chromosome 4, and its nucleotide type is C or T, which is the 20th nucleotide of sequence 1 in the sequence listing.

2. The method according to claim 1, characterized in that: The genotype of the SNP locus is CC, TT, or CT, where CC is homozygous for SNP locus C, TT is homozygous for SNP locus T, and CT is heterozygous for SNP locus C and T. The kernel moisture content of the test corn with genotype CC at the SNP locus is lower than that of the test corn with genotypes TT and / or CT at the SNP locus, and the dehydration rate of the test corn with genotype CC at the SNP locus is faster than that of the test corn with genotypes TT and / or CT at the SNP locus.

3. The application of the method according to claim 1 or 2 in maize breeding.

4. A method for maize breeding, characterized by: The method includes detecting the genotype of the SNP site in claim 1 in the maize genome, selecting maize with the genotype CC at the SNP site as a parent for breeding, wherein CC is a homozygous type of the SNP site with nucleotide C.

5. Application of substances for detecting SNP polymorphisms or genotypes in the maize genome in any of the following: (1) To identify or assist in the identification of corn kernel moisture content and / or dehydration rate; (2) Maize breeding; (3) Prepare products for identifying or assisting in the identification of corn kernel moisture content and / or dehydration rate; (4) Prepare products for maize breeding; The SNP site is a site on maize chromosome 4, and its nucleotide type is C or T, which is the 20th nucleotide of sequence 1 in the sequence listing.

6. The product, characterized in that: The product contains the substance of claim 5, and the product is any one of the following: C1) Products that detect single nucleotide polymorphisms or genotypes related to corn kernel moisture content and / or dehydration rate; C2) Products used to identify or assist in identifying the moisture content and / or dehydration rate of corn kernels; C3) Products used in maize breeding.

7. The application according to claim 5 or the product according to claim 6, characterized in that: The substance is either D1), D2), or D3): D1) The substance described is a primer composition for amplifying maize genomic DNA fragments including the SNP sites; D2) The substance described is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

8. The application or product according to claim 7, characterized in that: The primer composition consists of primer A, primer B and primer C; Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is the single-stranded DNA at positions 22-42 of sequence 2 in the sequence listing; Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-41 of sequence 3 in the sequence listing. The primer C nucleotide sequence is the single-stranded DNA molecule of sequence 4 in the sequence listing.

9. A DNA molecule, characterized by: The nucleotide sequence of the DNA molecule is sequence 1 in the sequence listing.

10. The use of the DNA molecule of claim 9 in any of the following: (1) To identify or assist in the identification of corn kernel moisture content and / or dehydration rate; (2) Maize breeding; (3) Prepare products for identifying or assisting in the identification of corn kernel moisture content and / or dehydration rate; (4) Prepare products for maize breeding.