Methods of treating alzheimer's disease using neural stem cell-derived extracellular vesicles

By administering extracellular vesicles carrying specific miRNAs to patients, the pathological changes in the brains of Alzheimer's disease patients are modulated, addressing the shortcomings of existing therapies and achieving the effects of reducing Aβ1-42 and pTau levels, reducing neuroinflammation, restoring dendritic structure, and improving cognitive function.

CN121925263APending Publication Date: 2026-04-24TONGJI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
TONGJI UNIV
Filing Date
2024-05-22
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Currently, there are no effective treatments to prevent or slow the progression of Alzheimer's disease, which leads to significant disability and death, placing a huge burden on caregivers and public health departments.

Method used

Extracellular vesicles containing neural stem cells, mesenchymal stem cells, or fibroblast-derived induced NSCs, carrying miRNAs such as let-7, miR-9, miR-21, miR-34a, and miR-10b, are administered to patients via multiple routes to regulate the levels of Aβ1-42, pTau, CD86, iNOS, and IL-1β in the brain, reduce the expression of specific genes, and regulate neuroinflammation.

Benefits of technology

It significantly reduces the levels of Aβ1-42 and pTau in the brains of patients, reduces neuroinflammation, restores dendritic length and spine density, improves cognitive function, and slows the progression of Alzheimer's disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present invention provides a composition and method for treating a patient with Alzheimer's disease. The method comprises administering to the patient a composition comprising a therapeutically effective amount of extracellular vesicles wherein the extracellular vesicles are isolated from the culture medium of the cells. In some embodiments, the extracellular vesicles comprise one or more of the following miRNAs: let-7, miR-9, miR-21, miR-34a, and miR-10b. The present invention also provides a composition for treating Alzheimer's disease in a patient in need thereof, comprising a therapeutically effective amount of extracellular vesicles.
Need to check novelty before this filing date? Find Prior Art

Description

Cross-references to related applications

[0001] This application claims priority to PCT application No. PCT / CN2023 / 095483, filed on May 22, 2023, which is incorporated herein by reference in its entirety. Background Technology

[0002] Dementia describes an intra-individual pattern of decline in memory and thinking, which impairs at least two cognitive domains (McKhann et al., Alzheimers Dement. , 7 (2011), pp. 263-269). Alzheimer's disease (AD) is the most common neurodegenerative disease and the leading cause of dementia in the elderly (Leng, F. et al., , 7 (2011), pp. 263-269). Nat Rev Neurol. 17(3):157-172 (2021)).

[0003] Because dementia caused by Alzheimer's disease is associated with the onset of significant and progressive disability throughout the disease course, with death being an inevitable outcome, typically occurring within 5–12 years of symptom onset (Vermunt et al., Alzheimers Dement. (15 (2019), pp. 888-898). This places a huge burden on caregivers and public health departments.

[0004] There is an urgent need for disease-modifying therapies that can prevent or slow the progression of the disease, but unfortunately, there are currently no available therapies. Summary of the Invention

[0005] In one aspect, the present invention provides a method for treating Alzheimer's disease in patients in need. The method includes administering to the patient a composition comprising a therapeutically effective amount of extracellular vesicles.

[0006] In some implementations, extracellular vesicles are isolated from the cell culture medium.

[0007] In some implementations, the cells are neural stem cells (NSCs), mesenchymal stem cells (MSCs), or fibroblast-derived induced NSCs (iNSCs).

[0008] In some implementations, the extracellular vesicles contain one or more of the following miRNAs: let-7, miR-9, miR-21, miR-34a, and miR-10b.

[0009] In some implementations, the extracellular vesicles contain let-7, miR-21, and miR-10b.

[0010] In some implementations, the medication is applied once or more daily.

[0011] In some implementations, the application is performed at least once every three days.

[0012] In some implementations, the application is continued for at least one month.

[0013] In some implementations, administration is carried out via oral, intravenous, intramuscular, intraperitoneal, intranasal, rectal, or sublingual routes.

[0014] In some embodiments, the dosage of the composition is in the range of 2 mg to 2,000 mg, 2 mg to 500 mg, 2 mg to 200 mg, 2 mg to 150 mg, 5 mg to 100 mg, or 5 mg to 50 mg.

[0015] In some implementations, the dosage is administered in divided doses or a single dose.

[0016] In some embodiments, the composition downregulates Aβ in the prefrontal cortex (PFC) and hippocampus. 1-42 The level.

[0017] In some embodiments, the composition reduces the proliferation of phosphorylated Tau (pTau).

[0018] In some embodiments, the composition modulates neuroinflammation.

[0019] In some embodiments, the composition reduces the levels of CD86, iNOS, and IL-1β in the PFC and hippocampus.

[0020] In some embodiments, the composition reduces the expression of one or more of the following genes: Il1b, Il12b, Mmp13, and Atp8b4.

[0021] In another aspect, the present invention provides a composition comprising a therapeutically effective amount of extracellular vesicles for treating Alzheimer's disease in patients of need.

[0022] In some implementations, extracellular vesicles are isolated from the cell culture medium.

[0023] In some other embodiments, the cells are neural stem cells (NSCs), mesenchymal stem cells (MSCs), or fibroblast-derived induced NSCs (iNSCs).

[0024] In some other embodiments, the extracellular vesicles contain one or more of the following miRNAs: let-7, miR-9, miR-21, miR-34a, and miR-10b.

[0025] In some implementations, the extracellular vesicles contain let-7, miR-21, and miR-10b.

[0026] In another aspect, the present invention provides a method for preparing any of the compositions disclosed herein.

[0027] In another aspect, the present invention provides the use of any of the compositions disclosed herein for the treatment of Alzheimer's disease in patients in need.

[0028] In some embodiments, the composition is administered in doses of 2 mg to 2000 mg, 2 mg to 500 mg, 2 mg to 200 mg, 2 mg to 150 mg, 5 mg to 100 mg, or 5 mg to 50 mg.

[0029] In some embodiments, the composition is applied at least once a day or multiple times a day.

[0030] In some implementations, it is administered via oral, intravenous, intramuscular, intraperitoneal, intranasal, rectal, or sublingual routes.

[0031] These and other features, aspects, and advantages of the invention will be better understood with reference to the following description and the appended claims. Attached Figure Description

[0032] The novel features of the present invention are set forth in detail in the appended claims. A better understanding of the features and advantages of the invention will be obtained by referring to the following detailed description and accompanying drawings, which illustrate exemplary embodiments utilizing the principles of the invention, wherein: Figures 1A and 1B show the characterization of NSCs and iNSCs. (Figure 1A) Representative confocal microscopy images of the immunoreactivity of Sox2, nestin, and Ki67 in neurospheres generated from NSCs and iNSCs. (Figure 1B) Representative confocal microscopy images of the immunoreactivity of Sox2, nestin, and Ki67 in NSCs and iNSCs in adherent cell culture. Scale bar: 50 μm.

[0033] Figures 2A to 2E show further characterization of NSC-EV and iNSC-EV. (Figure 2A) Representative blots of positive EV markers flotillin 1, flotillin 2, and CD9 in NSC-EV and iNSC-EV. (Figure 2B) Representative blots of negative EV markers APOA1 and APOA2 in EV and its parent cells. (Figure 2C) NTA analysis of NSC-EV and iNSC-EV. (Figure 2D) SEM of NSC and iNSC. (Figure 2E) TEM characterization of the morphology of NSC-EV and iNSC-EV. Scale bars: 2 μm (Figure 2D) and 200 nm (Figure 2E).

[0034] Figure 3 shows in vivo imaging of Dil-labeled NSC-EV and iNSC-EV after intravenous administration. Dil-labeled EV was injected intravenously into mice. In vivo fluorescence imaging was used to observe the distribution of Dil-labeled EV throughout the mouse body from 5 min to 360 min after injection. Mice injected with PBS were used as negative controls.

[0035] Figure 4 shows fluorescence images of mouse brain tissue after intravenous administration of Dil-labeled NSC-EV and iNSC-EV. Mouse brains were dissected at different time points after intravenous injection of Dil-labeled EV. PBS-injected mouse brains served as negative controls.

[0036] Figures 5A to 5C show the uptake of NSC-EV and iNSC-EV by cortical cells after intravenous administration. Dil-labeled EV was injected intravenously into mice. Brain tissue was collected 5 min after EV injection. (Figure 5A) Representative confocal microscopy images of Tuj1, CD9, and Dil immunoreactivity in the cortex. (Figure 5B) Representative confocal microscopy images of GFAP, CD9, and Dil immunoreactivity in the cortex. (Figure 5C) Representative confocal microscopy images of Iba1, CD9, and Dil immunoreactivity in the cortex. The images in the lower subplots are high-magnification images of the corresponding small box regions in the upper subplot of each group. Arrows indicate overlapping signals. Scale bar: 20 μm.

[0037] Figures 6A to 6C show the uptake of NSC-EV and iNSC-EV by hippocampal cells after intravenous administration. Dil-labeled EV was injected intravenously into mice. Brain tissue was collected 5 min after EV injection. (Figure 6A) Representative confocal microscopy images of Tuj1, CD9, and Dil immunoreactivity in the hippocampus. (Figure 6B) Representative confocal microscopy images of GFAP, CD9, and Dil immunoreactivity in the hippocampus. (Figure 6C) Representative confocal microscopy images of Iba1, CD9, and Dil immunoreactivity in the hippocampus. The images in the lower subplots are high-magnification images of the corresponding small box regions in the upper subplot of each group. Arrows indicate overlapping signals. Scale bar: 20 μm.

[0038] Figure 7 shows that intravenous administration of NSC-EV and iNSC-EV did not alter motor function in 5×FAD mice in the Morris water maze. Total swimming distance and mean swimming speed of mice in the Morris water maze (n=9) were also shown. Statistical differences between groups were assessed using a post-hoc one-way ANOVA with Bonferroni test.

[0039] Figure 8 shows that intravenous administration of NSC-EV and iNSC-EV did not alter the motor abilities of 5×FAD mice in the Y-maze test. Total distance traveled and average speed of mice in the Y-maze test (n=9). Statistical differences between groups were assessed using parametric one-way ANOVA with a post-hoc Bonferroni test.

[0040] Figures 9A through 9D show that intravenous administration of NSC-EV and iNSC-EV reduced Aβ plaque deposition in the hippocampus of 5×FAD mice. (Figure 9A) Representative confocal microscopy images of Aβ immunoreactivity in the hippocampus at 20x magnification. (Figures 9B through 9D) Quantification of Aβ plaque burden (Figure 9B), density (Figure 9C), and mean size (Figure 9D) using ImageJ (n=4). Scale bar: 200 μm. Error bars represent standard deviation. *, **, ***, **** represent... p <0.05、 p <0.01、 p <0.001 and p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0041] Figure 10 shows that intravenous administration of NSC-EV and iNSC-EV reduced Aβ accumulation in the hippocampus of 5×FAD mice. Aβ levels in the hippocampus were determined by ELISA. 1-42 The level (n=6). The error bars represent the standard deviation. * and ** respectively indicate... p <0.05 and p <0.01. Parametric one-way ANOVA with post-hoc Bonferroni test was used to assess statistical differences between groups.

[0042] Figure 11 shows how intravenous administration of NSC-EV and iNSC-EV alleviated pTau proliferation in the hippocampus of 5×FAD mice. Representative confocal microscopy images of pTau immunoreactivity in the hippocampus at 20x magnification are provided. The intensity of the pTau signal was quantified using ImageJ (n=6). Scale bar: 200 μm. Error bars indicate standard deviation. **** indicates... p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0043] Figures 12A through 12D show that intravenous administration of NSC-EV and iNSC-EV restored dendritic length and spine density in the hippocampus of 5×FAD mice. (Figure 12A) Representative microscopic images of hippocampal tissue samples stained with Golgi-Cox at 40x magnification. (Figure 12B) Magnified images showing dendrites and spines. (Figure 12C) Quantification of dendritic length in neurons in hippocampal tissue samples (n=9). (Figure 12D) Quantification of spine density in hippocampal tissue samples (n=10). Error bars represent standard deviations. *, **, ***, **** represent... p <0.05、 p <0.01、 p <0.001、 p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0044] Figures 13A through 13F show that intravenous administration of NSC-EV and iNSC-EV improved the cognitive performance of 5×FAD mice in the Morris water maze. (Figure 13A) Swimming path of mice upon platform removal (memory phase); (Figure 13B) Number of platform crossings in the target quadrant (n=9); (Figure 13C) Percentage of swimming distance spent in the target quadrant of the Morris water maze (n=9); (Figure 13D) Percentage of swimming time spent in the target quadrant of the Morris water maze (n=9); (Figure 13E) Mean swimming speed of mice in the Morris water maze test (n=9); (Figure 13F) Mean swimming distance of mice in the Morris water maze test (n=9). Error bars represent standard deviation. ns indicates no significance. *, **, *** represent... p <0.05、 p <0.01 and p <0.001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0045] Figures 14A and 14B show that NSC-EV and iNSC-EV enhanced the cognitive performance of 5×FAD mice in a fear condition test one month after intravenous administration. (Figure 14A) Total frozen time in mice during the fear condition test. (Figure 14B) Percentage of frozen time in mice during the fear condition test (n=9). Error bars represent standard deviation. ns indicates no significance. **, ***, and *** represent... p <0.01、 p <0.001 and p<0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0046] Figures 15A to 15F. One month after intravenous administration, NSC-EV and iNSC-EV reduced Aβ plaque deposition in the brains of 5×FAD mice. (Figure 15A) Aβ immunoreactivity in the PFC one month after EV administration. (Figures 15B to 15C) Quantification of Aβ plaque density (Figure 15B) and mean size (Figure 15C) in the PFC using ImageJ (n=9). (Figure 15D) Aβ immunoreactivity in the hippocampus one month after EV administration. (Figures 15E to 15F) Quantification of Aβ plaque density (Figure 15E) and mean size (Figure 15F) in the hippocampus using ImageJ (n=9). Error bars represent standard deviation. ns indicates no significance. **, ***, and *** represent... p <0.01、 p <0.001 and p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0047] Figures 16A-16B. Intravenous administration of NSC-EV and iNSC-EV reduced pTau proliferation in the brains of 5×FAD mice. (Figure 16A) Representative confocal microscopy images of pTau immunoreactivity in the PFC at 20x magnification. pTau signal intensity (n=6) quantified using ImageJ is shown in the right subplot. (Figure 16B) Representative confocal microscopy images of pTau immunoreactivity in the hippocampus at 20x magnification. pTau signal intensity (n=6) quantified using ImageJ is shown in the right subplot. Scale bar: 200 μm. Error bars indicate standard deviation. *** and **** indicate... p <0.001 and p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0048] Figures 17A to 17H. Intravenous administration of NSC-EV and iNSC-EV restored dendritic length and spine density in the brains of 5×FAD mice. (Figure 17A) Representative microscopic images of Golgi-Cox staining in cortical tissue samples at 40x magnification. (Figure 17B) Magnified images showing dendrites and spines. (Figure 17C) Quantification of dendritic length in neurons in cortical tissue samples (n=9). (Figure 17D) Quantification of spine density in cortical tissue samples (n=10). (Figure 17E) Representative microscopic images of Golgi-Cox staining in hippocampal tissue samples at 40x magnification. (Figure 17F) Magnified images showing dendrites and spines. (Figure 17G) Quantification of dendritic length in neurons in hippocampal tissue samples (n=9). (Figure 17H) Quantification of spine density in hippocampal tissue samples (n=10). Error bars represent standard deviation. *, *** represent... p <0.05 and p <0.001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0049] Figures 18A to 18D. Characterization of NSC-EV, iNSC-EV, MSC-EV, and FB-EV. (Figure 18A) Representative blots of positive EV markers Flotillin 1, Flotillin 2, and CD9 in NSC-EV and iNSC-EV. (Figure 18B) Representative blots of negative EV markers APOA1 and APOA2 in EVs and their parent cells. (Figure 18C) NTA analysis of EVs. (Figure 18D) TEM characterization of EV morphology. Scale bar: 200 nm.

[0050] Figures 19A to 19F. Intravenous administration of stem cell-derived EV improved cognitive performance in 5×FAD mice in the Morris water maze. (Figure 19A) Swimming path of mice upon platform removal (memory phase); (Figure 19B) Number of platform crossings in the target quadrant (n=7); (Figure 19C) Percentage of swimming distance spent in the target quadrant of the Morris water maze (n=7); (Figure 19D) Percentage of swimming time spent in the target quadrant of the Morris water maze (n=7); (Figure 19E) Mean swimming speed of mice in the Morris water maze test (n=7); (Figure 19F) Mean swimming distance of mice in the Morris water maze test (n=7). Error bars represent standard deviation. ns indicates no significance. *, **, ***, **** represent... p <0.05、 p <0.01、 p <0.001、 p<0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0051] Figures 20A to 20B. Intravenous administration of stem cell-derived EV alleviated cognitive function in 5×FAD mice during the fear conditioning test. (Figure 20A) Total freezing time of mice during the fear conditioning test. (Figure 20B) Percentage of freezing time of mice during the fear conditioning test (n=9). Error bars represent standard deviation. ns indicates no significance. *, **, ***, **** represent... p <0.05、 p <0.01、 p <0.001、 p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0052] Figures 21A-21F. Intravenous administration of stem cell-derived EV reduced Aβ plaque deposition in the brains of 5×FAD mice. (Figure 21A) Representative confocal microscopy image of Aβ immunoreactivity in PFC at 20x magnification. (Figures 21B-21C) Quantification of Aβ plaque density (Figure 21B) and mean size (Figure 21C) in PFC using ImageJ (n=10). (Figure 21D) Representative confocal microscopy image of Aβ immunoreactivity in PFC at 20x magnification. (Figures 21E-21F) Quantification of Aβ plaque density (Figure 21E) and mean size (Figure 21F) in the hippocampus using ImageJ (n=10). Scale bar: 200 μm. Error bars indicate standard deviation. *, **, **** represent... p <0.05、 p <0.01、 p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0053] Figures 22A-22B. Intravenous administration of stem cell-derived EV reduced pTau proliferation in the brains of 5×FAD mice. (Figure 22A) Representative confocal microscopy images of pTau immunoreactivity in the PFC at 20x magnification. The intensity of the pTau signal in the PFC, quantified using ImageJ, is shown in the right subplot (n=6). (Figure 22B) Representative confocal microscopy images of pTau immunoreactivity in the hippocampus at 20x magnification. The intensity of the pTau signal in the hippocampus, quantified using ImageJ, is shown in the right subplot (n=6). Scale bar: 200 μm. Error bars indicate standard deviation. *** and **** represent... p <0.001 and p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0054] Figures 23A to 23H. Intravenous administration of stem cell-derived EV restored dendritic length and spine density in the brains of 5×FAD mice. (Figure 23A) Representative microscopic images of Golgi-Cox staining in cortical tissue samples at 40x magnification. (Figure 23B) Magnified images showing dendrites and spines. (Figure 23C) Quantification of dendritic length in neurons in cortical tissue samples (n=10). (Figure 23D) Quantification of spine density in hippocampal tissue samples (n=10). (Figure 23E) Representative microscopic images of Golgi-Cox staining in hippocampal tissue samples at 40x magnification. (Figure 23F) Magnified images showing dendrites and spines. (Figure 23G) Quantification of dendritic length in neurons in hippocampal tissue samples (n=10). (Figure 23H) Quantification of spine density in hippocampal tissue samples (n=10). Error bars represent standard deviation. *, **, ***, **** represent... p <0.05、 p <0.01、 p <0.001、 p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0055] Figures 24A to 24E. Intravenous administration of NSC-EV and iNSC-EV altered gene expression profiles in the hippocampus of 5×FAD mice. (Figure 24A) Heatmap of the first 40 DEGs between groups. (Figure 24B) Comparison of the first 10 GO items of DEGs between NSC-EV-injected mice and PBS controls. (Figure 24C) Comparison of the first 10 KEGG pathways of DEGs between NSC-EV-injected mice and PBS controls. (Figure 24D) Comparison of the first 10 GO items of DEGs between iNSC-EV-injected mice and PBS controls. (Figure 24E) Comparison of the first 10 KEGG pathways of DEGs between iNSC-EV-injected mice and PBS controls.

[0056] Figures 25A to 25E. NSC-EV and iNSC-EV are primarily internalized by microglia in the brain. Dil-labeled EVs were intravenously injected into mice. Brain tissue was collected 5 min after EV injection. (Figure 25A) Representative confocal microscopy images of Iba1 and Dil immunoreactivity in the cortex and hippocampus. (Figure 25B) Representative confocal microscopy images of GFAP and Dil immunoreactivity in the cortex and hippocampus. (Figure 25C) Representative confocal microscopy images of Tuj1 and Dil immunoreactivity in the cortex and hippocampus. (Figure 25D) Quantitative analysis comparing NSC-EV uptake in microglia, astrocytes, and neurons in the PFC and hippocampus. (Figure 25E) Quantitative analysis comparing iNSC-EV uptake in microglia, astrocytes, and neurons in the PFC and hippocampus. The images in the right subplot are high-magnification images of the corresponding small box region in the left subplot of each group. Arrows indicate overlapping signals. Scale bar: 50μm. Error bars represent standard deviation. **, ***, and **** represent... p <0.01、 p <0.001 and p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0057] Figures 26A to 26H. Intravenous administration of NSC-EV and iNSC-EV inhibited microglia activation in the hippocampus of 5×FAD mice and enhanced microglia Aβ response. (Figure 26A) Representative confocal microscopy image of Iba1 immunoreactivity in the hippocampus at 20x magnification. (Figure 26B) Iba1 in each group + Cell number (n=6). (Fig. 26C) Representative confocal microscopy image of Iba1 and Aβ immunoreactivity in the hippocampus at 20x magnification. (Fig. 26D) Iba1 cells surrounding the surface of the Aβ plaque are shown in the right split image. +Cell number (n=6). (Fig. 26E) Representative Western blot of CD86, iNOS, and IL-1β protein expression levels in the hippocampus. (Fig. 26F) Quantification of CD86 protein expression levels in the hippocampus (n=3). (Fig. 26G) Quantification of iNOS protein expression levels in the hippocampus (n=3). (Fig. 26H) Quantification of IL-1β protein expression levels in the hippocampus (n=3). Western blot data were normalized to β-actin. Scale bar: 200 μm. Error bars represent standard deviation. *, **, ***, and **** represent... p <0.05、 p <0.01、 p <0.001 and p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0058] Figures 27A and 27B. Intravenous administration of NSCs and iNSC-EVs inhibited astrocyte activation in the brains of 5×FAD mice. (Figure 27A) Representative confocal microscopy image of GFAP immunoreactivity in the prefrontal cortex at 20x magnification. The number of immunoreactive cells in each group (n=8) is shown in the right subplot. (Figure 27B) Representative confocal microscopy image of GFAP immunoreactivity in the hippocampus at 20x magnification. The number of immunoreactive cells in each group (n=7) is shown in the right subplot. Scale bar: 200 μm. Error bars indicate standard deviation. *, **, **** represent... p <0.05、 p <0.01 and p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0059] Figures 28A to 28F. Intravenous administration of NSC and iNSC-EV altered gene expression profiles in the hippocampus of 5×FAD mice. (Figure 28A) Heatmap of all miRNAs detected in NSC-EV and iNSC-EV using microarray. (Figure 28B) Volcano plot of all miRNAs detected in NSC-EV and iNSC-EV. (Figure 28C) Top 10 miRNAs read in NSC-EV. (Figure 28D) Top 10 miRNAs read in iNSC-EV. (Figure 28E) qRT-PCR validation of the top 10 miRNAs read in NSC-EV. (Figure 28F) qRT-PCR validation of the top 10 miRNAs read in iNSC-EV.

[0060] Figure 29 shows that in the EV-injected group, approximately 40% of the downregulated genes identified by RNA-seq included pro-inflammatory genes (e.g., Il1b, Il12b ) and Aβ-related genes (e.g., Mmp13, Atp8b4 This is expected to become a direct target for EV-enriched miRNAs.

[0061] Figures 30A to 30B. Intravenous administration of NSC-EV and iNSC-EV altered gene expression profiles in the hippocampus of 5×FAD mice. (Aβ) 1-42 Primary mouse microglia were stimulated, followed by EV treatment and transfection with miR-9, let-7i, miR-21a, miR-34a, or miR-10b antagonists (for 2 days). (Figure 30A) Pro-inflammatory genes in microglia were identified by qRT-PCR. Il1b and Nos2 Transcriptional levels. (Figure 30B) Identification of anti-inflammatory genes in microglia by qRT-PCR. CD206 and Ym1 Transcriptional levels. Error bars represent standard deviations. ns indicates no significance. *, **, ***, and **** represent... p <0.05、 p <0.01、 p <0.001 and p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0062] Figures 31A to 31B. Intravenous administration of NSC-EV and iNSC-EV rescues neuronal loss in the brains of 5×FAD mice. (Figure 31A) Representative confocal microscopy images of NeuN immunoreactivity in the prefrontal cortex at 20x magnification. NeuN in each group is shown in the right subplot. + Cell number. (Fig. 31B) Representative confocal microscopy image of NeuN immunoreactivity in the hippocampus at 20x magnification. NeuN count in each group is shown in the right subplot. + Cell number. N=4. Scale bar: 200μm. Error bars represent standard deviation. * and ** indicate... p <0.05 and p <0.01. Parametric one-way ANOVA with post-hoc Bonferroni test was used to assess statistical differences between groups.

[0063] Figures 32A to 32D. Intravenous administration of NSC-EV and iNSC-EV promoted neurogenesis in the brains of 5×FAD mice. (Figures 32A to 32B) Representative confocal microscopy images of Ki67 (Figure 32A) and DCX (Figure 32B) immunoreactivity in the SVZ at 20x magnification. The number of immunoreactive cells in each group is shown in the right subplot. (Figures 32C to 32D) Representative confocal microscopy images of Ki67 (Figure 32C) and DCX (Figure 32D) immunoreactivity in the hippocampus at 20x magnification. The number of immunoreactive cells in each group is shown in the right subplot. N=4. Scale bar: 200 μm. Error bars indicate standard deviation. ns indicates no significance. *, **, **** represent... p <0.05、 p <0.01 and p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0064] Figures 33A to 33X. (Figures 33A to 33D) Water Maze: (Figure 33A) Swimming paths of mice with or without platforms (learning phase); (Figure 33B) Escape latency during the learning phase; (Figure 33C) Number of platform crossings and swimming distance in the target quadrant during the memory phase (n=9). (Figure 33D) Y-maze: Number and proportion of novel arm entry (n=9). (Figure 33E) Open Field Test: Number of feedings, number of freezes, and number of center field entry (n=9). (Figure 33F) Aβ Immunoreactivity in PFC. (Figure 33G) Quantification of Aβ plaque density and mean size using ImageJ (n=8). (Figure 33H) Aβ in PFC. 1-42Level ELISA assay (n=6). (Fig. 33I) pTau immunoreactivity in PFC. (Fig. 33J) Quantification of pTau signal intensity using ImageJ (n=7). (Fig. 33K) Representative image of Golgi-stained PFC tissue (top) and high-magnification image showing neuronal somatic cells and primary dendrites (bottom). (Fig. 33L) Quantification of dendritic length using ImageJ (n=9-10). (Fig. 33M) Quantification of spine density using ImageJ (n=9-10). (Fig. 33N) Heatmap of the first 40 DEGs between groups. (Figs. 33O to 33P) Comparison of the first 5 GO items of DEGs (Fig. 33O) and the KEGG pathway (Fig. 33P) between NSC-EV and PBS-injected mice. (Figs. 33Q to 33R) Comparison of the first five GO items of DEG (Fig. 33Q) and the KEGG pathway (Fig. 33R) between iNSC-EV and PBS-injected mice. (Fig. 33S) Iba1 immunoreactivity in PFC. (Fig. 33T) Immunoreactivity of Iba1 using ImageJ. + Cell counts were quantified (n=5). (Fig. 33U) Immunoreactivity of Iba1 and Aβ in PFC. (Fig. 33V) Iba1 levels around Aβ plaques using ImageJ. + Cells were quantified (n=6). (Figs. 33W to 33X) Representative blots (Fig. 33W) and quantification (Fig. 33X) of CD86, IL-1β, and iNOS expression levels in PFCs (n=3). Error bars represent standard deviation. ns indicates no significance. *, **, ***, **** represent... p <0.05、 p <0.01、 p <0.001、 p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0065] Figure 34. iNSC-EV alleviates Aβ oligomer-induced cell damage. Human neuronal cell line SH-SY5Y was stimulated with Aβ oligomers, followed by EV treatment. Cell viability was determined by CCK8 assay. Error bars represent standard deviation. * and **** indicate... p <0.05 and p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0066] Figures 35A to 35B. iNSC-EV eliminated Aβ oligomer-induced inhibition of synaptic cytokine expression. Human neuronal cell line SH-SY5Y was stimulated with Aβ oligomers, followed by EV treatment. Transcriptional levels of the postsynaptic gene PSD95 and the presynaptic gene synaptic vesicle protein were determined in SH-SY5Y cells by qRT-PCR. Error bars represent standard deviation. ns indicates no statistical significance. *, ***, and **** represent... p <0.05、 p <0.001 and p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0067] Figures 36A to 36B. iNSC-EV reversed Aβ oligomer-induced oxidative stress and ferroptosis. Human neuronal cell line SH-SY5Y was stimulated with Aβ oligomers, followed by EV treatment. (A) ROS accumulation in SH-SY5Y cells was determined by quantifying ROS+ cells (DHE+ cells). (B) Antiferroptosis genes in SH-SY5Y cells were identified by qRT-PCR. GPX4 and ferroptosis genes ACSL4 Transcriptional levels. Error bars represent standard deviations. ns indicates no significance. *, **, ***, and **** represent... p <0.05、 p <0.01、 p <0.001 and p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0068] Figures 37A to 37B. iNSC-EV inhibits Aβ processing genes. Human neuronal cell line SH-SY5Y was stimulated with Aβ oligomers, followed by EV treatment. Key Aβ processing genes in SH-SY5Y cells were identified by qRT-PCR. APP and BACE1 Transcription levels. Error bars represent standard deviations. ns indicates no significance. *** and **** represent... p <0.001 and p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0069] Figures 38A to 38B. 3'UTRs of miR-26a-5p targeting APP and ACSL4 transcripts. Figure 38A: Pairing of 3'UTRs of candidate genes with miR-26a-5p predictions on the TargetScan website. Figure 38B: Inhibition of luciferase activity by the 3'UTRs of APP and ACSL4 dependent on miR-26a-5p. Firefly luciferase activity was normalized to an internal control, i.e., Renida luciferase activity. Error bars represent standard deviations. ns indicates no significance. ** and *** represent... p <0.01 and p <0.001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0070] Figures 39A to 39B. miR-26a-5p targets the 3'UTR of APP and ACSL4 transcripts. Human neuronal cell line SH-SY5Y cells were stimulated with Aβ oligomers, followed by EV treatment with / without miR-26a-5p. SH-SY5Y cells were identified by qRT-PCR. APP and ACSL4 Transcription level. Error bars represent standard deviation. ns indicates no significance. **, *** and **** represent [variables / values]. p <0.01、 p <0.001 and p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test. Detailed Implementation

[0071] In the foregoing abstract and detailed description, as well as the appended claims, reference has been made to specific features of the invention. It should be understood that the disclosure of the invention in this specification includes all possible combinations of such specific features. For example, where a specific feature is disclosed in the context of a particular aspect or embodiment of the invention or a particular claim, that feature may also be used, to the extent possible and generally in the context of other specific aspects and embodiments of the invention, and / or in the context thereof.

[0072] In a first aspect, the present invention provides a method for treating Alzheimer's disease in patients in need, comprising administering to the patient a composition comprising a therapeutically effective amount of extracellular vesicles (EVs).

[0073] As used herein, a “therapeutic effective amount” means an adequate amount of EV used to suppress the harmful effects of Alzheimer’s disease in a patient with a reasonable benefit / risk ratio applicable to any medical practice. However, it should be understood that the total daily dose of EV may be determined by the attending physician within reasonable medical judgment. The specific therapeutic effective dose level for any particular subject will depend on a variety of factors, including the condition being treated and its severity; the specific composition used by the subject, age, weight, general health, sex, and diet; the timing, route of administration, and excretion rate of the EV used; the duration of treatment; medications used in combination with or concurrently with the EV; and similar factors well known in the medical field. For example, it is known to those skilled in the art that a dose of a composition is started at a level below those required to achieve the desired therapeutic effect and gradually increased until the desired effect is achieved. Furthermore, a “therapeutic effective amount” is an amount that will elicit a biological or medical response in the tissue, system, or subject sought by the researcher or clinician, and in particular, an amount capable of eliciting some desired therapeutic or preventative effect for suppressing the harmful effects of Alzheimer’s disease in a patient.

[0074] Those skilled in the art recognize that even if the condition is not completely eradicated or prevented, partial improvement or relief of its symptoms and / or effects in a subject can be considered a "treatment-effective" measure. Various indicators are known to those skilled in the art for determining the effectiveness of methods used to suppress the harmful effects of Alzheimer's disease on patients.

[0075] As used herein, the terms “treating,” “treatment,” “therapeutic,” or “therapy” do not necessarily mean the complete cure or elimination of a disease or condition. Any relief of any unintended sign or symptom of a disease or condition may be considered treatment and / or therapy to any extent. Furthermore, treatment may include behaviors that may worsen a patient’s overall well-being or appearance.

[0076] In some embodiments, based on the total weight of the composition considered as 100% by weight, the composition contains about 5% by weight to about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% by weight of EV, preferably about 30% by weight to about 90% by weight of EV.

[0077] The claimed composition may include other ingredients, such as other active agents, preservatives, buffers, salts, pharmaceutically acceptable carriers, or other pharmaceutically acceptable ingredients.

[0078] As used herein, “carrier” refers to a compound that facilitates the incorporation of a composition into cells or tissues. For example, but not limited to, dimethyl sulfoxide (DMSO), ethanol (EtOH), or PEG400 are commonly used carriers that facilitate the ingestion of many organic compositions into the cells or tissues of a subject.

[0079] In some embodiments, extracellular vesicles (EVs) are isolated from the cell culture medium. EVs are small, lipid-bilayer-closed vesicles that exhibit blood-brain barrier (BBB) ​​penetration ability and potency similar to their parent cells (Xia, X. et al., Transl Neurodegener . 11(1):53 (2022)).

[0080] In some implementations, the cells are neural stem cells (NSCs), mesenchymal stem cells (MSCs), or fibroblast-derived induced NSCs (iNSCs).

[0081] The inventors obtained mouse fibroblast-derived induced NSCs (iNSCs) through somatic cell reprogramming, thus opening a new window for obtaining EVs derived from NSC-like cells (Ma, Y. et al., Cell Commun Signal . 17(1):96(2019); Gao, G. et al. Induced neural stem / progenitor cell-derived extracellular vesicles promote recovery post-stroke. Clin Transl Med . 12(6):e936 (2022)). However, it is unclear whether iNSC-derived (iNSC-EV) can be used as a treatment for AD.

[0082] In some implementations, the extracellular vesicles contain one or more of the following miRNAs: let-7, miR-9, miR-21, miR-34a, and miR-10b.

[0083] In some implementations, the extracellular vesicles contain let-7, miR-21, and miR-10b.

[0084] In some implementations, the medication is applied at least once a day or multiple times a day.

[0085] In some implementations, the application is performed at least once every three days.

[0086] In some implementations, the application is continued for at least one month.

[0087] Various techniques exist in the art for administering the composition, including, but not limited to, oral, rectal, topical, aerosol, injection, and parenteral delivery, including intramuscular, subcutaneous, intravenous, intramedullary, intrathecal, direct intraventricular, intraperitoneal, intranasal, and intraocular injection. The composition can also be administered locally rather than systemically, for example, by injecting the composition directly into the area of ​​infection (typically in the form of a long-acting or sustained-release formulation). Furthermore, the composition can be administered in targeted drug delivery systems, such as liposomes coated with tissue-specific antibodies. The liposomes will target the organ and be selectively taken up by it.

[0088] In some embodiments, administration is carried out via various routes, selected from oral, intravenous, intramuscular, intraperitoneal, intranasal, rectal, or sublingual routes.

[0089] The term "intraperitoneal" as used here means applied within or through the peritoneum. The peritoneum is a thin, transparent membrane that serves as the lining of the walls of the abdominal (peritoneal) cavity and contains / encloses abdominal organs such as the stomach and intestines.

[0090] As used in this article, "sublingual" refers to something located under the tongue or applied under the tongue.

[0091] In some embodiments, the dosage range of the composition is 2 mg to 2,000 mg, 2 mg to 500 mg, 2 mg to 200 mg, 2 mg to 150 mg, 5 mg to 100 mg, or 5 mg to 50 mg.

[0092] In some implementations, the dosage is administered in divided doses or a single dose.

[0093] In some embodiments, the composition is administered at a dose of EV ranging from 2 mg to 2000 mg. In some embodiments, the composition is administered orally at a daily dose of EV ranging from 5 mg to 500 mg.

[0094] The dosage range can be wide, depending on the desired effect and therapeutic indication. Daily dosing regimens for adult patients may include, for example, oral doses of 0.01 mg to 3000 mg per kg of subject body weight, preferably 1 mg to 700 mg, for example 5 mg to 200 mg, or about 0.1 mg to about 1000 mg of EV per kg of subject body weight. Depending on the subject's needs, the dosage may be a single, one-time, two-time, or more-time series of doses administered over a period of one or more days. In some embodiments, the composition is administered for a continuous period of time, such as more than one week, or several months or years. In some embodiments, EV or its pharmaceutically acceptable salts are administered at a lower frequency compared to the frequency of administration of agents within standard care. In some embodiments, EV or its pharmaceutically acceptable salts may be administered once daily. In some embodiments, the total duration of treatment with EV or its pharmaceutically acceptable salts may be shorter than the total duration of treatment with standard care.

[0095] Where human doses of EVs have been established for at least some conditions, these same doses, or approximately 0.1% to 500%, more preferably, approximately 25% to 250% of the established human doses, may be used. Where human doses have not been established, as in the case of a newly discovered pharmaceutical composition, doses may be derived from EDs. 50 or ID 50 The appropriate human dose is inferred from the value, or other appropriate value derived from in vitro or in vivo studies, such as those quantified through toxicity and efficacy studies in animals.

[0096] As used in this article, the term "ED" 50 "This refers to the dose that produces the desired effect in 50% of the population, or the median effective dose."

[0097] The dosage and interval can be adjusted individually to provide a plasma level sufficient to maintain the active component of the modulating effect, or minimum effective concentration (MEC). The dose required to achieve the MEC will depend on individual characteristics and the route of administration. However, HPLC or bioassays can be used to determine plasma concentrations. The MEC value can also be used to determine the dosing interval. The composition should be administered using a regimen that maintains plasma levels above the MEC for 10% to 90% (preferably 30% to 90%, most preferably 50% to 90%) of the time. In cases of local application or selective uptake, the effective local concentration of the drug may be independent of plasma concentration.

[0098] It should be noted that the attending physician will know how and when to terminate, interrupt, or adjust administration due to toxicity or organ dysfunction. Conversely, if the clinical response is insufficient (excluding toxicity), the attending physician will also know to adjust the treatment to a higher level. When treating a condition of interest, the dosage administered will vary depending on the severity of the condition and the route of administration. For example, the severity of the condition can be assessed in part using standard prognostic methods. Furthermore, the dosage and possible dosing frequency will also vary based on the individual patient's age, weight, and response. Procedures similar to those discussed above can be used in veterinary medicine.

[0099] In some embodiments, the composition downregulates the levels of Aβ1-42 in the prefrontal cortex (PFC) and hippocampus.

[0100] In some embodiments, the composition reduces the proliferation of phosphorylated Tau (pTau).

[0101] In some embodiments, the composition modulates neuroinflammation.

[0102] In some embodiments, the composition reduces the levels of CD86, iNOS, and IL-1β in the PFC and hippocampus. Specifically, CD86 refers to the T-lymphocyte activation antigen CD86; iNOS is nitric oxide synthase 2; and IL-1β is interleukin-1β.

[0103] In some embodiments, the composition reduces the expression of one or more of the following genes: Il1b, Il12b, Mmp13, and Atp8b4.

[0104] In a second aspect, the present invention provides a composition comprising a therapeutically effective amount of extracellular vesicles for treating Alzheimer's disease in patients in need.

[0105] In a third aspect, the present invention provides a method for preparing any of the compositions disclosed herein.

[0106] In a fourth aspect, the present invention provides the use of any of the compositions disclosed herein for treating Alzheimer's disease in patients in need.

[0107] In some embodiments, the composition is prepared in the form of a pharmaceutical composition.

[0108] The term "pharmaceutical composition" refers to a mixture of EV with other chemical components, such as diluents or carriers. Pharmaceutical compositions facilitate the application of the composition to a living organism. Pharmaceutical compositions can also be obtained by reacting the composition with inorganic or organic acids, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, and salicylic acid. Pharmaceutical compositions are typically tailored to a specific intended route of administration. Pharmaceutical compositions are intended for human and / or veterinary use.

[0109] The pharmaceutical compositions described herein may be administered to human patients on their own, or as pharmaceutical compositions in which they are mixed with other active ingredients (such as in combination therapy, or as carriers, diluents, excipients, or combinations thereof). Appropriate formulations depend on the chosen route of administration. Techniques for the formulation and administration of the compositions described herein are known to those skilled in the art.

[0110] As used herein, a “diluent” refers to a component in a pharmaceutical composition that lacks pharmacological activity but may be pharmaceutically necessary or desired. For example, a diluent can be used to increase the volume of a potent drug that cannot be manufactured and / or administered due to its small mass. It can also be a liquid used to dissolve a drug administered by injection, ingestion, or inhalation. Commonly used forms of diluents in the art are buffered aqueous solutions, such as, but not limited to, phosphate-buffered saline solutions that mimic the composition of human blood.

[0111] As used herein, "excipient" refers to an inert substance added to a pharmaceutical composition to provide, but not limited to, volume, consistency, stability, binding capacity, lubricity, disintegration capacity, etc. "Diluent" is a type of excipient.

[0112] The pharmaceutical compositions disclosed herein can be manufactured in ways known per se, for example by conventional mixing, dissolving, granulating, forming sugar-coated pellets, grinding, emulsifying, encapsulating, embedding, or tableting processes.

[0113] If desired, the pharmaceutical composition may be packaged in a packaging or dispenser device that may contain one or more unit dosage forms containing the active ingredient. The packaging may include, for example, metal or plastic foil, such as blister packs. The packaging or dispenser device may be accompanied by instructions for use. The packaging or dispenser may also be accompanied by a container-related notification in the form prescribed by the government agency regulating the manufacture, use, or sale of the drug, reflecting the agency's approval for the human or veterinary form of administration. For example, such notification may be a prescription drug label approved by the U.S. Food and Drug Administration, or an approved product insert. Compositions of EVs that can be formulated in a compatible drug carrier, placed in an appropriate container, and labeled for the treatment of a specified condition may also be prepared. definition

[0114] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. If a term has multiple definitions, the definition in this section shall prevail unless otherwise stated.

[0115] The terminology used herein is for descriptive purposes only and is not intended to be limiting. Unless the context clearly indicates otherwise, the singular forms “a,” “an,” and “described” as used herein also include the plural forms. Furthermore, the use of the terms “comprising,” “containing,” “having,” “has,” “with,” or variations thereof in the specification and / or claims is intended to include in a manner similar to the term “comprising.”

[0116] As used herein, the terms “individual,” “patient,” or “subject” are used interchangeably. None of these terms require or limit situations characterized by supervision (e.g., continuous or intermittent) of healthcare workers (e.g., physicians, registered nurses, nurse practitioners, physician assistants, caregivers, or hospice workers).

[0117] Control: A control is an individual or group of samples used as a comparative standard to examine the results of a survey or experiment. In some contexts, a control is referred to as a reference.

[0118] As used herein, a “diluent” refers to a component in a pharmaceutical composition that lacks pharmacological activity but may be pharmaceutically necessary or desired. For example, a diluent can be used to increase the volume of a potent drug that cannot be manufactured and / or administered due to its small mass. It can also be a liquid used to dissolve a drug administered by injection, ingestion, or inhalation. Commonly used forms of diluents in the art are buffered aqueous solutions, such as, but not limited to, phosphate-buffered saline solutions that mimic the composition of human blood.

[0119] As used herein, "excipient" refers to an inert substance added to a pharmaceutical composition to provide, but not limited to, volume, consistency, stability, binding capacity, lubricity, disintegration capacity, etc. "Diluent" is a type of excipient.

[0120] As used herein, the terms “treatment” and “treating” refer to a method of obtaining a beneficial or desired outcome (including, but not limited to, therapeutic and / or preventative benefits). For example, treatment may include administering the systems or cell populations disclosed herein. A therapeutic benefit may refer to any treatment-related improvement or effect of treatment on one or more diseases, conditions, or symptoms. For preventative benefits, the composition may be administered to a subject at risk of developing a particular disease, condition, or symptom, or to a subject who has reported one or more physiological symptoms of a disease (even if the disease, condition, or symptom may not yet have manifested).

[0121] A “treatment effect” may occur if the condition being treated changes. The change can be positive or negative. A “change” in the condition being treated can refer to a change of at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 25%, 50%, 75%, or 100% in the condition. This change can be based on an improvement in the severity of the treated condition in an individual, or on a difference in the frequency of improvement in a group of individuals receiving and not receiving treatment. The term “treatment-effective” should be understood to have a definition corresponding to “having a therapeutic effect.”

[0122] Any headings or subheadings used herein are for organizational purposes and should not be used to limit the scope of the embodiments disclosed herein.

[0123] All publications and patent applications cited in this specification are incorporated herein by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference.

[0124] The following embodiments are provided to provide a complete disclosure and description of how to make and use the invention to those skilled in the art, and are not intended to limit the scope of what the inventors believe to be their invention, nor are they intended to represent that the following experiments are all or only the experiments performed. Efforts have been made to ensure the accuracy of the figures used (e.g., quantities, temperatures, etc.), but some experimental errors and deviations should be taken into account. Unless otherwise stated, parts are parts by weight, molecular weights are weight-average molecular weights, temperatures are in degrees Celsius, and pressures are at atmospheres or near atmospheres. Example 1 Materials and Methods

[0125] mice Five-fold FAD and C57BL / 6 mice were purchased from Shanghai Model Biology Center Co., Ltd. All mice were housed in isolated, ventilated cages (maximum 5 mice per cage) at the Comparative Medical Animal Facility of Tongji University School of Medicine (TUSM). All mice were kept in a 12 / 12-hour light / dark cycle (24–26°C, 40–70% humidity) with free access to pellet food and water. Cages were checked daily to ensure animal welfare. All procedures were performed according to the protocol approved by the Institutional Animal Care and Use Committee (IACUC) of TUSM (reference number: SYXK(HU)2014-0026).

[0126] Isolation of mouse NSC Neural stem cells were isolated from the fetal brains of C57BL / 6 mice. In short, NSCs were obtained from mouse cortical tissue at embryonic day 13.5 and treated with NeuroCult... ® NSC basal culture medium (Stem Cell Technologies), NeuroCult ® NSCs were cultured in a medium supplemented with NSC proliferation supplement (Stem Cell Technologies), 20 ng / mL FGF2 (BioWalkersville), 20 ng / mL EGF (BioWalkersville), 2 μg / mL heparin (Sigma), N2 supplement (Gibco), 2 mM L-glutamine (ThermoFisher), and 100 U / mL penicillin & streptomycin (ThermoFisher) to form neurospheres. The primary neurospheres were then dissociated into single cells and re-platened to form the next round of neurospheres. After three rounds of neurosphere formation, the NSCs were purified.

[0127] Isolation of mouse microglia Microglia were isolated from the fetal brains of C57BL / 6 mice. Briefly, the brains of mice were dissected on day 1 after birth and digested at 37°C for 30 min in 0.25% trypsin-EDTA (Gibco) supplemented with 0.05% DNase I (Roche). Digestion was stopped by FBS (Invitrogen). The tissue pellet was centrifuged at 1500 rpm for 5 min at 4°C. After homogenization, the dissociated cells were cultured at 37°C in DMEM (Gibco) supplemented with 10 ng / mL GM-CSF, 10% FBS, 50 U penicillin, and 50 mg / mL streptomycin. Culture dishes were coated with 100 mg / mL poly-D-lysine (Sigma) and 5 mg / mL fibronectin (Sigma). The medium was changed every 3 days. Primary mouse microglia were isolated from the glial cell confluent culture by shaking. Floating microglia were collected by centrifugation at 1500 rpm for 5 min at 4°C.

[0128] Reprogramming mouse fibroblasts into iNSCs Mouse fibroblasts were derived from mouse embryos at day 14. Briefly, all internal organs, head, and spinal cord were removed from the embryo. The remaining skin tissue was washed twice with PBS and dissociated with 0.25% trypsin-EDTA solution. Mouse fibroblasts were cultured at 37°C under a humidified atmosphere of 5% CO2 in high-glucose medium supplemented with 10% FBS, 1% non-essential amino acids (non-AA), 100 U / ml penicillin, and 100 μg / ml streptomycin.

[0129] Mouse fibroblasts were directly reprogrammed into iNSCs. In short, mouse fibroblasts were incubated overnight in a supernatant containing a mixture of viruses. 10 μg / mL Millipore was added to promote viral transfection. One day after the second infection, infected fibroblasts were cultured in NSC medium. The NSC medium was changed every two days. On day 28 after retroviral transduction, colonies formed, which were manually selected and suspended in single cells to generate neurospheres. After 4–6 days of culture, floating primary neurospheres were collected and replated onto 6-well plates coated with poly-D-lysine / fibronectin. Cells were collected after reaching 80% confluence and resuspended in single cells for a second round of neurosphere formation. After three rounds of selection and enrichment, cells were collected for iNSC characterization.

[0130] Preparation of Aβ oligomers and Aβ-induced in vitro activation of microglia By Aβ 42β-peptide (GL Biochem, Shanghai) was prepared by dissolving it in 221.7 μl of HFIP (1,1,1,3,3,3-hexafluoro-2-propanol) (Sigma-Aldrich). 42 Peptide solution (1 mM). Incubate the solution at room temperature (RT) for 1 h, then on ice for 10 min. Afterward, aliquot the solution into non-silicified microcentrifuge tubes (100 μl solution containing 0.45 mg Aβ). 42 The sample was dried overnight at room temperature. The residue was dissolved in 20 μl of dimethyl sulfoxide (DMSO), added to F12 medium to prepare a 100 μM stock solution, incubated overnight at 4°C, and then centrifuged at 14,000 × g for 10 min at 4°C. Aβ oligomers appeared in the supernatant, which was confirmed by immunoblotting with anti-Aβ antibody (1:1000, BioLegend).

[0131] To mimic Aβ-induced microglial activation in vivo, primary microglia were treated with Aβ oligomers (dose: 10 μM) at 37°C for 48 h. The activity of pro-inflammatory genes in microglia was examined. Tnf and Il1b) and anti-inflammatory genes ( CD206 and Ym1 The expression levels of the corresponding transcripts and the expression levels of pro-inflammatory cytokines (Tnf-α and IL-1β) in the conditioning medium were used to confirm the activation of microglia.

[0132] Agonists / antagonists / siRNA and transfection antagomiR control, antagomiR-9, antagomiR-21a, antagomiR-34a, antagomiR-10b, and antagomiR-let7i were purchased from GenePharma (GenePharma). Transfection with 20 nM antagomiR-9, antagomiR-21a, antagomiR-34a, antagomiR-10b, antagomiR-let7i, or their respective controls was performed using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's instructions.

[0133] EV separation EVs were isolated from the conditioning medium of NSC and iNSC cultures. Briefly, the conditioning medium was first centrifuged at 300g for 10 min to remove cells, at 3000g for 20 min to remove cell debris, and at 10,000g for 30 min to remove intracellular organelles. The supernatant was filtered using a 0.22 μm syringe filter and then centrifuged at 100,000g for 4 h to collect EVs. Centrifugation was performed at 4°C. The EVs were resuspended in PBS and stored at -80°C for future use.

[0134] EVs were stained with Dil. The EV solution was slowly mixed with Dil in PBS (1:1000) and incubated in the dark at room temperature for 30 min. The mixture was washed once with PBS, filtered through a 0.22 μm filter, and centrifuged at 100,000 g for 2 h at 4°C, leaving any unbound dye for disposal. Mice were intravenously injected with Dil-labeled EV or PBS. After 5 min, the mice were sacrificed to obtain brain tissue. The brain tissue was sectioned into slices. After being sectioned into 10 μM sections, the sections were imaged on a Zeiss AX10 fluorescence microscope to detect Dil signals in brain cells.

[0135] Set up the group and inject EV intravenously into 5×FAD Four-month-old 5×FAD mice were randomly assigned to three groups: 5×FAD+PBS (n=10 / group), 5×FAD+NSC-EV (n=11 / group), and 5×FAD+iNSC-EV (n=11 / group). Age-matched C57BL / 6 mice injected with PBS (WT+PBS) served as controls (n=10 / group). Every three days, 200 μl of EV (0.5 μg / μl concentration) or an equal volume of PBS was administered intravenously via the tail vein over 5 minutes. Each animal received 10 injections. The EV dosage was selected based on a recent stroke study (Leng, F., Edison, P. Neuroinflammation and microglial activation in Alzheimer disease: where do we go from here?). Nat Rev Neurol . 17(3):157-172 (2021)).

[0136] Nanoparticle tracking analysis (NTA) NTA analysis was performed to determine the size and concentration of the EV samples. Briefly, under defined measurement conditions (25°C, 1 cP viscosity, 25 sec and 60 sec measurement time per capture frame), the EVs were resuspended in 1 ml of PBS for NTA analysis. The NTA analysis was evaluated using an sCMOS camera on a NanoSight NS300 system (Malvern Instruments, UK). Three separate measurements were applied to determine the size and concentration of the EVs.

[0137] Electron microscope (EM) For scanning electron microscopy (SEM), NSCs and iNSCs cultured on glass coverslips were fixed with 2.5% glutaraldehyde and washed three times with PBS. Cells were dehydrated by a series of increasing concentrations of ethanol and transferred for critical drying. The cells were then coated with gold-palladium to increase image contrast and imaged using a scanning electron microscope (S-3400, Hitachi). For transmission electron microscopy (TEM), purified EVs were negatively stained and then spread on a copper grid. Droplets of EVs were removed with filter paper and the cells were air-dried at room temperature. Images were taken using a transmission electron microscope (JEM-1230, JEOL Ltd.).

[0138] Morris Water Maze (MWM) Test MWM was performed to determine cognitive function and memory in mice. Mice were introduced into a circular tank filled with water, which was divided into four quadrants. Visual cues were placed around the tank in a conspicuous location to mark the underwater platform. Various parameters of mouse movement were recorded, including the time spent in each quadrant of the tank, the time spent reaching the platform (escape delay), and the total distance traveled. For each trial, mice were given no more than 60 seconds to locate the underwater platform before being guided to it. The mice were then removed from the water, dried with a towel, and returned to their cages. During the 6-day training phase, each mouse completed 4 trials per day. The day after training, a detection test was performed. The platform was removed, and each mouse was given 60 seconds to swim in the water. The swimming was videotaped and analyzed using Ethovision XT (Noldus, Netherlands).

[0139] Y Maze The Y-maze has three arms (20cm long × 10cm wide × 20cm high) at a 120° angle. The three arms include an initiating arm (always open); a novel arm, which is blocked in the first trial but open in the second; and another arm (always open). In the first trial, one arm is blocked, allowing the animal to explore the remaining two arms for 10 minutes. The second trial is conducted 2 hours after the first. In the second trial, the blocked arm is opened and treated as the novel arm. The animal is allowed to explore all three arms for 5 minutes, and entry into each arm is recorded. Spatial memory can be revealed by the identification of the novel arm in the second trial. A video camera connected to the Any-Maze animal tracking system software was mounted above the maze to record mouse movement for analysis. The time spent in the novel arm and entry into the novel arm indicate spatial recognition memory (learned behavior). The experimental environment was kept quiet, brightly lit, and slightly dark, and each arm of the Y-maze was cleaned with a 70% ethanol solution between trials.

[0140] Open field test Open-field testing was conducted using an open-field apparatus (30×30×21cm) with nine virtual quadrants (each 10×10cm). The central area consisted of four sub-squares marked in red. At the start of the test, each mouse was placed in the center and allowed to explore freely for 5 minutes. Crossover counts, time spent in the center and perimeter, feeding, feces tray usage, rest time, jumping, and effort made to escape were recorded for each mouse. Total distance and time, as well as the distance traveled and time spent in the central area (10cm×10cm), were analyzed using activity monitoring software (Med Associates, Inc.). The apparatus was cleaned with 70% ethanol between trials.

[0141] Fear Conditioning Test The test consisted of a two-day training and testing phase. During the training phase, mice were placed in an adaptation chamber for a 120-second acclimatization period. Then, mice were presented with an 80 dB tone for 30 seconds, followed by a two-second 0.7 mA foot strike, and then a second tone and foot strike were performed after a 120-second interval. The mice were removed from the chamber 30 seconds after the second strike. In the situational test, mice were placed in the same chamber used during training for 5 minutes without tone or foot strike, and the duration of the frozen behavior was recorded using a stopwatch. Percentage of frozen time (defined as the time the mouse did not move except for respiration) was recorded and analyzed using the Panlab Startleand Fear combined system and Packwin 2.0 software.

[0142] Protein extraction and Western blotting Brain tissue was extracted from euthanized mice and homogenized using a homogenizer in M-PER protein extraction buffer (Pierce) containing a mixture of protease inhibitors (Sigma). Protein concentrations were determined using a BCA protein assay kit (Pierce). Proteins (5–10 μg) were separated from tissue lysates by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinyl fluoride membranes (Millipore and Bio-Rad). Proteins were treated overnight at 4°C with purified primary antibody against CD9 (rabbit, Abcam, 1:2000), raft protein 1 (mouse, BD Biosciences; 1:5000), raft protein 2 (rabbit, CST, 1:1000), APOA1 (rabbit, Affinity Biosciences, 1:500), APOA2 (rabbit, Affinity Biosciences; 1:500), CD68 (rabbit, Abcam; 1:1000), CD86 (rabbit, CST; 1:1000), or β-actin (mouse, CST; 1:1000), followed by treatment with horseradish peroxidase-linked secondary antibody (rabbit or anti-mouse, CellSignaling Technologies, 1:10000). Antigen-antibody complexes were visualized using Pierce ECL protein blot substrates (ThermoFisher Scientific, Waltham, MA). The film was then scanned using a Canon Scan 9950F scanner, and the acquired images were analyzed on a Macintosh computer using the free public domain NIH ImageJ program.

[0143] Enzyme-linked immunosorbent assay (ELISA) Hippocampal and cortical tissue lysates from mice were collected, and Aβ was measured using a commercially available ELISA kit according to the manufacturer's protocol. 1-42 The levels of TNF-α (catalog number KE1266, Immunoway), IL-1β (catalog number KE1419, Immunoway), and IL-1β (catalog number KE1416, Immunoway) were determined. Triplets of diluted standards and lysates were added to the corresponding wells and incubated on a microplate shaker at room temperature for 2 h. Sample diluents were used as blank controls. Streptavidin-HRP (100 μl / well) was added and incubated at room temperature for 45 min. Then, TMB substrate solution (100 μl / well) was added and incubated at room temperature for 30 min. The enzyme reaction was stopped with stop solution (100 µl / well). The absorbance of each well was read using a spectrophotometer DV8200 (Drawell). Aβ was determined based on the standard curve. 1-42TNF-α and IL-1β concentrations.

[0144] Immunohistochemistry Tissue sections were fixed overnight in 4% paraformaldehyde (Sigma) at 4°C and then transferred to 30% sucrose for incubation at 4°C for 24 h. After three washes with PBS, the sections were incubated for 1 h at room temperature with permeabilization and blocking buffer containing 5% goat serum (Vector Laboratories) and 0.5% Triton X-100 (Bio-Rad) in PBS. Tissue sections were then incubated overnight at 4°C with primary antibody (Aβ, catalog 15126S, CST, 1:400), nestin (chicken, catalog NB100-1604, Novus, 1:5000), Sox2 (rabbit, catalog ab92494, Abcam, 1:500), CD9 (rabbit, catalog 98327, CST, 1:100), Ki67 (rabbit, catalog 9129S, CST (1:400)), DCX (rabbit, catalog 4604S, CST), NeuN (mouse, catalog MAB377, Millipore, 1:200), or Iba1 (goat, catalog ab5076, Abcam, 1:500). The next day, after washing three times with PBS, tissue sections were incubated with secondary antibody (molecular probe) at room temperature for 1 h. Sections were then mounted using a VectaShield (Vector Laboratories) device. Images were captured using a Zeiss AX10 fluorescence microscope with ZEN 2.3 (blue edition) software. To quantify the density of immunoreactive cells, the hippocampus, prefrontal cortex (PFC), and subventricular zone (SVZ) were imaged at 20x magnification. For each animal, three coronal sections spanning different depths across the hippocampus, PFC, and SVZ were analyzed along the head-tail axis. Four to five images were captured on matching regions of selected brain areas in each section. The number of immunoreactive amyloid plaques and cells was quantified using ImageJ. The amyloid plaque load in the cortex and hippocampus of each section (area occupied by all plaques divided by the total area) was estimated using the AnalyzeParticles plugin of ImageJ software. The mean immunoreactive amyloid plaque and cell density for each animal was obtained by averaging the values ​​of each section.

[0145] Golgi-Cox staining Mouse cortical and hippocampal tissues were incubated for 14 days at room temperature in Golgi-Cox staining solutions A / B from the FD Rapid Golgi Stain™ kit (FDNeurotechnologies) in the dark. On the second day, solution C was changed, and brain tissue was incubated in the dark at 4°C for 72 hours. Afterward, brain tissue blocks were encapsulated in a 10% sucrose-4% agarose solution to obtain 100µm thick sections using a Leica VT1200S vibratory microtome. Sections were mounted on gelatin-coated slides and allowed to air dry for 20 minutes. The Golgi-Cox reaction was performed according to the manufacturer's instructions. Finally, the sections were counterstained with toluidine blue to identify anatomical structures. Images were taken using an Olympus 1X71 with 20, 40, and 64 objectives.

[0146] Quantitative reverse transcription polymerase chain reaction (qRT-PCR) According to the manufacturer's instructions, mRNA and miRNA were isolated from brain tissue and cells using the RNeasy Mini Kit (Qiagen). Genomic DNA was extracted using the DNase I Digestion Kit (Qiagen). cDNA was synthesized using the miScript II RT Kit (Qiagen). Transcripts were amplified using the SYBR green PCR Kit (Qiagen) with an ABI7500 (Applied Biosystems), wherein the ABI7500 has... Gapdh (Forward: CATGTTCCAGTATGACTCCACTC (SEQ ID NO: 1), Reverse: GGCCTCACCCCATTTGATGT (SEQ ID NO: 2)) Il1b (Forward: CCAGCAGGTTATCATCATCATCC (SEQ ID NO: 3), Reverse: CTCGCAGCAGCACATCAAC (SEQ ID NO: 4)) Nos2 (Forward: CCCTTCAATGGTTGGTACATGG (SEQ ID NO: 5), Reverse: ACATTGATCTCCGTGACAGCC (SEQ ID NO: 6)) Tnf (Forward: ACGTGGAACTGGCAGAAGAG (SEQ ID NO: 7), Reverse: GGTCTGGGCCATAGAACTGA (SEQ ID NO: 8)), Myod88 (Forward: CGGGTCCCTGGACTCCTTCA (SEQ ID NO: 9), Backward: CGCGTTTCCAGCTCTCGGAT (SEQ ID NO: 10)) Ym1 (Forward: TCACAGGTCTGGCAATTCTTCTG (SEQ ID NO: 11), Reverse: ACTCCCTTCTATTGGCCTGTCC (SEQ ID NO: 12)) CD206(Forward primer: TCTTTGCCTTTCCCAGTCTCC (SEQ ID NO: 13), Reverse primer: TGACACCCAGCGGAATTTC (SEQ ID NO: 14)) and miRNA (universal primer: GAATCGAGCACCAGTTACGC (SEQ ID NO: 15), U6 primer: TGGCCCCTGCGCAAGGATG (SEQ ID NO: 16), miR-9: TCTTTGGTTATCTAGCTGTATGA (SEQ ID NO: 17), let-7i: TGAGGTAGTAGTTTGTGCTGTT (SEQ ID NO: 18), miR-10b: TACCCTGTAGAACCGAATTTGTG (SEQ ID NO: 19), miR-21a: TAGCTTATCAGACTGATGTTGA (SEQ ID NO: 20), miR-30a: TGTAAACATCCTCGACTGGAAG (SEQ ID NO: 21), miR-99a: AACCCGTAGATCCGATCTTGTG (SEQ ID NO: 22), let-7f: TGAGGTAGTAGATTGTATAGTT (SEQ ID NO: 23), let-7g: TGAGGTAGTAGTTTGTACAGTT (SEQ ID NO: 24), miR-181a: AACATTCAACGCTGTCGGTGAGT (SEQ ID NO: 25), miR-26a: TTCAAGTAATCCAGGATAGGCT (SEQ ID NO: 26), miR-129: CTTTTTGCGGTCTGGGCTTGC (SEQ ID NO: 27), let-7c: TGAGGTAGTAGGTTGTATGGTT (SEQ ID NO: 28), let-7b: TGAGGTAGTAGGTTGTGTGGTT (SEQ ID NO: 29),miR-148a:TCAGTGCACTACAGAACTTTGT (SEQ ID NO: 30),miR-100: The specific primer set for AACCCGTAGATCCGAACTTGTG (SEQ ID NO: 31) was determined. Each sample was subjected to three reactions, with a template-free blank used as a negative control. Values ​​were normalized to... Gapdh (mRNA) and U6 snRNA (miRNA).

[0147] RNA sequencing (RNA-seq) Total RNA was extracted from cortical and hippocampal tissues of experimental and control mice using the mirVana miRNA isolation kit (Ambion). Sample processing was performed by OE Biotech Co., Ltd. (Shanghai, China). RNA integrity was evaluated using an Agilent 2100 bioanalyzer (Agilent Technologies). Libraries were constructed using the TruSeq Stranded mRNA LTSamplePrep Kit (Illumina). The libraries were sequenced on an Illumina sequencing platform (Illumina NovaSeq 6000), generating 125bp / 150bp paired-end reads. Raw data (raw reads) were processed using Trimmomatic. Clean reads were mapped to a reference genome using hisat 2. FPKM values ​​for each gene were calculated using cufflinks, and read counts for each gene were obtained using htseq. DEGs were identified using the DESeq 2012 R package functions estimateSizeFactors and nbinomTest. P-values ​​< 0.05 and fold changes > 2 or < 0.5 were set as thresholds for significant differential expression. Hierarchical cluster analysis was performed on differentially expressed genes (DEGs) to explore gene expression patterns. Enrichment of gene ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways in DEGs was analyzed using the DAVID online tool (david.abcc.ncifcrf.gov). GO terms corresponding to biological processes were selected. Analysis using the DAVID online tool... p - Values ​​determine GO terms and KEGG pathway enrichment. p The value was determined by a modified Fisher exact test and adjusted using the Benjamini-Hochberg method.

[0148] miRNA microarray Total RNA was extracted from NSC-EV and iNSC-EV. Illumina was used for the extraction. ® (NEB)'s NEBNext ®The MultiplexSmall RNA Library Prep Set was used to generate sequencing libraries from 3 μg of total RNA per sample as input material. The indexed samples were clustered using the TruSeq SR Cluster Kit v3 cBot HS (Illumia) on the cBot Cluster generation system. After clustering, the libraries were sequenced on an Illumina Hiseq 2500 / 2000 platform, generating 50 bp single-end reads. The raw data (raw reads) in FastQ format were first processed using custom Perl and Python scripts for quality control. Small RNA tags were mapped to reference sequences via Bowtie in the absence of mismatches to analyze their expression and distribution on the reference sequences. The mapped small RNA tags were used for matching with known miRNAs. miRBase 20.0 was used as a reference for known miRNAs, while miRDeep2 and sRNA-tools-cli were used to obtain new miRNAs and map their secondary structures, respectively. miRNA expression levels were estimated using TPM (transcripts per million).

[0149] Statistical analysis Unpaired Student's t-test was used to analyze statistical differences between two independent groups, and parametric one-way ANOVA with post-hoc Bonferroni test was used to assess statistical differences between more than two groups. Data were presented as mean ± standard deviation, and significance was determined to be 1 / 2. p <0.05. result

[0150] EVs were isolated from the conditioning medium of mouse NSCs and iNSCs. iNSCs were characterized by immunocytochemistry (Figures 1A and 1B). The purity of EVs was verified by Western blotting, nanoparticle tracking analysis, and electron microscopy (Figures 2A to 2E).

[0151] Five minutes after intravenous administration of EVs labeled with the lipophilic carbonyl cyanin fluorescent membrane labeling dye Dil, Dil signaling was detected in vivo via fluorescence analysis throughout the mouse body (Fig. 3) and in the brain (Fig. 4). Tuj1 was also detected by immunohistochemical analysis in the cortex (Figs. 5A–5C) and hippocampus (Figs. 6A–6C). + Neuron, GFAP + Astrocytes and Iba1 + The detection of Dil signals colocalized with the EV marker CD9 in microglia indicates that EVs have been absorbed by brain cells.

[0152] Then, four-month-old APP / PS1 double transgenic mice (5×FAD mice) co-expressing five familial AD mutations were intravenously injected every three days with 200 μl of EV (0.5 μg / μl concentration) or an equal volume of PBS for one month. After EV treatment, compared with the PBS control, 5×FAD mice took less time to find the platform in the water maze (Figs. 33A-33B). Compared with the PBS control, EV treatment also increased the distance and time spent by 5×FAD mice in the target quadrant during the memory phase (Fig. 33C), without affecting motor skills (Fig. 7).

[0153] The Y-maze test showed that, compared with the PBS control, EV treatment significantly increased the number and proportion of novel arm entries in 5×FAD mice (Fig. 33D) without affecting the mice's motor performance (Fig. 8). Compared with the PBS control, EV treatment also significantly increased the number of feedings, shortened the freezing time, and expanded the number of central region entries in the open field test (Fig. 33E). In addition, EV treatment significantly reduced the extracellular plaque density and mean size in the prefrontal cortex (PFC) (Fig. 33F, Fig. 33G) and hippocampus (Fig. 9A to Fig. 9D) of 5×FAD mice.

[0154] Importantly, ELISA assays showed that Aβ levels in the PFC (Fig. 33H) and hippocampus (Fig. 10) of mice injected with EV were significantly lower. 1-42 The levels were significantly reduced. Similarly, compared with the PBS group, EV treatment reduced the proliferation of phosphorylated Tau (pTau) in the PFC and hippocampus of 5×FAD mice (Fig. 33I, Fig. 33J, Fig. 11), and increased dendritic length and dendritic spine density (Fig. 33K, Fig. 33L, Fig. 33M, Fig. 12A to Fig. 12D).

[0155] Furthermore, as demonstrated in the water maze and fear conditioning tests, EV significantly improved cognitive function in 5×FAD mice even one month after administration (Figs. 13A–13F, 14A–14B). Additionally, compared to the PBS control, Aβ levels were significantly reduced one month after EV injection. 1-42 The accumulation of β-lactamase (Fig. 15A–15F) and pTau proliferation (Fig. 16A–16B) were significantly reduced, while dendritic length and dendritic spine density in the PFC and hippocampus of EV-injected mice (Fig. 17A–17H) were significantly increased, indicating a long-lasting therapeutic effect of EV. Therefore, iNSC-EV shows comparable (if not more, not less) therapeutic potential to NSC-EV in AD-like behavior and pathological phenotypes.

[0156] EVs derived from MSCs (a widely used cell type in regenerative medicine) and fibroblasts (the origin cells of iNSCs) were further collected (Figs. 18A–18D). The water maze test showed that, compared to the MSC-derived EV (MSC-EV) and fibroblast-derived EV (FB-EV) injection groups, mice in the iNSC-EV injection group had more platform crossings and similar distance / time at the target platform (Figs. 19A–19F). The fear condition test showed that, compared to MSC-EV and FB-EV, iNSC-EV had a greater effect on increasing the freezing time in 5×FAD mice (Figs. 20A–20B). Compared to MSC-EV and FB-EV, iNSC-EV had a greater effect on Aβ. 1-42 Accumulation (Fig. 21A-21F) and pTau proliferation (Fig. 22A-22B) also showed greater inhibitory effects, and had better therapeutic effects on restoring dendritic length and dendritic spine density in the PFC and hippocampus of 5×FAD mice (Fig. 23A-23H). Therefore, iNSC-EV shows greater potential than MSC-EV in alleviating the AD-like phenotype in 5×FAD mice.

[0157] To understand the potential mechanisms underlying the improvement in AD-like phenotype mediated by iNSC-EV, RNA-seq analysis was performed on RNA isolated from the PFC. The top 40 differentially expressed genes (DEGs) between groups revealed that EV administration restored AD-induced gene expression dysregulation (Fig. 33N). GO and KEGG analyses showed that, compared to the PBS control, DEGs in the NSC-EV and iNSC-EV injection groups were strongly associated with inflammation-related terms and signaling pathways, respectively (Figs. 33O–33R). Similar results were obtained through RNA-seq analysis of RNA isolated from the hippocampus, suggesting that neuroinflammation (a key pathological feature and risk factor for AD) is a potential target of EV treatment (Figs. 24A–24E). The RNA-seq results were confirmed by immunohistochemical analysis, indicating that NSC-EVs and iNSC-EVs were primarily internalized by microglia, resident immune cells in the brain (Figs. 25A–25E).

[0158] In addition, EV administration significantly reduced PFC and periplasmic Iba1 in the hippocampus of 5×FAD mice. + Cell count and Iba1 + The degree of cell clustering (Fig. 33S to Fig. 33V, Fig. 26A to Fig. 26D). Western blot results also showed that, compared with PBS control, the expression levels of pro-inflammatory proteins CD86, iNOS, and IL-1β were significantly reduced in the PFC (Fig. 33W, Fig. 33X) and hippocampus (Fig. 26E to Fig. 26H) of mice injected with EV.

[0159] Furthermore, compared with mice injected with PBS, 5×FAD mice injected with EV had higher levels of GFAP in both the PFC and hippocampus. + The proportion of cells decreased, which confirms that EVs also inhibited astrocyte activation (Figs. 27A to 27B).

[0160] To elucidate the potential mechanisms of EV-mediated immune regulation, microarray analysis was performed on the profiles of important and enriched miRNAs in NSC-EV and iNSC-EV (Fig. 28A). Microarray results showed that multiple miRNA families (e.g., let-7, miR-9, and miR-21) were enriched in both NSC-EV and iNSC-EV (Figs. 28B–28D), which was confirmed by qRT-PCR analysis (Figs. 28E, 28F). Volcano plots further identified differentially expressed miRNAs in NSC-EV (e.g., miR-34a, etc.) compared to iNSC-EV (e.g., miR-10b, etc.) (Fig. 28B). Interestingly, in the EV-injected group, approximately 40% of the downregulated genes identified by RNA-seq (including pro-inflammatory genes (e.g., ...) were...) Il1b , Il12b ) and Aβ-related genes (e.g., Mmp13 , Atp8b4 These are expected to become direct targets of EV-enriched miRNAs (Figure 29). Knockout of EV-enriched miRNAs (including let-7i, miR-21a, and miR-10b) significantly reduced the inhibitory effect of EV on Aβ-induced microglial activation (Figures 30A to 30B), indicating that miRNAs are key mediators of EV-dependent immune regulation.

[0161] Furthermore, immunohistochemical results demonstrated that, compared to the PBS control, mice injected with EV had significantly higher levels of NeuN in the PFC and hippocampus. + Neuron (Figures 31A to 31B), Ki67 + Proliferating cells and DCX + The significantly increased number of neuronal precursors (Figs. 32A to 32D) indicates that iNSC-EV and NSC-EV are equally effective in restoring neuronal damage and neurogenesis impairment induced by neuroinflammation and Aβ deposition. Therefore, these results suggest that anti-neuritis is an important mechanism for EV-mediated improvement in AD-like phenotypes.

[0162] In summary, these data demonstrate for the first time that, after intravenous injection, iNSC-EV exhibits comparable therapeutic effects to NSC-EV in cognitive function, Aβ deposition, neuroinflammation, and neurogenesis in 5×FAD mice, suggesting that iNSC-EV is a promising alternative to NSC-EV in the treatment of AD. Example 2

[0163] This embodiment demonstrates the use of extracellular vesicles derived from iNSCs to treat patients with Alzheimer's disease.

[0164] The test revealed that human patients had Alzheimer's disease.

[0165] The composition, comprising a therapeutically effective amount of iNSC-derived extracellular vesicles, was administered to the patient. The efficacy and safety of the composition were tested in in vitro cell culture and in vivo animal models prior to its use in treating human patients. Example 3 Materials and Methods

[0166] Cell culture Human neuroblastoma cells (SH-SY5Y) were grown in a humidified tissue culture incubator at 37°C and 5% CO2 in 1:1 EMEM / F12 medium supplemented with heat-inactivated 15% fetal bovine serum (FBS), 100 U / mL penicillin / streptomycin, 1× non-essential amino acids and 2 mM glutamine.

[0167] CCK8 Measurement In summary, 5,000 SH-SY5Y cells were cultured in each well of a 96-well plate. The SH-SY5Y cells were then treated with 15 μg / ml EV for 24 h. Cell viability was measured using a CCK-8 assay (Yeasen, #40203ES80). Experiments were performed according to the manufacturer's instructions. Absorbance was measured at 450 nm and analyzed using a SpectraMax M5 microplate reader (Molecular Devices).

[0168] Dual-luciferase reporter assay APP / ACL4 wild-type (wt) 3'UTR and mutant (mut) 3'UTR were synthesized by Genewiz (Genewiz, Suzhou, China) and cloned into the PmeI and SacI sites of the pmirGLO vector (Promega, Beijing, China) downstream of the firefly luciferase gene. For luciferase assays, 3,000 293T cells were co-cultured in 96-well plates with DMEM, 10% FBS, 100 μg / ml streptomycin, and 100 U / ml penicillin. After reaching approximately 70% confluence, cells were co-transfected with miR-26a-5p mimics and APP / ACL4 3'UTR-wt or 3'UTR-mut dual luciferase reporter vectors. Transfection solutions were prepared using serum-free Opti-MEM according to the manufacturer's instructions, and transfection was promoted using Lipofectamine 2000 reagent (Invitrogen). Luciferase activity was determined 24 hours post-transfection using a Dual Luciferase® Reporter assay system (Promega Corporation, Beijing, China) on a SpectraMax M5 microplate reader (Molecular Devices). The activity of firefly luciferase was normalized using the activity of Renida luciferase.

[0169] ROS measurement based on DHE ROS generation was detected using a ROS-sensitive fluorescent indicator-dihydroethidium (DHE) assay kit (Shanghai BestBio Biotechnology Co., Ltd.). ROS generation was represented by total DHE fluorescence, and fluorescence intensity was detected using a fluorescence microscope.

[0170] Quantitative real-time polymerase chain reaction (qRT-PCR) mRNA and miRNA were isolated from brain tissue and cells using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. Genomic DNA was extracted using the DNase I Digestion Kit (Qiagen). cDNA was synthesized using the miScript II RT Kit (Qiagen, Valencia, CA). Transcripts were amplified using the SYBR green PCR Kit (Qiagen, Valencia, CA) and an ABI 7500 (Applied Biosystems, Waltham, MA). All qPCR results were measured three times for each sample, with a template-free blank used as a negative control. Amplification curves and gene expression were normalized to housekeeping genes. GAPDH .

[0171] Agonists / antagonists / siRNA and transfection antagomiR control and antagomiR-26a were purchased from GenePharma. 20 nM antagomiR-26a or its corresponding control were transfected using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's instructions. result

[0172] Figure 34 shows that iNSC-EV alleviated Aβ oligomer-induced cell damage. Human neuronal cell line SH-SY5Y was stimulated with Aβ oligomers, followed by EV treatment. Cell viability was determined by CCK8 assay. Error bars represent standard deviation. * and **** indicate... p <0.05 and p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0173] Figures 35A and 35B show that iNSC-EV eliminated Aβ oligomer-induced inhibition of synaptic factor expression. Human neuronal cell line SH-SY5Y was stimulated with Aβ oligomers, followed by EV treatment. Transcriptional levels of the postsynaptic gene PSD95 and the presynaptic gene synaptic vesicle protein were determined in SH-SY5Y cells by qRT-PCR. Error bars represent standard deviation. ns indicates no significance. *, ***, and **** represent... p <0.05、 p <0.001 and p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0174] Figures 36A and 36B show that iNSC-EV reversed Aβ oligomer-induced oxidative stress and ferroptosis. Human neuronal cell line SH-SY5Y was stimulated with Aβ oligomers followed by EV treatment. (A) ROS accumulation in SH-SY5Y cells was determined by quantifying ROS+ cells (DHE+ cells). (B) Antiferroptosis genes in SH-SY5Y cells were identified by qRT-PCR. GPX4 and ferroptosis genes ACSL4 Transcriptional levels. Error bars represent standard deviations. ns indicates no significance. *, **, ***, and **** represent... p <0.05、 p <0.01、 p <0.001 and p<0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0175] Figures 37A and 37B illustrate that iNSC-EV inhibits Aβ processing genes. Human neuronal cell line SH-SY5Y was stimulated with Aβ oligomers, followed by EV treatment. Key Aβ processing genes in SH-SY5Y cells were identified by qRT-PCR. APP and BACE1 Transcription levels. Error bars represent standard deviations. ns indicates no significance. *** and **** represent... p <0.001 and p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0176] Figures 38A and 38B show the 3'UTRs of miR-26a-5p targeting the APP and ACSL4 transcripts. Figure 38A shows the pairing of 3'UTRs of candidate genes and miR-26a-5p predictions on the TargetScan website. Figure 38B shows that the inhibition of luciferase activity by the APP and ACSL4 3'UTRs is miR-26a-5p dependent. Firefly luciferase activity was normalized to an internal control, namely Renidae luciferase activity. Error bars represent standard deviations. ns indicates no significance. ** and *** represent... p <0.01 and p <0.001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test.

[0177] Figures 39A-39B show that miR-26a-5p targets the 3'UTR of APP and ACSL4 transcripts. Human neuronal cell line SH-SY5Y cells were stimulated with Aβ oligomers, followed by EV treatment with / without miR-26a-5p. SH-SY5Y cells were identified by qRT-PCR. APP and ACSL4 Transcription level. Error bars represent standard deviation. ns indicates no significance. **, *** and **** represent [variables / values]. p <0.01、 p <0.001 and p <0.0001. Statistical differences between groups were assessed using parametric one-way ANOVA with post-hoc Bonferroni test. References

[0178] 1. G.M. McKhann, D.S. Knopman, H. Chertkow, B.T. Hyman, C.R. JackJr., C.H. Kawas, W.E. Klunk, W.J. Koroshetz, J.J. Manly, R. Mayeux, et al.The diagnosis of dementia due to Alzheimer’s disease: recommendations fromthe National Institute on Aging-Alzheimer’s Association workgroups ondiagnostic guidelines for Alzheimer’s disease. Alzheimers Dement. , 7 (2011),pp. 263-269. 2. L. Vermunt, S.A.M. Sikkes, A. van den Hout, R. Handels, I. Bos,W.M. van der Flier, S. Kern, P.-J. Ousset, P. Maruff, I. Skoog, et al.Duration of preclinical, prodromal, and dementia stages of Alzheimer’sdisease in relation to age, sex, and APOE genotype. Alzheimers Dement. , 15(2019), pp. 888-898. 3. Leng, F., Edison, P. Neuroinflammation and microglial activationin Alzheimer disease: where do we go from here? Nat Rev Neurol . 17(3):157-172(2021). 4. Xia, X., Wang, Y., Zheng, J.C. Extracellular vesicles, from thepathogenesis to the therapy of neurodegenerative diseases. Transl Neurodegener. 11(1):53 (2022). 5. Ma, Y. et al. Exosomes released from neural progenitor cells andinduced neural progenitor cells regulate neurogenesis through miR-21a. Cell Commun Signal . 17(1):96 (2019). 6. Gao, G. et al. Induced neural stem / progenitor cell-derivedextracellular vesicles promote recovery post-stroke. Clin Transl Med . 12(6):e936 (2022).

Claims

1. A method for treating Alzheimer's disease in a patient in need, comprising administering to the patient a composition comprising a therapeutically effective amount of extracellular vesicles.

2. The method according to claim 1, wherein, The extracellular vesicles are isolated from the cell culture medium.

3. The method according to any one of claims 1-2, wherein, The cells are neural stem cells (NSCs), mesenchymal stem cells (MSCs), or fibroblast-derived induced NSCs (iNSCs).

4. The method according to any one of claims 1-3, wherein, The extracellular vesicles contain one or more of the following miRNAs: let-7, miR-9, miR-21, miR-34a, and miR-10b.

5. The method according to any one of claims 1-4, wherein, The extracellular vesicles contain let-7, miR-21, and miR-10b.

6. The method according to any one of claims 1-5, wherein, The application is to be performed at least once a day or multiple times a day.

7. The method according to any one of claims 1-6, wherein, The application is to be performed at least once every three days.

8. The method according to any one of claims 1-7, wherein, The application is to be continued for at least one month.

9. The method according to any one of claims 1-8, wherein, The administration is carried out via oral, intravenous, intramuscular, intraperitoneal, intranasal, rectal, or sublingual routes.

10. The method according to any one of claims 1-9, wherein, The dosage of the composition is in the range of 2 mg to 2,000 mg, 2 mg to 500 mg, 2 mg to 200 mg, 2 mg to 150 mg, 5 mg to 100 mg, or 5 mg to 50 mg.

11. The method according to claim 10, wherein, The dosage is administered in divided doses or as a single dose.

12. The method according to any one of claims 1-11, wherein, The composition downregulates Aβ in the prefrontal cortex (PFC) and hippocampus. 1-42 The level.

13. The method according to any one of claims 1-11, wherein, The composition reduces the proliferation of phosphorylated Tau (pTau).

14. The method according to any one of claims 1-11, wherein, The composition regulates neuroinflammation.

15. The method according to any one of claims 1-11, wherein, The composition reduces the levels of CD86, iNOS, and IL-1β in the PFC and the hippocampus.

16. The method according to any one of claims 1-11, wherein, The composition reduces the expression of one or more of the following genes: Il1b, Il12b, Mmp13, and Atp8b4.

17. A composition comprising a therapeutically effective amount of extracellular vesicles for treating Alzheimer's disease in patients in need.

18. The composition according to claim 17, wherein, The extracellular vesicles are isolated from the cell culture medium.

19. The composition according to claim 18, wherein, The cells are neural stem cells (NSCs), mesenchymal stem cells (MSCs), or fibroblast-derived induced NSCs (iNSCs).

20. The composition according to any one of claims 17-19, wherein, The extracellular vesicles contain one or more of the following miRNAs: let-7, miR-9, miR-21, miR-34a, and miR-10b.

21. The composition according to any one of claims 17-20, wherein, The extracellular vesicles contain let-7, miR-21, and miR-10b.

22. The composition according to any one of claims 17-21, wherein, The composition downregulates Aβ in the prefrontal cortex (PFC) and hippocampus. 1-42 The level.

23. The composition according to any one of claims 17-22, wherein, The composition reduces the proliferation of phosphorylated Tau (pTau).

24. The composition according to any one of claims 17-23, wherein, The composition regulates neuroinflammation.

25. The composition according to any one of claims 17-24, wherein, The composition reduces the levels of CD86, iNOS, and IL-1β in the PFC and the hippocampus.

26. The composition according to any one of claims 17-25, wherein, The composition reduces the expression of one or more of the following genes: Il1b, Il12b, Mmp13, and Atp8b4.

27. A method for preparing the composition according to any one of claims 17-26.

28. Use of the composition according to any one of claims 17-26 for the treatment of Alzheimer's disease in patients in need.

29. The use according to claim 28, wherein, The composition is administered in doses of 2 mg to 2000 mg, 2 mg to 500 mg, 2 mg to 200 mg, 2 mg to 50 mg, 5 mg to 100 mg, or 5 mg to 50 mg.

30. The use according to claim 28 or 29, wherein, The composition is applied at least once a day or multiple times a day.

31. The use according to any one of claims 28-30, wherein, The administration is carried out via oral, intravenous, intramuscular, intraperitoneal, intranasal, rectal, or sublingual routes.