Modified nucleoside compound and oligonucleotide prepared from same

Abstract

The invention provides a nucleoside phosphoramidite compound as shown in a formula I. The invention further provides a preparation method of the nucleoside phosphoramidite compound. The nucleoside phosphoramidite compound disclosed by the invention can be introduced into the head and tail ends and / or the middle of oligonucleotide, the stability of the oligonucleotide is enhanced while the biological function of the oligonucleotide is enhanced or basically maintained, and the continuous acting time is prolonged.

Description

Technical Field

[0001] This invention relates to the field of biopharmaceuticals, specifically to a modified nucleoside compound and oligonucleotides prepared therefrom. Background Technology

[0002] Oligonucleotide therapeutics, including small interfering RNA (siRNA), are a new class of drugs capable of modulating the expression of pathogenic genes. The U.S. Food and Drug Administration (FDA) has approved six siRNAs, all for liver targeting, and many other candidates are in late-stage clinical trials. The foundation of a successful oligonucleotide therapeutic platform is an optimized chemical structure that provides metabolic stability to support robust, safe, and sustained regulation of gene expression in tissues of interest. Backbone stability is crucial for the in vivo efficacy of therapeutic oligonucleotides. Various oligonucleotide backbone modifications (amides, GNAs, TNAs, E-VPs, PSs, and guanidine phosphates, etc.) have been developed to enhance siRNA function. While these modifications show great potential for the future of oligonucleotide therapy, currently, the phosphothioester (PS) backbone is the only backbone modification used clinically for siRNA stabilization. This is primarily because PS modifications are highly compatible with RNA-binding protein mechanisms, which are essential for gene silencing, and are highly resistant to nuclease-mediated degradation, extending the duration of action of oligonucleotides from weeks to months. However, 3'-truncated metabolites are detectable in vivo for several months after injection. The presence of these 3'-truncated molecules as major metabolites suggests that 3'-terminal degradation is a key factor limiting the long-term effects and persistence of oligonucleotides, particularly in extrahepatic tissues. Sustained 3'-terminal degradation may occur because PS modification is insufficient to alter the backbone structure to prevent recognition by exonucleases.

[0003] This invention provides a novel oligonucleotide backbone that significantly improves the stability of 3' exonucleases while minimizing impact on the overall structure, charge, and thermal stability of the siRNA double strand. The novel backbone is well tolerated in a fully chemically modified (2-OMe and 2-F) siRNA background and is compatible with PS. Binding PS to the 3' end of the siRNA antisense strand positively influences the plasma pharmacokinetics and tissue accumulation of siRNA, thereby improving the efficacy and duration of action of RNAi in vivo. This novel backbone provides a new option for enhancing the stabilization of oligonucleotides, expanding the clinical application of oligonucleotide therapeutics beyond the liver. Summary of the Invention

[0004] This invention first provides a nucleoside compound of Formula I, or a deuterated form thereof, or a stereoisomer thereof:

[0005]

[0006] in,

[0007] X 1 X 2 Each is independently selected from O or S;

[0008] R 1 R 2 The components are independently selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, substituted C2-C6 ynyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, -(C0-C2 alkylene)-(3-10 membered carbide ring), -(C0-C2 alkylene)-(4-10 membered heterocycle), -(C0-C2 alkylene)-(6-10 membered aromatic ring), and -(C0-C2 alkylene)-(5-10 membered aromatic heterocycle); wherein the alkylene, carbide ring, heterocycle, aromatic ring, and aromatic heterocycle are optionally surrounded by 1, 2, or 3 R's. 1a Replace; and R 1 R 2 They are not both hydrogen;

[0009] R 3 R 4 R 5 R 6 They are independently selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl, C1-C6 alkoxy, and substituted C1-C6 alkoxy, respectively.

[0010] R 7 Selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, substituted C2-C6 ynyl, C1-C6 alkoxy, substituted C1-C6 alkoxy.

[0011] Each R 1a They are independently selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl, C1-C6 alkoxy, and substituted C1-C6 alkoxy, respectively.

[0012] The substituents in the substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, and substituted C1-C6 alkoxy groups are selected from hydrogen, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 alkoxy, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)(C1-C6 alkyl), -NHC(O)(C1-C6 alkyl), -C(O)(C1-C6 alkyl), -C(O)NH(C1-C6 alkyl), and -C(O)N(C1-C6 alkyl)(C1-C6 alkyl);

[0013] Nu is a hydrogen or nucleoside base.

[0014] Furthermore, the compounds represented by Formula I are shown in Formulas IIa and IIb:

[0015]

[0016]

[0017] Among them, X 1 X 2 R 1 R 2 R 3 R 4 R 5 R 6 R 7 Nu is as described above.

[0018] Furthermore, the compounds represented by Formula I are as shown in Formulas IIIa, IIIb, IIIc, and IIId:

[0019]

[0020] Among them, X 1 X 2 R 1 R 2 R 3 R 4 R 5 R 6 R 7 Nu is as described above.

[0021] In some embodiments of the present invention, preferably, R 3 R 4 R 5 R 6 Each of the following is independently selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, vinyl, ethynyl, methoxy, and methoxymethyl; preferably, R 3 R 4 R5 R 6 Both are hydrogen.

[0022] More specifically, the compounds represented by Formula I are as shown in Formulas IVa, IVb, IVc, and IVd:

[0023]

[0024] Among them, X 1 X 2 R 1 R 2 R 7 Nu is as described above.

[0025] In some embodiments of the present invention, Nu is a nucleoside base, and the base is selected from:

[0026]

[0027] In some embodiments of the present invention, preferably, R 2 For hydrogen, R 1 Selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxymethyl, methoxyethyl, vinyl, ethynyl, methoxy, ethoxy, cyclopropyl, cyclobutyl, cyclopropylmethyl, phenyl, benzyl, phenethyl Or, R 1 For hydrogen, R 2 Selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxymethyl, methoxyethyl, vinyl, ethynyl, methoxy, ethoxy, cyclopropyl, cyclobutyl, cyclopropylmethyl, phenyl, benzyl, phenethyl.

[0028] In some embodiments of the present invention, preferably, R 7 Selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxymethyl, methoxyethyl, vinyl, ethynyl, methoxy, ethoxy, -O-C2H4-OCH3, -O-C2H4-C(O)NH(CH3).

[0029] In some embodiments of the present invention, more preferably, the nucleoside compound is specifically:

[0030]

[0031]

[0032]

[0033]

[0034] Nu, as mentioned above.

[0035] In some specific embodiments of the present invention, the nucleoside compound is specifically:

[0036]

[0037]

[0038]

[0039] The present invention also provides a nucleoside compound of formula X, or a deuterated thereof, or a stereoisomer thereof:

[0040]

[0041] in,

[0042] X 1 X 2 Each is independently selected from O or S;

[0043] R 1 R 2 The components are independently selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, substituted C2-C6 ynyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, -(C0-C2 alkylene)-(3-10 membered carbide ring), -(C0-C2 alkylene)-(4-10 membered heterocycle), -(C0-C2 alkylene)-(6-10 membered aromatic ring), and -(C0-C2 alkylene)-(5-10 membered aromatic heterocycle); wherein the alkylene, carbide ring, heterocycle, aromatic ring, and aromatic heterocycle are optionally surrounded by 1, 2, or 3 R's. 1a replace;

[0044] R 3 R 4 R 5 R 6 They are independently selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl, C1-C6 alkoxy, and substituted C1-C6 alkoxy, respectively.

[0045] R 7Selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, substituted C2-C6 ynyl, C1-C6 alkoxy, substituted C1-C6 alkoxy.

[0046] Each R 1a They are independently selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl, C1-C6 alkoxy, and substituted C1-C6 alkoxy, respectively.

[0047] The substituents in the substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, and substituted C1-C6 alkoxy groups are selected from hydrogen, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 alkoxy, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)(C1-C6 alkyl), -NHC(O)(C1-C6 alkyl), -C(O)(C1-C6 alkyl), -C(O)NH(C1-C6 alkyl), and -C(O)N(C1-C6 alkyl)(C1-C6 alkyl).

[0048] Furthermore, the compounds represented by formula X are shown in formulas XIa and XIb:

[0049]

[0050] Among them, X 1 X 2 R 1 R 2 R 3 R 4 R 5 R 6 R 7 As mentioned above.

[0051] In some embodiments of the present invention, preferably, R 3 R 4 R 5 R 6 Each is independently selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, vinyl, ethynyl, methoxy, and methoxymethyl; more preferably, R 3 R 4 R 5 R 6 Both are hydrogen.

[0052] More specifically, the compounds represented by formula X are shown in formulas XIIa, XIIb, XIIc, and XIId:

[0053]

[0054] Among them, X 1 X 2 R 1 R 2 R 7 As mentioned above.

[0055] In some embodiments of the present invention, preferably, in the nucleoside compounds shown in formula X, formula XIa, formula XIb, formula XIIa, formula XIIb, formula XIIc, and formula XII, R 2 For hydrogen, R 1 It is hydrogen.

[0056] In some embodiments of the present invention, preferably, R in formulas X, X1a, X1b, XIIa, XIIb, XIIc, and XII 7 Selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxymethyl, methoxyethyl, vinyl, ethynyl, methoxy, ethoxy, -O-C2H4-OCH3, -O-C2H4-C(O)NH(CH3).

[0057] In some embodiments of the present invention, preferably, the nucleoside compounds shown in formulas X, XIa, XIb, XIIa, XIIb, XIIc, and XII are the following nucleoside compounds:

[0058]

[0059] The present invention also provides the use of any of the above-mentioned nucleoside compounds in the preparation of oligonucleotides; preferably, the use of any of the above-mentioned nucleoside compounds as intermediates in the preparation of oligonucleotides is provided; more preferably, the oligonucleotide is siRNA, antisense nucleic acid, saRNA, miRNA or nucleic acid aptamer.

[0060] The present invention also provides an oligonucleotide comprising at least one structure as shown in Formula V or Formula V', and wherein... Linked to the rest of the oligonucleotide;

[0061]

[0062] in,

[0063] X 1 X 2 X 3 Each is independently selected from O or S;

[0064] R 1 R 2The components are independently selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, substituted C2-C6 ynyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, -(C0-C2 alkylene)-(3-10 membered carbide ring), -(C0-C2 alkylene)-(4-10 membered heterocycle), -(C0-C2 alkylene)-(6-10 membered aromatic ring), and -(C0-C2 alkylene)-(5-10 membered aromatic heterocycle); wherein the alkylene, carbide ring, heterocycle, aromatic ring, and aromatic heterocycle are optionally surrounded by 1, 2, or 3 R's. 1a Replace; and R 1 R 2 They are not both hydrogen;

[0065] R 3 R 4 R 5 R 6 They are independently selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl, C1-C6 alkoxy, and substituted C1-C6 alkoxy, respectively.

[0066] R 7 Selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, substituted C2-C6 ynyl, C1-C6 alkoxy, substituted C1-C6 alkoxy.

[0067] Each R 1a They are independently selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl, C1-C6 alkoxy, and substituted C1-C6 alkoxy, respectively.

[0068] The substituents in the substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, and substituted C1-C6 alkoxy groups are selected from hydrogen, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 alkoxy, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)(C1-C6 alkyl), -NHC(O)(C1-C6 alkyl), -C(O)(C1-C6 alkyl), -C(O)NH(C1-C6 alkyl), and -C(O)N(C1-C6 alkyl)(C1-C6 alkyl);

[0069] Nu is a hydrogen or nucleoside base.

[0070] Furthermore, the structures of oligonucleotides represented by formula V or formula V' are shown in formulas VIa, VIb, VIa', and VIb':

[0071]

[0072] Among them, X 1 X 2 X 3 R 1 R 2 R 3 R 4 R 5 R 6 R 7 Nu is as described above.

[0073] Furthermore, the oligonucleotides represented by formula V or formula V' are shown in formulas VIIa, VIIb, VIIc, VIId, VIIa', VIIb', VIIc', and VIId':

[0074]

[0075] Among them, X 1 X 2 X 3 R 1 R 2 R 3 R 4 R 5 R 6 R 7 Nu is as described above.

[0076] In some embodiments of the present invention, preferably, R 3 R 4 R 5 R 6 Each of the following is independently selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, vinyl, ethynyl, methoxy, and methoxymethyl; preferably, R 3 R 4 R 5 R 6 Both are hydrogen.

[0077] More specifically, the oligonucleotides represented by formula V or formula V' are as shown in formulas VIIIa, VIIIb, VIIIc, VIIId, VIIIa', VIIIb', VIIIc', and VIIId':

[0078]

[0079] Among them, X1 X 2 X 3 R 1 R 2 R 7 Nu is as described above.

[0080] In some embodiments of the present invention, Nu is a nucleoside base, wherein the base is selected from A, U, G, C, T, or the bases shown below:

[0081]

[0082] In some embodiments of the present invention, preferably, R 2 For hydrogen, R 1 Selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxymethyl, methoxyethyl, vinyl, ethynyl, methoxy, ethoxy, cyclopropyl, cyclobutyl, cyclopropylmethyl, phenyl, benzyl, phenethyl. Or, R 1 For hydrogen, R 2 Selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxymethyl, methoxyethyl, vinyl, ethynyl, methoxy, ethoxy, cyclopropyl, cyclobutyl, cyclopropylmethyl, phenyl, benzyl, phenethyl.

[0083] In some embodiments of the present invention, preferably, R 7 Selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxymethyl, methoxyethyl, vinyl, ethynyl, methoxy, ethoxy, -O-C2H4-OCH3, -O-C2H4-C(O)NH(CH3).

[0084] In some embodiments of the present invention, more preferably, the oligonucleotides represented by formula V or formula V' are as follows:

[0085]

[0086] In some embodiments of the present invention, more preferably, the oligonucleotides represented by formula V or formula V' are as follows:

[0087]

[0088]

[0089] The present invention also provides an oligonucleotide comprising at least one structure as shown in formula XV or formula XV', and through... Linked to the rest of the oligonucleotide;

[0090]

[0091] in,

[0092] X 1 X 2 X 3 Each is independently selected from O or S;

[0093] R 1 R 2 The components are independently selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, substituted C2-C6 ynyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, -(C0-C2 alkylene)-(3-10 membered carbide ring), -(C0-C2 alkylene)-(4-10 membered heterocycle), -(C0-C2 alkylene)-(6-10 membered aromatic ring), and -(C0-C2 alkylene)-(5-10 membered aromatic heterocycle); wherein the alkylene, carbide ring, heterocycle, aromatic ring, and aromatic heterocycle are optionally surrounded by 1, 2, or 3 R's. 1a replace;

[0094] R 3 R 4 R 5 R 6 They are independently selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl, C1-C6 alkoxy, and substituted C1-C6 alkoxy, respectively.

[0095] R 7 Selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, substituted C2-C6 ynyl, C1-C6 alkoxy, substituted C1-C6 alkoxy.

[0096] Each R 1a They are independently selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl, C1-C6 alkoxy, and substituted C1-C6 alkoxy, respectively.

[0097] The substituents in the substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, and substituted C1-C6 alkoxy groups are selected from hydrogen, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 alkoxy, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)(C1-C6 alkyl), -NHC(O)(C1-C6 alkyl), -C(O)(C1-C6 alkyl), -C(O)NH(C1-C6 alkyl), and -C(O)N(C1-C6 alkyl)(C1-C6 alkyl).

[0098] In some embodiments of the present invention, preferably, R 3 R 4 R 5 R 6 Each is independently selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, vinyl, ethynyl, methoxy, and methoxymethyl; more preferably, R 3 R 4 R 5 R 6 All are hydrogen. In some embodiments of the present invention, preferably, R 2 For hydrogen, R 1 It is hydrogen. In some embodiments of the invention, preferably, R 7 Selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxymethyl, methoxyethyl, vinyl, ethynyl, methoxy, ethoxy, -O-C2H4-OCH3, -O-C2H4-C(O)NH(CH3).

[0099] More specifically, the oligonucleotides represented by formula XV or XV' are shown as those represented by formula XVIa or XVIa':

[0100]

[0101] Among them, X 1 X 2 X 3 R 7 As mentioned above.

[0102] More specifically, the structure of oligonucleotides represented by formula XV or XV' is shown in the following formula:

[0103]

[0104] In some embodiments of the present invention, the oligonucleotide is siRNA, antisense nucleic acid, saRNA, miRNA, or nucleic acid aptamer; preferably, the oligonucleotide is siRNA.

[0105] Further, the siRNA comprises a sense strand and an antisense strand; wherein the structure represented by Formula V or Formula V' is the 1st, 2nd, 3rd, 4th, or 5th nucleotide at the 3' end of the siRNA antisense strand, or the structure represented by Formula V or Formula V' is the 1st, 2nd, 3rd, 4th, or 5th nucleotide at the 3' end of the siRNA sense strand. Preferably, the structure represented by Formula V or Formula V' is the 1st or 2nd nucleotide at the 3' end of the siRNA antisense strand. More preferably, the structure represented by Formula V or Formula V' is the 1st nucleotide at the 3' end of the siRNA antisense strand.

[0106] Further, the siRNA comprises a sense strand and an antisense strand; wherein the structure represented by Formula XV or Formula XV' is the 1st, 2nd, 3rd, 4th, or 5th nucleotide at the 3' end of the antisense strand of the siRNA, or the structure represented by Formula XV or Formula XV' is the 1st, 2nd, 3rd, 4th, or 5th nucleotide at the 3' end of the sense strand of the siRNA. Preferably, the structure represented by Formula XV or Formula XV' is the 1st or 2nd nucleotide at the 3' end of the antisense strand of the siRNA.

[0107] In this invention, the siRNA has a double-stranded structure comprising a sense strand and an antisense strand; wherein the antisense strand is 17-30 nucleotides in length; the sense strand is 17-30 nucleotides in length and is at least partially complementary to the antisense strand. Preferably, the sense strand and the antisense strand are complementary by at least 15, 16, 17, 18, 19, 20, or 21 nucleotides.

[0108] In some embodiments of the present invention, the antisense strand is 21 to 23 nucleotides long; the sense strand is 19 to 21 nucleotides long.

[0109] In some embodiments of the invention, the siRNA comprises one or more single-stranded nucleotide overhangs, such as 1, 2, 3, or 4 nucleotide overhangs. In some embodiments, the overhangs may be on the sense strand, the antisense strand, or any combination thereof. In some embodiments, the overhangs are present at the 5' end, 3' end, or both ends of the antisense or sense strand of the siRNA. Preferably, the 3' end of the antisense strand of the siRNA has a 2-nucleotide overhang.

[0110] In some embodiments of the present invention, the antisense strand is 23 nucleotides long and the sense strand is 21 nucleotides long; or the antisense strand is 22 nucleotides long and the sense strand is 20 nucleotides long; or the antisense strand is 21 nucleotides long and the sense strand is 21 nucleotides long; or the antisense strand is 21 nucleotides long and the sense strand is 19 nucleotides long; or the antisense strand is 19 nucleotides long and the sense strand is 19 nucleotides long.

[0111] In some embodiments of the present invention, a targeting ligand is also attached to the 3' end of the siRNA positive strand.

[0112] In some embodiments of the present invention, the targeting ligand is L96, having the following structure:

[0113]

[0114] Unless otherwise stated, the terms used in the specification and claims have the following meanings.

[0115] In this invention, when the terms "comprising" or "including" are used, unless otherwise specified, they also cover situations where the elements, integers, or steps mentioned are constituted.

[0116] In this application, "DMTr" in the compound structure stands for 4,4′-bismethoxytriphenylmethyl. "Me" in the chemical structural formula refers to a methyl group.

[0117] The term "stereoisomer" in this application refers to compounds having the same chemical structure but different spatial arrangements of atoms or groups. The compounds of this invention may contain asymmetric centers or chiral centers, thus resulting in different stereoisomers. All stereoisomeric forms of the compounds of this invention, including but not limited to conformational isomers (rotational isomers), geometrical isomers (cis / trans) isomers, blocked rotation isomers, and mixtures thereof, such as racemic mixtures, constitute a part of this invention. Many organic compounds exist in optically active forms, meaning they are capable of rotating the plane of plane-polarized light. When describing optically active compounds, the prefixes D, L, or R, S are used to indicate the absolute configuration of the chiral center of the molecule. These stereoisomers have the same chemical structure but different stereostructures. "Stereoisomer" includes enantiomers or diastereomers. Specific stereoisomers may be enantiomers, and mixtures of isomers are generally referred to as enantiomer mixtures.

[0118] In this invention, "nucleoside base" includes, but is not limited to, guanine, cytosine, adenine, thymidine, and uracil. "G", "C", "A", "T", and "U" typically represent nucleotides containing guanine, cytosine, adenine, thymidine, and uracil as bases, respectively. However, those skilled in the art will recognize that guanine, cytosine, adenine, and uracil can be replaced by other parts without substantially altering the base-pairing properties of the oligonucleotide containing the nucleotide with such replacement parts. Examples of such nucleoside base modifications that can be used to generate RNAi activators include the substitution of nucleotides containing uracil, guanine, or adenine with nucleotides containing, for example, inosine; and the replacement of adenine and cytosine in oligonucleotides with guanine and uracil, respectively, to form a GU Wobble base pair with the target mRNA. In addition, other examples of modified nucleoside bases include, but are not limited to: 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine. 5-Methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosyl queosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-hydroxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-hydroxyacetic acid methyl ester, uracil-5-hydroxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine. These modified nucleoside bases are all within the scope of this invention. Furthermore, the aforementioned nucleoside bases that have protecting groups during the preparation of nucleotides are also considered in this invention.

[0119] In this invention, unless otherwise specified, the term "complementary" refers to the ability of an oligonucleotide of a first sequence to hybridize with an oligonucleotide of a second sequence under certain conditions and form a double-stranded structure. "At least partially complementary" means that the two sequences can be completely complementary, or have no more than 5, 4, 3, or 2 mismatched base pairs in total, while retaining the ability to hybridize under the relevant conditions. Furthermore, where the two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs should not be considered mismatches for determining complementarity. In this invention, to satisfy the above hybridization ability requirements, the "complementary" sequence may also include or consist entirely of base pairs formed from non-Watson-Crick base pairs and / or from non-natural and modified nucleotides. Such non-Watson-Crick base pairs include, but are not limited to, G:U swing base pairs or Hoogstein base pairs.

[0120] In this invention, the term "protruding end" is used to describe an unpaired nucleotide located at the 3' or 5' end of the double-stranded region of a double-stranded oligonucleotide. An unpaired nucleotide forms a protruding end when the 3' end of one strand of the double-stranded oligonucleotide extends beyond the 5' end of the other strand, or when the 5' end of one strand extends beyond the 3' end of the other strand. The double-stranded oligonucleotide according to the invention may also have zero protruding ends. In the case of zero protruding ends, all ends of the double-stranded oligonucleotide are blunt ends, and such a molecule lacks 3' or 5' single-stranded nucleotide protrusions.

[0121] In this invention, "nucleotide" refers to the structural unit of oligonucleotides and polynucleotides, and for the purposes of this invention, includes naturally occurring nucleotides and modified nucleotides. In nature, RNA nucleotides comprise a sugar moiety (ribose), a nucleobase moiety, and a phosphate ester group. Herein, a modified nucleotide refers to a nucleotide that, corresponding to a natural RNA nucleotide, has modifications in its sugar moiety and / or nucleobase moiety and / or phosphate ester group.

[0122] In this invention, the term "antisense strand" in relation to double-stranded oligonucleotides refers to an oligonucleotide chain containing a region complementary to a consecutive nucleotide of the target sequence. The term "sense strand" in relation to double-stranded oligonucleotides in this invention refers to an oligonucleotide chain containing a consecutive nucleotide complementary to at least a portion of a region of the antisense strand to form a double-stranded region.

[0123] The carbon, hydrogen, oxygen, sulfur, nitrogen, or F, Cl, Br, I mentioned in the groups and compounds described in this application include their isotopes, and the carbon, hydrogen, oxygen, sulfur, or nitrogen mentioned in the groups and compounds described in this application may optionally be further replaced by one or more of their corresponding isotopes, wherein the isotopes of carbon include12 C 13 C and 14 C, the isotopes of hydrogen include protium (H), deuterium (D, also called heavy hydrogen), and tritium (T, also called superheavy hydrogen), and the isotopes of oxygen include 16 O、 17 O and 18 O, isotopes of sulfur include 32 S, 33 S, 34 S and 36 S, nitrogen isotopes include 14 N and 15 N, isotopes of fluorine include 17 F and 19 F, isotopes of chlorine include 35 Cl and 37 Cl, isotopes of bromine include 79 Br and 81 Br, an isotope of iodine, includes 127 iodine, 129 Iodine and 131 iodine.

[0124] "alkyl" refers to a straight-chain or branched saturated aliphatic hydrocarbon group with 1 to 30 carbon atoms, preferably an alkyl group with 1 to 20 carbon atoms (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20), more preferably an alkyl group with 1 to 6 carbon atoms or an alkyl group with 10 to 18 carbon atoms. Non-limiting examples of alkyl groups include methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, neobutyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, straight-chain or branched C 10-18 Alkyl group. The alkyl group may optionally be further substituted with one or more substituents.

[0125] "Alkoxy" refers to a group formed by the bonding of an alkyl group with an oxygen atom. The definition of alkyl is the same as that of "alkyl" as described above. Non-limiting examples of alkoxy groups include methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, n-hexoxy, cyclopropoxy, cyclobutoxy, and straight-chain or branched C-type groups. 10-18 Alkyl group. The alkoxy group may optionally be further substituted with one or more substituents.

[0126] "Cycloalkyl" refers to a saturated cyclic hydrocarbon group, the ring of which can be a 3- to 10-membered (e.g., 3, 4, 5, 6, 7, 8, 9, 10-membered) monocyclic ring, a 4- to 12-membered (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12-membered) bicyclic ring, or a 10- to 20-membered (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20-membered) polycyclic system, preferably with 3 to 10 carbon atoms, more preferably with 3 to 8 carbon atoms. Non-limiting examples of cycloalkyl include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, etc. The cycloalkyl group may optionally be further substituted by one or more substituents.

[0127] "Alkenyl" refers to an alkenyl group containing 1 to 15 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15) carbon-carbon double bonds, consisting of 2 to 30 carbon atoms, preferably an alkenyl group with 2 to 20 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20) carbon atoms, more preferably an alkenyl group with 2 to 8 carbon atoms or an alkenyl group with 10 to 18 carbon atoms. Non-limiting examples of alkenyl groups include vinyl, propen-2-yl, buten-2-yl, penten-2-yl, penten-4-yl, hexen-2-yl, hexen-3-yl, hepten-2-yl, hepten-3-yl, hepten-4-yl, octen-3-yl, nonen-3-yl, decen-4-yl, undecen-3-yl, straight-chain or branched C 12-18 Alkenyl group. The alkenyl group may optionally be further substituted with one or more substituents.

[0128] "Alynyl" refers to a straight-chain or branched unsaturated aliphatic hydrocarbon group containing 1 to 15 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15) carbon-carbon triple bonds and composed of 2 to 30 carbon atoms, preferably an alkynyl group with 2 to 20 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20) carbon atoms, more preferably an alkynyl group with 2 to 8 carbon atoms or an alkynyl group with 10 to 18 carbon atoms. Non-limiting examples of alkynyl groups include ethynyl, propyn-1-yl, propyn-2-yl, butyn-1-yl, butyn-2-yl, butyn-3-yl, 3,3-dimethylbutyn-2-yl, pentyyn-1-yl, pentyyn-2-yl, hexyn-1-yl, 1-heptyyn-1-yl, heptyyn-3-yl, heptyyn-4-yl, octyyn-3-yl, nonyyn-3-yl, decantyyn-4-yl, undecyn-3-yl, dodecanyyn-4-yl, and straight-chain or branched C 13-18 The alkynyl group may optionally be further substituted with one or more substituents.

[0129] Halogens include F, Cl, Br and I.

[0130] An acyl group is a structure formed by a carbonyl functional group bonded to a hydrogen atom or a substituent group, written as -COR'. In this invention, R' represents alkyl, alkenyl, or alkynyl. The definitions of alkyl, alkenyl, and alkynyl are the same as those for "alkyl," "alkenyl," and "alkynyl" as described above. Non-limiting examples of acyl groups include formyl, acetyl, propionyl, and butyryl.

[0131] "Aryl" or "aromatic ring" refers to an aromatic ring group having a conjugated planar ring system, which can be a 5- to 8-membered (e.g., 5, 6, 7, 8-membered) monocyclic, a 5- to 12-membered (e.g., 5, 6, 7, 8, 9, 10, 11, 12-membered) bicyclic, or a 10- to 15-membered (e.g., 10, 11, 12, 13, 14, 15-membered) tricyclic system, and can be a bridged ring or a spirocyclic ring. Non-limiting examples of aryl groups include phenyl and naphthyl. The aryl group may optionally be further substituted by one or more substituents.

[0132] "Heteroaryl" or "heteroary ring" refers to an aromatic ring group having a conjugated planar ring system and containing heteroatoms. It can be a 3- to 8-membered (e.g., 3, 4, 5, 6, 7, 8-membered) monocyclic, a 5- to 12-membered (e.g., 5, 6, 7, 8, 9, 10, 11, 12-membered) bicyclic, or a 10- to 15-membered (e.g., 10, 11, 12, 13, 14, 15-membered) tricyclic system, and contains 1 to 6 (e.g., 1, 2, 3, 4, 5, 6) heteroatoms selected from N, O, or S. Non-limiting examples of heteroaryl groups include triazolyl, pyridyl, furanyl, thiophene, pyranyl, pyrroloyl, pyrimidinyl, pyrazinyl, pyridazinyl, imidazolyl, piperidinylbenzimidazolyl, benzopyridyl, and pyrrolopyridyl. The heteroaryl group may optionally be further substituted by one or more substituents.

[0133] "Heterocyclic group" or "heterocycle" refers to a saturated or unsaturated aromatic heterocycle or a non-aromatic heterocycle. When it is an aromatic heterocycle, its definition is the same as the definition of "heteroaryl" above. When it is a non-aromatic heterocycle, it can be a 3- to 10-membered (e.g., 3, 4, 5, 6, 7, 8, 9, 10-membered) monocyclic, a 4- to 12-membered (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12-membered) bicyclic, or a 10- to 15-membered (e.g., 10, 11, 12, 13, 14, 15-membered) tricyclic system, and contains 1 to 4 (e.g., 1, 2, 3, 4) heteroatoms selected from N, O, or S, preferably a 3- to 8-membered heterocyclic group. Non-limiting examples of "heterocyclic group" or "heterocycle" include oxoheterobutyl, azaheterobutyl, thioheterobutyl, 1,3-dioxopentyl, 1,4-dioxopentyl, 1,3-dioxahexacycloyl, azaheptanyl, oxoheptanyl, thioheptanyl, triazolyl, pyridyl, piperidinyl, furanyl, thiophene, pyranyl, N-alkylpyrroleyl, pyrimidinyl, pyrazinyl, pyridazinyl, piperazinyl, homopiperazinyl, imidazolyl, piperidinyl, morpholinyl, thiomorpholinyl, thiaxylyl, 1,3-dithiaalkyl, dihydrofuranyl, dithiapentylyl Cycloyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiophenyl, tetrahydropyrroleyl, tetrahydroimidazoyl, tetrahydrothiazoyl, tetrahydropyranyl, benzimidazolyl, benzopyridyl, pyrrolopyridyl, benzodihydrofuranyl, 2-pyrrolinyl, 3-pyrrolinyl, dihydroindolyl, 2H-pyranyl, 4H-pyranyl, dioxacyclohexyl, 1,3-dioxapentyl, pyrazolinyl, dithiaalkyl, dithiamonyl, dihydrothiophenyl, pyrazolyl, imidazolinyl, imidazolinyl, 1,2,3,4-tetrahydroisoquinolinyl. The "heterocyclic group" or "heterocycle" may optionally be further substituted with one or more substituents.

[0134] When the "alkyl", "alkoxy", "cycloalkyl", "alkenyl", "alkynyl", "aryl", "heteroaryl", and "heterocyclic" groups mentioned above are substituted, they may be further substituted by 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substituents selected from F, Cl, Br, I, hydroxyl, mercapto, nitro, cyano, amino, C1-6 alkylamino, C1-6 alkyl, C1-6 alkoxy, C2-6 alkenyl, C2-6 alkynyl, C3-8 cycloalkyl, C3-8 heterocyclic alkyl, C6-10 aryl, and C5-10 heteroaryl groups.

[0135] "Optional" or "optionally" means that the event or condition described below may or may not occur, and the description includes both cases in which the event or condition occurs and cases in which it does not occur. For example, "optionally alkyl-substituted heterocyclic group" means that the alkyl group may or may not be present, and the description includes both cases in which the heterocyclic group is substituted with an alkyl group and cases in which the heterocyclic group is not substituted with an alkyl group.

[0136] beneficial effect

[0137] The nucleotide monomers provided in this invention, when used in siRNA, significantly improve the stability of the 3' exonuclease while minimizing impact on the overall structure, charge, and thermal stability of the siRNA double strand. The novel nucleic acid backbone exhibits excellent tolerance to fully chemically modified (2-OMe and 2-F) siRNA and is compatible with PS. Binding PS to the 3' end of the siRNA antisense strand positively influences the plasma pharmacokinetics and tissue accumulation of siRNA, thereby enhancing the efficacy and duration of action of RNAi in vivo. Cellular experiments demonstrate that the oligonucleotide drugs prepared containing the nucleoside compounds of this invention exhibit significantly improved in vitro and in vivo activity, pharmacokinetic properties, and bioavailability. Attached Figure Description

[0138] Figure 1 The results show the silencing activity of the double-stranded siRNA-L96 conjugate in mice. Detailed Implementation

[0139] Unless otherwise specified, the instruments used in this invention are conventional instruments, and the reagents used are conventional reagents.

[0140] The structure of the compound was determined by nuclear magnetic resonance (NMR) and / or mass spectrometry (MS).

[0141] NMR shifts (δ) are given in units of 10⁻⁶ (ppm). NMR measurements were performed using a Broker Avance III 400 NMR spectrometer with deuterated dimethyl sulfoxide (DMSO-d₆), deuterated chloroform (CDCl₃), and deuterated methanol (CD₃OD) as solvents and tetramethylsilane (TMS) as the internal standard.

[0142] MS determination was performed using (Agilent 6120B (ESI) and Agilent 6120B (APCI));

[0143] Thin-layer chromatography silica gel plates are Yantai Huanghai HSGF254 or Qingdao GF254. The silica gel plates used in thin-layer chromatography (TLC) have a diameter of 0.15mm-0.20mm, and the diameter of the thin-layer chromatography separation and purification products is 0.4mm-0.5mm.

[0144] Column chromatography typically uses Yantai Huanghai silica gel with a mesh size of 200-300 as the carrier.

[0145] Oligo solid-phase synthesis was performed on an LK-48E synthesizer (Lingkun).

[0146] Explanation of the abbreviations used for materials in this invention:

[0147]

[0148]

[0149]

[0150] The present invention will be described in detail below through embodiments. Unless otherwise specified, experimental methods under conventional conditions were used in the embodiments. The embodiments are provided to better illustrate the present invention, but should not be construed as limiting the invention to the examples given. Non-essential improvements and adjustments made to the implementation schemes by those skilled in the art based on the above description are still within the scope of protection of the present invention.

[0151] It should be noted that in this invention, the "Nu" in the nucleotide monomer number "EXxxx-Nu" represents the composition of the nucleoside bases in that monomer, usually A / U / G / C; for example, "EX001-U" represents the structure of EX001 with the nucleoside base U. It should also be noted that the nucleotides represented by "EXxxx-Nu" in the oligonucleotide chain of this invention are the nucleotides introduced into the chain from the nucleotide monomers with the same number.

[0152] The modified nucleotides used in some embodiments of this invention have the following nucleotide sequences:

[0153] no sequence(5'→3') SEQ ID NO. 1 TTTTTTTTTTTTTTTTTTTTTU 1 2 TTTTTTTTTTTTTTTTTTTTTTTT 2 3 AACAGUGUUCUUGCUCUAUAA 3 4 UUAUAGAGCAAGAACACUGUUUU 4

[0154] Example Section

[0155] Example 1: Synthesis of Compound 12

[0156]

[0157] Synthesis of compound 2:

[0158] Compound 1 (30.0 g, 116.24 mmol, 1.0 eq.) was dissolved in pyridine (300 mL). DMTrCl (43.32 g, 127.86 mmol, 1.1 eq.) was slowly added to the reaction system, and the reaction was allowed to proceed overnight at room temperature. TLC analysis showed that compound 1 reacted completely. Water was added to the reaction system, followed by extraction twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 2 (60.21 g), which was used directly in the next reaction. ESI-MS: m / z 561.2 [M+H] +

[0159] Synthesis of compound 3:

[0160] The dried crude product 2 (60.21 g) was dissolved in DMF (400 mL). Imidazole (19.78 g, 290.60 mmol, 2.5 eq.) was added to the reaction system, and the reaction was cooled to 0 °C and stirred continuously for 30 minutes. Then, tert-butyldimethylchlorosilane (21.02 g, 139.49 mmol, 1.2 eq.) was slowly added to the reaction system. After the addition was complete, the ice bath was removed, and the reaction was gradually brought to room temperature and allowed to proceed overnight at room temperature. TLC analysis showed that compound 2 had reacted completely. Water was added to the reaction system, followed by extraction twice with ethyl acetate. The organic phases were combined and washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 3 (70.58 g), which was used directly in the next reaction. ESI-MS: m / z 675.3 [M+H] +

[0161] Synthesis of compound 4:

[0162] The dried crude product 3 (70.58 g) was dissolved in DCM (400 mL). Triethylsilane (27.03 g, 232.48 mmol, 2.0 eq.) was added to the reaction system, and the reaction was cooled to 0 °C and stirred continuously for 30 minutes. Then, dichloroacetic acid (17.99 g, 139.49 mmol, 1.2 eq.) was slowly added dropwise to the reaction system. After the addition was complete, the ice bath was removed, and the reaction was gradually brought to room temperature and allowed to proceed overnight at room temperature. TLC analysis showed that compound 2 reacted completely. The pH of the reaction system was adjusted to approximately 7 by adding sodium bicarbonate aqueous solution, followed by extraction twice with dichloromethane. The organic phases were combined and washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to give crude product 4 (52.55 g). Crude product 4 was subjected to column chromatography (PE / EA = 2 / 3) to give compound 4 (25.07 g, 67.36 mmol, overall yield of three steps: 57.95%). ESI-MS: m / z 373.2 [M+H] +

[0163] Synthesis of compound 5:

[0164] The dried compound 4 (25.07 g, 67.36 mmol, 1.0 eq.) was dissolved in ultra-dry acetonitrile (250 mL). 2-Iodobenzoic acid (41.50 g, 148.19 mmol, 2.2 eq.) was added to the reaction system. The reaction system was placed in an oil bath and heated to 80 °C, and stirred at this temperature for 2 hours. The entire reaction was carried out under nitrogen protection. TLC and LCMS analysis showed that compound 4 reacted completely. The reaction mixture was removed from the oil bath and cooled to 0 °C. Insoluble matter was removed by filtration, and the filtrate was concentrated to give crude compound 5 (27.33 g), which was directly used in the next reaction. ESI-MS: m / z 371.2 [M+H] +

[0165] Synthesis of compound 6:

[0166] Methyltriphenylphosphine bromide (52.94 g, 148.19 mmol, 2.2 eq.) was dissolved in ultradry THF (300 mL). The reaction system was cooled to 0 °C and stirred continuously for 30 minutes. Potassium tert-butoxide (16.63 g, 148.19 mmol, 2.2 eq.) was added. After the addition was complete, the reaction was stirred at 0 °C for 20 minutes. Then, crude product 5 (27.33 g) in THF (300 mL) solution was slowly added dropwise. After the addition was complete, the ice bath was removed and the reaction was stirred at a lower temperature. TLC and LCMS analysis showed that compound 5 reacted completely. The reaction system was concentrated to remove some THF, and then extracted twice with ethyl acetate solution. The organic phases were combined and washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to give crude product 6. Crude product 6 was then subjected to column chromatography (PE / EA = 1 / 1) to give compound 6 (15.63 g, 42.45 mmol, overall yield: 63.02%). ESI-MS: m / z 369.2 [M+H] +

[0167] Synthesis of compound 7:

[0168] Compound 6 (15.63 g, 42.45 mmol, 1.0 eq.) was dried and dissolved in ultra-dry THF (150 mL). 0.5 mol / L 9-boronbicyclo[3.3.1]nonane (254.7 mL, 127.35 mmol, 3.0 eq.) was added, and the mixture was stirred overnight at room temperature. TLC and LCMS analysis showed that compound 5 reacted completely. The reaction system was cooled to 0 °C and stirred continuously for 30 minutes. Methanol (100 mL) and water (150 mL) were slowly added, followed by sodium perborate tetrahydrate (32.66 g, 212.25 mmol, 5.0 eq.). After the addition was complete, the ice bath was removed, and the reaction was stirred overnight. TLC and LCMS analysis showed that the intermediate was completely consumed. The system was filtered and concentrated to remove some of the solvent. Water was added, and the mixture was extracted twice with dichloromethane. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 7. The crude product was then subjected to column chromatography (PE / EA = 2 / 3) to give compound 7 (7.33 g, 18.98 mmol, 44.71% yield). ESI-MS: m / z 387.2 [M+H] +

[0169] Synthesis of compound 8:

[0170] The dried compound 7 (7.33 g, 18.98 mmol, 1.0 eq.) was dissolved in ultra-dry acetonitrile (250 mL). 2-Iodobenzoic acid (11.69 g, 41.76 mmol, 2.2 eq.) was added to the reaction system. The reaction system was placed in an oil bath and heated to 80 °C, and stirred at this temperature for 2 hours. The entire reaction was carried out under nitrogen protection. TLC and LCMS analysis showed that compound 7 reacted completely. The reaction mixture was removed from the oil bath and cooled to 0 °C. Insoluble matter was removed by filtration, and the filtrate was concentrated to obtain crude compound 8. Crude compound 8 was subjected to column chromatography (PE / EA = 2 / 3) to obtain compound 8 (6.76 g, 17.60 mmol, 92.73% yield). ESI-MS: m / z 385.2 [M+H] +

[0171] Synthesis of compound 9:

[0172] The dried compound 8 (6.76 g, 17.60 mmol, 1.0 eq.) was dissolved in ultra-dry THF (60 mL). The reaction system was cooled to -20 °C and stirred at this temperature for 20 minutes. The entire reaction was carried out under nitrogen protection. Then, a 1.0 mol / L methyl magnesium bromide solution (52.80 mL, 52.80 mmol, 3.0 eq.) was slowly added dropwise. After the addition was complete, the mixture was brought back to room temperature and stirred. TLC and LCMS analysis showed that compound 8 reacted completely. The reaction was quenched by adding saturated ammonium chloride solution, and the mixture was extracted twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 9. Crude product 9 was subjected to column chromatography (PE / EA = 2 / 3) to obtain compound 9 (2.11 g, 5.27 mmol, 29.94% yield) (TLC: R f =0.43, PE / EA=1 / 3). ESI-MS:m / z 401.2[M+H] +

[0173] Synthesis of compound 10:

[0174] Compound 9 (2.11 g, 5.27 mmol, 1.0 eq.) was dissolved in DCE (30 mL). AgNO3 (895 mg, 5.27 mmol, 1.0 eq.) and 2,4,6-trimethylpyridine (1.28 g, 10.54 mmol, 2.0 eq.) were added to the reaction system, followed by DMTrCl (2.68 g, 7.91 mmol, 1.5 eq.). The reaction system was heated at 80 °C overnight. TLC analysis showed that compound 9 reacted completely. Water was added to the reaction system, followed by extraction twice with dichloromethane. The combined organic phases were washed with 5% citric acid aqueous solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 10 (3.56 g), which was directly used in the next reaction. ESI-MS: m / z 703.3 [M+H] +

[0175] Synthesis of compound 11:

[0176] Crude compound 10 (3.56 g) was dissolved in THF (30 mL), and 1.0 mol / L TBAF solution (6.3 mL, 6.32 mmol, 1.2 eq.) was added to the reaction system. The reaction was allowed to proceed overnight at room temperature. TLC analysis showed that compound 10 reacted completely. Water was added to the reaction system, followed by extraction twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 11. Crude compound 11 was subjected to column chromatography (PE / EA = 2 / 3) to give compound 11 (2.24 g, 3.81 mmol, overall yield: 72.30%). ESI-MS: m / z 589.3 [M+H] +

[0177] Synthesis of compound 12:

[0178] Compound 11 (2.24 g, 3.81 mmol, 1.0 eq.) was dissolved in ultra-dry DCM (30 mL). DCI (405 mg, 3.43 mmol, 0.9 eq.) was added to the reaction system, and after purging with nitrogen, bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.38 g, 4.57 mmol, 1.2 eq.) was added. The reaction was carried out at room temperature for 30 minutes. TLC analysis showed that compound 11 reacted completely. A saturated aqueous sodium bicarbonate solution was added to the reaction system, followed by extraction with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 12. Crude compound 12 was subjected to column chromatography (PE / EA = 1 / 1) to obtain compound 12 (2.15 g, 2.73 mmol, 71.65% yield). 1 H NMR (400MHz, DMSO-d6) δ11.37(s,1H),7.54–7.19(m,10H),6.91–6.86(m,4H),5.78(d,J=4 .9Hz,1H),5.61(dd,J=8.1,2.2Hz,1H),4.60–4.40(m,1H),4.35–4.29(m,1H),4.11–3.99( m,1H),3.98–3.76(m,9H),3.41(s,3H),3.14–3.00(m,2H),2.93–2.70(m,2H),1.54–1.39( m,2H),1.24(dd,J=11.4,2.2Hz,3H),1.15(dd,J=10.9,4.2Hz,9H),0.84(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.32(s),148.29(s).ESI-MS:m / z 789.4[M+H] +

[0179] Example 2: Synthesis of Compound 16

[0180]

[0181] Synthesis of compound 13:

[0182] The dried compound 8 (10.00, 26.03 mmol, 1.0 eq.) was dissolved in ultra-dry THF (100 mL). The reaction mixture was cooled to -20 °C and stirred at this temperature for 20 minutes. The entire reaction was carried out under nitrogen protection. Then, a 1.0 mol / L solution of methyl magnesium bromide (78.09 mL, 78.09 mmol, 3.0 eq.) was slowly added dropwise. After the addition was complete, the mixture was allowed to return to room temperature and stirred. TLC and LCMS analysis showed that compound 8 had reacted completely. The reaction was quenched by adding saturated ammonium chloride solution, and the mixture was extracted twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 13. Crude product 13 was subjected to column chromatography (PE / EA = 2 / 3) to obtain compound 13 (3.33 g, 8.32 mmol, 31.89% yield) (TLC: R). f =0.40, PE / EA=1 / 3). ESI-MS:m / z 401.2[M+H] +

[0183] Synthesis of compound 14:

[0184] Compound 13 (3.33 g, 8.32 mmol, 1.0 eq.) was dissolved in DCE (35 mL). AgNO3 (1.41 g, 8.32 mmol, 1.0 eq.) and 2,4,6-trimethylpyridine (2.02 g, 16.64 mmol, 2.0 eq.) were added to the reaction system, followed by DMTrCl (4.23 g, 12.48 mmol, 1.5 eq.). The reaction system was heated at 80 °C overnight. TLC analysis showed that compound 13 reacted completely. Water was added to the reaction system, followed by extraction twice with dichloromethane. The combined organic phases were washed with 5% citric acid aqueous solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 14 (5.62 g), which was directly used in the next reaction. ESI-MS: m / z 703.3 [M+H] +

[0185] Synthesis of compound 15:

[0186] Crude compound 14 (5.62 g) was dissolved in THF (50 mL), and 1.0 mol / L TBAF solution (9.98 mL, 9.98 mmol, 1.2 eq.) was added to the reaction system. The reaction was allowed to proceed overnight at room temperature. TLC analysis showed that compound 14 reacted completely. Water was added to the reaction system, followed by extraction twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 15. Crude compound 15 was then subjected to column chromatography (PE / EA = 2 / 3) to give compound 15 (3.13 g, 5.32 mmol, overall yield: 63.94%). ESI-MS: m / z 589.3 [M+H] +

[0187] Synthesis of compound 16:

[0188] Compound 15 (3.13 g, 5.32 mmol, 1.0 eq.) was dissolved in ultra-dry DCM (30 mL). DCI (566 mg, 4.79 mmol, 0.9 eq.) was added to the reaction system, and after purging with nitrogen, bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.92 g, 6.38 mmol, 1.2 eq.) was added. The reaction was carried out at room temperature for 30 minutes. TLC analysis showed that compound 15 reacted completely. A saturated aqueous sodium bicarbonate solution was added to the reaction system, followed by extraction with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 16. Crude compound 16 was subjected to column chromatography (PE / EA = 1 / 1) to obtain compound 16 (2.89 g, 3.67 mmol, 68.98% yield). 1 H NMR (400MHz, DMSO-d6) δ11.38(s,1H),7.56–7.18(m,10H),6.90–6.85(m,4H),5.79(d,J=4 .9Hz,1H),5.62(dd,J=8.1,2.2Hz,1H),4.61–4.41(m,1H),4.37–4.28(m,1H),4.11–3.98( m,1H),3.97–3.75(m,9H),3.42(s,3H),3.13–3.01(m,2H),2.91–2.71(m,2H),1.53–1.37( m,2H),1.25(dd,J=11.4,2.2Hz,3H),1.13(dd,J=10.9,4.2Hz,9H),0.83(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.32(s),148.29(s).ESI-MS:m / z 789.4[M+H] +

[0189] Example 3: Synthesis of Compound 20

[0190]

[0191] Synthesis of compound 17:

[0192] The dried compound 8 (10.00, 26.03 mmol, 1.0 eq.) was dissolved in ultra-dry THF (100 mL). The reaction mixture was cooled to -20 °C and stirred at this temperature for 20 minutes. The entire reaction was carried out under nitrogen protection. Then, a 1.0 mol / L solution of ethyl magnesium bromide (78.09 mL, 78.09 mmol, 3.0 eq.) was slowly added dropwise. After the addition was complete, the mixture was allowed to return to room temperature and stirred. TLC and LCMS analysis showed that compound 8 reacted completely. The reaction was quenched by adding saturated ammonium chloride solution. The mixture was extracted twice with ethyl acetate, and the organic phases were combined and washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 17. Crude product 17 was subjected to column chromatography (PE / EA = 2 / 3) to obtain compound 17 (3.01 g, 7.27 mmol, 27.93% yield) (TLC: R). f =0.46, PE / EA=1 / 3). ESI-MS:m / z 415.2[M+H] +

[0193] Synthesis of compound 18:

[0194] Compound 17 (3.01 g, 7.27 mmol, 1.0 eq.) was dissolved in DCE (30 mL). AgNO3 (1.23 g, 7.27 mmol, 1.0 eq.) and 2,4,6-trimethylpyridine (1.76 g, 14.54 mmol, 2.0 eq.) were added to the reaction system, followed by DMTrCl (3.70 g, 10.91 mmol, 1.5 eq.). The reaction system was heated at 80 °C overnight. TLC analysis showed that compound 17 reacted completely. Water was added to the reaction system, followed by extraction twice with dichloromethane. The combined organic phases were washed with 5% citric acid aqueous solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 18 (5.21 g), which was used directly in the next reaction. ESI-MS: m / z 717.4 [M+H] +

[0195] Synthesis of compound 19:

[0196] Crude compound 18 (5.21 g) was dissolved in THF (50 mL), and 1.0 mol / L TBAF solution (8.72 mL, 8.72 mmol, 1.2 eq.) was added to the reaction system. The reaction was allowed to proceed overnight at room temperature. TLC analysis showed that compound 18 reacted completely. Water was added to the reaction system, followed by extraction twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 18. Crude compound 18 was then subjected to column chromatography (PE / EA = 2 / 3) to give compound 19 (2.67 g, 4.43 mmol, overall yield: 60.93%). ESI-MS: m / z 603.3 [M+H] +

[0197] Synthesis of compound 20:

[0198] Compound 19 (2.67 g, 4.43 mmol, 1.0 eq.) was dissolved in ultra-dry DCM (30 mL). DCI (471 mg, 3.99 mmol, 0.9 eq.) was added to the reaction system, and after purging with nitrogen, bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.60 g, 5.32 mmol, 1.2 eq.) was added. The reaction was carried out at room temperature for 30 minutes. TLC analysis showed that compound 19 reacted completely. A saturated aqueous sodium bicarbonate solution was added to the reaction system, followed by extraction with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 20. Crude compound 20 was subjected to column chromatography (PE / EA = 1 / 1) to obtain compound 20 (2.29 g, 2.85 mmol, 64.33% yield). 1 H NMR(400MHz,DMSO-d6)δ11.37(s,1H),7.55–7.19(m,10H),6.91–6.84(m,4H),5.7 8(d,J=4.9Hz,1H),5.61(dd,J=8.1,2.2Hz,1H),4.62–4.41(m,1H),4.37–4.27(m, 1H),4.11–3.97(m,1H),3.97–3.76(m,8H),3.43(s,3H),3.22–3.01(m,3H),2.91– 2.72(m,2H),1.62–1.30(m,4H),1.14(dd,J=10.9,4.2Hz,9H),0.98–0.74(m,6H). 31 P NMR(162MHz,DMSO-d6)δ149.25(s),148.11(s).ESI-MS:m / z 803.4[M+H] +

[0199] Example 4: Synthesis of Compound 24

[0200]

[0201] Synthesis of compound 21:

[0202] The dried compound 8 (10.00, 26.03 mmol, 1.0 eq.) was dissolved in ultra-dry THF (100 mL). The reaction mixture was cooled to -20 °C and stirred at this temperature for 20 minutes. The entire reaction was carried out under nitrogen protection. Then, a 1.0 mol / L solution of ethyl magnesium bromide (78.09 mL, 78.09 mmol, 3.0 eq.) was slowly added dropwise. After the addition was complete, the mixture was allowed to return to room temperature and stirred. TLC and LCMS analysis showed that compound 8 reacted completely. The reaction was quenched by adding saturated ammonium chloride solution, and the mixture was extracted twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 21. Crude product 21 was subjected to column chromatography (PE / EA = 2 / 3) to obtain compound 21 (2.45 g, 5.91 mmol, 22.70% yield) (TLC: R). f =0.41, PE / EA=1 / 3). ESI-MS:m / z 415.2[M+H] +

[0203] Synthesis of compound 22:

[0204] Compound 21 (2.45 g, 5.91 mmol, 1.0 eq.) was dissolved in DCE (30 mL). AgNO3 (1.00 g, 5.91 mmol, 1.0 eq.) and 2,4,6-trimethylpyridine (1.43 g, 11.82 mmol, 2.0 eq.) were added to the reaction system, followed by DMTrCl (3.01 g, 8.87 mmol, 1.5 eq.). The reaction system was heated at 80 °C overnight. TLC analysis showed that compound 21 reacted completely. Water was added to the reaction system, followed by extraction twice with dichloromethane. The combined organic phases were washed with 5% citric acid aqueous solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 22 (4.03 g), which was directly used in the next reaction. ESI-MS: m / z 717.4 [M+H] +

[0205] Synthesis of compound 23:

[0206] Crude compound 22 (4.03 g) was dissolved in THF (40 mL), and 1.0 mol / L TBAF solution (7.09 mL, 7.09 mmol, 1.2 eq.) was added to the reaction system. The reaction was allowed to proceed overnight at room temperature. TLC analysis showed that compound 22 reacted completely. Water was added to the reaction system, followed by extraction twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 23. Crude compound 23 was then subjected to column chromatography (PE / EA = 2 / 3) to give compound 23 (2.33 g, 3.87 mmol, overall yield: 65.48%). ESI-MS: m / z 603.3 [M+H] +

[0207] Synthesis of compound 24:

[0208] Compound 23 (2.33 g, 3.87 mmol, 1.0 eq.) was dissolved in ultra-dry DCM (25 mL). DCI (411 mg, 3.48 mmol, 0.9 eq.) was added to the reaction system, and after purging with nitrogen, bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.40 g, 4.64 mmol, 1.2 eq.) was added. The reaction was carried out at room temperature for 30 minutes. TLC analysis showed that compound 23 reacted completely. A saturated aqueous sodium bicarbonate solution was added to the reaction system, followed by extraction with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 24. Crude compound 24 was subjected to column chromatography (PE / EA = 1 / 1) to obtain compound 24 (2.10 g, 2.62 mmol, 67.70% yield). 1 H NMR(400MHz,DMSO-d6)δ11.36(s,1H),7.56–7.17(m,10H),6.90–6.83(m,4H),5.7 9(d,J=4.9Hz,1H),5.62(dd,J=8.1,2.2Hz,1H),4.61–4.43(m,1H),4.38–4.26(m, 1H),4.12–3.98(m,1H),3.98–3.75(m,8H),3.45(s,3H),3.23–3.01(m,3H),2.92– 2.71(m,2H),1.63–1.30(m,4H),1.15(dd,J=10.9,4.2Hz,9H),0.97–0.74(m,6H). 31 P NMR(162MHz,DMSO-d6)δ149.29(s),148.15(s).ESI-MS:m / z 803.4[M+H] +

[0209] Example 5: Synthesis of Compound 28

[0210]

[0211] Synthesis of compound 25:

[0212] The dried compound 8 (10.00, 26.03 mmol, 1.0 eq.) was dissolved in ultra-dry THF (100 mL). The reaction mixture was cooled to -20 °C and stirred at this temperature for 20 minutes. The entire reaction was carried out under nitrogen protection. Then, a 1.0 mol / L isopropyl magnesium bromide solution (78.09 mL, 78.09 mmol, 3.0 eq.) was slowly added dropwise. After the addition was complete, the mixture was allowed to return to room temperature and stirred. TLC and LCMS analysis showed that compound 8 reacted completely. The reaction was quenched by adding saturated ammonium chloride solution, and the mixture was extracted twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 25. Crude product 25 was subjected to column chromatography (PE / EA = 2 / 3) to give compound 25 (3.23 g, 7.54 mmol, 28.97% yield) (TLC: R f =0.43, PE / EA=1 / 3). ESI-MS:m / z 429.2[M+H] +

[0213] Synthesis of compound 26:

[0214] Compound 25 (3.23 g, 7.54 mmol, 1.0 eq.) was dissolved in DCE (35 mL). AgNO3 (1.28 g, 7.54 mmol, 1.0 eq.) and 2,4,6-trimethylpyridine (1.83 g, 15.08 mmol, 2.0 eq.) were added to the reaction system, followed by DMTrCl (3.83 g, 11.31 mmol, 1.5 eq.). The reaction system was heated at 80 °C overnight. TLC analysis showed that compound 25 reacted completely. Water was added to the reaction system, followed by extraction twice with dichloromethane. The combined organic phases were washed with 5% citric acid aqueous solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 26 (4.67 g), which was directly used in the next reaction. ESI-MS: m / z 731.4 [M+H] +

[0215] Synthesis of compound 27:

[0216] Crude compound 26 (4.67 g) was dissolved in THF (40 mL), and 1.0 mol / L TBAF solution (9.05 mL, 9.05 mmol, 1.2 eq.) was added to the reaction system. The reaction was allowed to proceed overnight at room temperature. TLC analysis showed that compound 26 reacted completely. Water was added to the reaction system, followed by extraction twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 27. Crude compound 27 was then subjected to column chromatography (PE / EA = 2 / 3) to give compound 27 (2.89 g, 4.69 mmol, overall yield: 62.20%). ESI-MS: m / z 617.3 [M+H] +

[0217] Synthesis of compound 28:

[0218] Compound 27 (2.89 g, 4.69 mmol, 1.0 eq.) was dissolved in ultra-dry DCM (30 mL). DCI (498 mg, 4.22 mmol, 0.9 eq.) was added to the reaction system, and after purging with nitrogen, bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.70 g, 5.63 mmol, 1.2 eq.) was added. The reaction was carried out at room temperature for 30 minutes. TLC analysis showed that compound 27 reacted completely. A saturated aqueous sodium bicarbonate solution was added to the reaction system, followed by extraction with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 28. Crude compound 28 was subjected to column chromatography (PE / EA = 1 / 1) to obtain compound 28 (2.65 g, 3.25 mmol, 69.30% yield). 1 H NMR(400MHz,DMSO-d6)δ11.38(s,1H),7.55–7.18(m,10H),6.92–6.85(m,4H),5.79( d,J=4.9Hz,1H),5.62(dd,J=8.1,2.2Hz,1H),4.61–4.41(m,1H),4.38–4.28(m,1H),4 .12–3.98(m,1H),3.93–3.73(m,9H),3.42(s,3H),3.14–3.01(m,2H),2.92–2.71(m,2 H),2.26–1.95(m,1H),1.55–1.38(m,2H),1.13–0.89(m,15H),0.83(t,J=6.7Hz,3H). 31 PNMR(162MHz,DMSO-d6)δ149.33(s),148.71(s).ESI-MS:m / z 817.4[M+H] +

[0219] Example 6: Synthesis of Compound 32

[0220]

[0221] Synthesis of compound 29:

[0222] The dried compound 8 (10.00, 26.03 mmol, 1.0 eq.) was dissolved in ultra-dry THF (100 mL). The reaction mixture was cooled to -20 °C and stirred at this temperature for 20 minutes. The entire reaction was carried out under nitrogen protection. Then, a 1.0 mol / L isopropyl magnesium bromide solution (78.09 mL, 78.09 mmol, 3.0 eq.) was slowly added dropwise. After the addition was complete, the mixture was allowed to return to room temperature and stirred. TLC and LCMS analysis showed that compound 8 reacted completely. The reaction was quenched by adding saturated ammonium chloride solution. The mixture was extracted twice with ethyl acetate, and the organic phases were combined and washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 29. Crude product 29 was subjected to column chromatography (PE / EA = 2 / 3) to obtain compound 29 (2.76 g, 6.45 mmol, 24.78% yield) (TLC: R). f =0.39, PE / EA=1 / 3). ESI-MS:m / z 429.2[M+H] +

[0223] Synthesis of compound 30:

[0224] Compound 29 (2.76 g, 6.45 mmol, 1.0 eq.) was dissolved in DCE (30 mL). AgNO3 (1.10 g, 6.45 mmol, 1.0 eq.) and 2,4,6-trimethylpyridine (1.56 g, 12.90 mmol, 2.0 eq.) were added to the reaction system, followed by DMTrCl (3.28 g, 9.68 mmol, 1.5 eq.). The reaction system was heated at 80 °C overnight. TLC analysis showed that compound 29 reacted completely. Water was added to the reaction system, followed by extraction twice with dichloromethane. The combined organic phases were washed with 5% citric acid aqueous solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 30 (4.12 g), which was used directly in the next reaction. ESI-MS: m / z 731.4 [M+H] +

[0225] Synthesis of compound 31:

[0226] Crude compound 30 (4.12 g) was dissolved in THF (40 mL), and 1.0 mol / L TBAF solution (7.74 mL, 7.74 mmol, 1.2 eq.) was added to the reaction system. The reaction was allowed to proceed overnight at room temperature. TLC analysis showed that compound 30 reacted completely. Water was added to the reaction system, followed by extraction twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 31. Crude compound 31 was subjected to column chromatography (PE / EA = 2 / 3) to give compound 31 (2.32 g, 3.76 mmol, overall yield: 58.29%). ESI-MS: m / z 617.3 [M+H] +

[0227] Synthesis of compound 32:

[0228] Compound 31 (2.32 g, 3.76 mmol, 1.0 eq.) was dissolved in ultra-dry DCM (25 mL). DCI (399 mg, 3.38 mmol, 0.9 eq.) was added to the reaction system, and after purging with nitrogen, bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.36 g, 4.51 mmol, 1.2 eq.) was added. The reaction was carried out at room temperature for 30 minutes. TLC analysis showed that compound 31 reacted completely. A saturated aqueous sodium bicarbonate solution was added to the reaction system, followed by extraction with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 32. Crude compound 32 was subjected to column chromatography (PE / EA = 1 / 1) to obtain compound 32 (2.19 g, 2.68 mmol, 71.28% yield). 1 H NMR(400MHz,DMSO-d6)δ11.36(s,1H),7.62–7.21(m,10H),6.98–6.87(m,4H),5.78( d,J=4.9Hz,1H),5.65(dd,J=8.1,2.2Hz,1H),4.62–4.41(m,1H),4.35–4.22(m,1H),4 .11–3.91(m,1H),3.90–3.70(m,9H),3.45(s,3H),3.15–3.02(m,2H),2.93–2.72(m,2 H),2.24–1.91(m,1H),1.56–1.34(m,2H),1.12–0.88(m,15H),0.81(t,J=6.7Hz,3H). 31 PNMR(162MHz,DMSO-d6)δ149.39(s),148.72(s).ESI-MS:m / z 817.4[M+H] +

[0229] Example 7: Synthesis of Compound 36

[0230]

[0231] Synthesis of compound 33:

[0232] The dried compound 8 (10.00, 26.03 mmol, 1.0 eq.) was dissolved in ultra-dry THF (100 mL). The reaction mixture was cooled to -20 °C and stirred at this temperature for 20 minutes. The entire reaction was carried out under nitrogen protection. Then, a 1.0 mol / L vinyl magnesium bromide solution (78.09 mL, 78.09 mmol, 3.0 eq.) was slowly added dropwise. After the addition was complete, the mixture was allowed to return to room temperature and stirred. TLC and LCMS analysis showed that compound 8 reacted completely. The reaction was quenched by adding saturated ammonium chloride solution. The mixture was extracted twice with ethyl acetate, and the organic phases were combined and washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 33. Crude product 33 was subjected to column chromatography (PE / EA = 2 / 3) to obtain compound 33 (3.30 g, 8.01 mmol, 30.77% yield) (TLC: R f =0.48, PE / EA=1 / 3). ESI-MS:m / z 413.2[M+H] +

[0233] Synthesis of compound 34:

[0234] Compound 33 (3.30 g, 8.01 mmol, 1.0 eq.) was dissolved in DCE (35 mL). AgNO3 (1.36 g, 8.01 mmol, 1.0 eq.) and 2,4,6-trimethylpyridine (1.94 g, 16.02 mmol, 2.0 eq.) were added to the reaction system, followed by DMTrCl (4.07 g, 12.02 mmol, 1.5 eq.). The reaction system was heated at 80 °C overnight. TLC analysis showed that compound 33 reacted completely. Water was added to the reaction system, followed by extraction twice with dichloromethane. The combined organic phases were washed with 5% citric acid aqueous solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 34 (5.03 g), which was directly used in the next reaction. ESI-MS: m / z 715.3 [M+H] +

[0235] Synthesis of compound 35:

[0236] Crude compound 34 (5.03 g) was dissolved in THF (50 mL), and 1.0 mol / L TBAF solution (9.61 mL, 9.61 mmol, 1.2 eq.) was added to the reaction system. The reaction was allowed to proceed overnight at room temperature. TLC analysis showed that compound 34 reacted completely. Water was added to the reaction system, followed by extraction twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 35. Crude compound 35 was subjected to column chromatography (PE / EA = 2 / 3) to give compound 35 (2.90 g, 4.83 mmol, overall yield: 60.30%). ESI-MS: m / z 601.3 [M+H] +

[0237] Synthesis of compound 36:

[0238] Compound 35 (2.90 g, 4.83 mmol, 1.0 eq.) was dissolved in ultra-dry DCM (30 mL). DCI (514 mg, 4.35 mmol, 0.9 eq.) was added to the reaction system, and after purging with nitrogen, bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.75 g, 5.80 mmol, 1.2 eq.) was added. The reaction was carried out at room temperature for 30 minutes. TLC analysis showed that compound 35 reacted completely. A saturated aqueous sodium bicarbonate solution was added to the reaction system, followed by extraction with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 36. Crude compound 36 was subjected to column chromatography (PE / EA = 1 / 1) to obtain compound 36 (2.58 g, 3.22 mmol, 66.67% yield). 1 H NMR(400MHz,DMSO-d6)δ11.36(s,1H),7.55–7.11(m,10H),6.90–6.80(m,5H),5.75(d, J=4.9Hz,1H),5.65(dd,J=8.1,2.2Hz,1H),5.45–5.01(m,2H),4.61–4.41(m,1H),4.36– 4.28(m,1H),4.12–3.98(m,1H),3.96–3.72(m,9H),3.42(s,3H),3.15–3.01(m,2H),2.9 2–2.71(m,2H),1.55–1.38(m,2H),1.16(dd,J=10.9,4.2Hz,9H),0.83(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.25(s),148.37(s).ESI-MS:m / z 801.4[M+H] +

[0239] Example 8: Synthesis of Compound 40

[0240]

[0241] Synthesis of compound 37:

[0242] The dried compound 8 (10.00, 26.03 mmol, 1.0 eq.) was dissolved in ultra-dry THF (100 mL). The reaction mixture was cooled to -20 °C and stirred at this temperature for 20 minutes. The entire reaction was carried out under nitrogen protection. Then, a 1.0 mol / L vinyl magnesium bromide solution (78.09 mL, 78.09 mmol, 3.0 eq.) was slowly added dropwise. After the addition was complete, the mixture was allowed to return to room temperature and stirred. TLC and LCMS analysis showed that compound 8 reacted completely. The reaction was quenched by adding saturated ammonium chloride solution. The mixture was extracted twice with ethyl acetate, and the organic phases were combined and washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 37. Crude product 37 was subjected to column chromatography (PE / EA = 2 / 3) to obtain compound 37 (2.45 g, 5.94 mmol, 22.82% yield) (TLC: R). f =0.43, PE / EA=1 / 3). ESI-MS:m / z 413.2[M+H] +

[0243] Synthesis of compound 38:

[0244] Compound 37 (2.45 g, 5.94 mmol, 1.0 eq.) was dissolved in DCE (30 mL). AgNO3 (1.01 g, 5.94 mmol, 1.0 eq.) and 2,4,6-trimethylpyridine (1.44 g, 11.88 mmol, 2.0 eq.) were added to the reaction system, followed by DMTrCl (3.02 g, 8.91 mmol, 1.5 eq.). The reaction system was heated at 80 °C overnight. TLC analysis showed that compound 37 reacted completely. Water was added to the reaction system, followed by extraction twice with dichloromethane. The combined organic phases were washed with 5% citric acid aqueous solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 38 (3.98 g), which was directly used in the next reaction. ESI-MS: m / z 715.3 [M+H] +

[0245] Synthesis of compound 39:

[0246] Crude compound 38 (3.98 g) was dissolved in THF (40 mL), and 1.0 mol / L TBAF solution (7.13 mL, 7.13 mmol, 1.2 eq.) was added to the reaction system. The reaction was allowed to proceed overnight at room temperature. TLC analysis showed that compound 38 reacted completely. Water was added to the reaction system, followed by extraction twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 39. Crude compound 39 was then subjected to column chromatography (PE / EA = 2 / 3) to give compound 39 (2.10 g, 3.50 mmol, overall yield: 58.92%). ESI-MS: m / z 601.3 [M+H] +

[0247] Synthesis of compound 40:

[0248] Compound 39 (2.10 g, 3.50 mmol, 1.0 eq.) was dissolved in ultra-dry DCM (35 mL). DCI (372 mg, 3.15 mmol, 0.9 eq.) was added to the reaction system, and after purging with nitrogen, bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.27 g, 4.20 mmol, 1.2 eq.) was added. The reaction was carried out at room temperature for 30 minutes. TLC analysis showed that compound 39 reacted completely. A saturated aqueous sodium bicarbonate solution was added to the reaction system, followed by extraction with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 40. Crude product 40 was subjected to column chromatography (PE / EA = 1 / 1) to obtain compound 40 (1.95 g, 2.44 mmol, 69.71% yield). 1 H NMR(400MHz,DMSO-d6)δ11.35(s,1H),7.54–7.10(m,10H),6.93–6.81(m,5H),5.76(d, J=4.9Hz,1H),5.66(dd,J=8.1,2.2Hz,1H),5.43–5.02(m,2H),4.64–4.45(m,1H),4.33– 4.27(m,1H),4.13–3.97(m,1H),3.98–3.71(m,9H),3.41(s,3H),3.16–3.02(m,2H),2.9 1–2.72(m,2H),1.56–1.37(m,2H),1.15(dd,J=10.9,4.2Hz,9H),0.84(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.28(s),148.39(s).ESI-MS:m / z 801.4[M+H] +

[0249] Example 9: Synthesis of Compound 44

[0250]

[0251] Synthesis of compound 41:

[0252] The dried compound 8 (10.00, 26.03 mmol, 1.0 eq.) was dissolved in ultra-dry THF (100 mL). The reaction mixture was cooled to -20 °C and stirred at this temperature for 20 minutes. The entire reaction was carried out under nitrogen protection. Then, 0.5 mol / L acetylenyl magnesium bromide solution (156.18 mL, 78.09 mmol, 3.0 eq.) was slowly added dropwise. After the addition was complete, the mixture was allowed to return to room temperature and stirred. TLC and LCMS analysis showed that compound 8 reacted completely. The reaction was quenched by adding saturated ammonium chloride solution, and the mixture was extracted twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 41. Crude product 41 was subjected to column chromatography (PE / EA = 2 / 3) to obtain compound 41 (3.50 g, 8.53 mmol, 32.77% yield) (TLC: R f =0.45, PE / EA=1 / 3). ESI-MS:m / z 411.2[M+H] +

[0253] Synthesis of compound 42:

[0254] Compound 41 (3.50 g, 8.53 mmol, 1.0 eq.) was dissolved in DCE (35 mL). AgNO3 (1.45 g, 8.53 mmol, 1.0 eq.) and 2,4,6-trimethylpyridine (2.07 g, 17.06 mmol, 2.0 eq.) were added to the reaction system, followed by DMTrCl (4.34 g, 12.80 mmol, 1.5 eq.). The reaction system was heated at 80 °C overnight. TLC analysis showed that compound 41 reacted completely. Water was added to the reaction system, followed by extraction twice with dichloromethane. The combined organic phases were washed with 5% citric acid aqueous solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 42 (5.11 g), which was used directly in the next reaction. ESI-MS: m / z 713.3 [M+H] +

[0255] Synthesis of compound 43:

[0256] Crude compound 42 (5.11 g) was dissolved in THF (50 mL), and 1.0 mol / L TBAF solution (10.24 mL, 10.24 mmol, 1.2 eq.) was added to the reaction system. The reaction was allowed to proceed overnight at room temperature. TLC analysis showed that compound 42 reacted completely. Water was added to the reaction system, followed by extraction twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 43. Crude compound 43 was then subjected to column chromatography (PE / EA = 2 / 3) to give compound 43 (3.05 g, 5.10 mmol, overall yield: 59.79%). ESI-MS: m / z 599.2 [M+H] +

[0257] Synthesis of compound 44:

[0258] Compound 43 (3.05 g, 5.10 mmol, 1.0 eq.) was dissolved in ultra-dry DCM (30 mL). DCI (542 mg, 4.59 mmol, 0.9 eq.) was added to the reaction system, and after purging with nitrogen, bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.84 g, 6.12 mmol, 1.2 eq.) was added. The reaction was carried out at room temperature for 30 minutes. TLC analysis showed that compound 43 reacted completely. A saturated aqueous sodium bicarbonate solution was added to the reaction system, followed by extraction with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 44. Crude product 44 was subjected to column chromatography (PE / EA = 1 / 1) to obtain compound 44 (2.87 g, 3.59 mmol, 70.39% yield). 1 H NMR(400MHz,DMSO-d6)δ11.35(s,1H),7.56–7.18(m,10H),6.90–6.83(m,4H),5.77( d,J=4.9Hz,1H),5.62(dd,J=8.1,2.2Hz,1H),4.61–4.42(m,1H),4.34–4.23(m,1H), 4.13–3.95(m,1H),3.94–3.73(m,9H),3.52-3.34(m,4H),3.15–3.01(m,2H),2.92–2 .71(m,2H),1.55–1.34(m,2H),1.13(dd,J=10.9,4.2Hz,9H),0.83(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.41(s),148.52(s).ESI-MS:m / z 799.4[M+H] +

[0259] Example 10: Synthesis of Compound 48

[0260]

[0261] Synthesis of compound 45:

[0262] The dried compound 8 (10.00, 26.03 mmol, 1.0 eq.) was dissolved in ultra-dry THF (100 mL). The reaction mixture was cooled to -20 °C and stirred at this temperature for 20 minutes. The entire reaction was carried out under nitrogen protection. Then, 0.5 mol / L acetylenyl magnesium bromide solution (156.18 mL, 78.09 mmol, 3.0 eq.) was slowly added dropwise. After the addition was complete, the mixture was allowed to return to room temperature and stirred. TLC and LCMS analysis showed that compound 8 reacted completely. The reaction was quenched by adding saturated ammonium chloride solution, and the mixture was extracted twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 45. Crude product 45 was subjected to column chromatography (PE / EA = 2 / 3) to obtain compound 45 (2.05 g, 5.00 mmol, 19.21% yield) (TLC: R f =0.42, PE / EA=1 / 3). ESI-MS:m / z 411.2[M+H] +

[0263] Synthesis of compound 46:

[0264] Compound 45 (2.05 g, 5.00 mmol, 1.0 eq.) was dissolved in DCE (25 mL). AgNO3 (0.85 g, 5.00 mmol, 1.0 eq.) and 2,4,6-trimethylpyridine (1.21 g, 10.00 mmol, 2.0 eq.) were added to the reaction system, followed by DMTrCl (2.54 g, 7.50 mmol, 1.5 eq.). The reaction system was heated at 80 °C overnight. TLC analysis showed that compound 45 reacted completely. Water was added to the reaction system, followed by extraction twice with dichloromethane. The combined organic phases were washed with 5% citric acid aqueous solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 46 (3.11 g), which was used directly in the next reaction. ESI-MS: m / z 713.3 [M+H] +

[0265] Synthesis of compound 47:

[0266] Crude compound 46 (3.11 g) was dissolved in THF (30 mL), and 1.0 mol / L TBAF solution (6.00 mL, 6.00 mmol, 1.2 eq.) was added to the reaction system. The reaction was allowed to proceed overnight at room temperature. TLC analysis showed that compound 46 reacted completely. Water was added to the reaction system, followed by extraction twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 47. Crude compound 47 was then subjected to column chromatography (PE / EA = 2 / 3) to give compound 47 (1.95 g, 3.26 mmol, overall yield: 65.20%). ESI-MS: m / z 599.2 [M+H] +

[0267] Synthesis of compound 48:

[0268] Compound 47 (1.95 g, 3.26 mmol, 1.0 eq.) was dissolved in ultra-dry DCM (20 mL). DCI (346 mg, 2.93 mmol, 0.9 eq.) was added to the reaction system, and after purging with nitrogen, bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.18 g, 3.91 mmol, 1.2 eq.) was added. The reaction was carried out at room temperature for 30 minutes. TLC analysis showed that compound 47 reacted completely. A saturated aqueous sodium bicarbonate solution was added to the reaction system, followed by extraction with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 48. Crude compound 48 was subjected to column chromatography (PE / EA = 1 / 1) to obtain compound 48 (1.81 g, 2.27 mmol, 69.63% yield). 1 H NMR(400MHz,DMSO-d6)δ11.33(s,1H),7.54–7.14(m,10H),6.92–6.81(m,4H),5.76( d,J=4.9Hz,1H),5.63(dd,J=8.1,2.2Hz,1H),4.63–4.41(m,1H),4.35–4.22(m,1H), 4.12–3.94(m,1H),3.91–3.71(m,9H),3.51-3.38(m,4H),3.14–3.00(m,2H),2.94–2 .73(m,2H),1.53–1.31(m,2H),1.14(dd,J=10.9,4.2Hz,9H),0.85(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.45(s),148.57(s).ESI-MS:m / z 799.4[M+H] +

[0269] Example 11: Synthesis of Compound 52

[0270]

[0271] Synthesis of compound 49:

[0272] The dried compound 8 (10.00, 26.03 mmol, 1.0 eq.) was dissolved in ultra-dry THF (100 mL). The reaction mixture was cooled to -20 °C and stirred at this temperature for 20 minutes. The entire reaction was carried out under nitrogen protection. Then, a 1.0 mol / L magnesium phenyl bromide solution (78.09 mL, 78.09 mmol, 3.0 eq.) was slowly added dropwise. After the addition was complete, the mixture was allowed to return to room temperature and stirred. TLC and LCMS analysis showed that compound 8 reacted completely. The reaction was quenched by adding saturated ammonium chloride solution. The mixture was extracted twice with ethyl acetate, and the organic phases were combined and washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 49. Crude product 49 was subjected to column chromatography (PE / EA = 2 / 3) to obtain compound 49 (3.20 g, 6.92 mmol, 26.58% yield) (TLC: R). f =0.47, PE / EA=1 / 3). ESI-MS:m / z 463.2[M+H] +

[0273] Synthesis of Compound 50:

[0274] Compound 49 (3.20 g, 6.92 mmol, 1.0 eq.) was dissolved in DCE (35 mL). AgNO3 (1.18 g, 6.92 mmol, 1.0 eq.) and 2,4,6-trimethylpyridine (1.68 g, 13.84 mmol, 2.0 eq.) were added to the reaction system, followed by DMTrCl (3.52 g, 10.38 mmol, 1.5 eq.). The reaction system was heated at 80 °C overnight. TLC analysis showed that compound 49 reacted completely. Water was added to the reaction system, followed by extraction twice with dichloromethane. The combined organic phases were washed with 5% citric acid aqueous solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 50 (4.98 g), which was directly used in the next reaction. ESI-MS: m / z 765.4 [M+H] +

[0275] Synthesis of compound 51:

[0276] Crude compound 50 (4.98 g) was dissolved in THF (50 mL), and 1.0 mol / L TBAF solution (8.30 mL, 8.30 mmol, 1.2 eq.) was added to the reaction system. The reaction was allowed to proceed overnight at room temperature. TLC analysis showed that compound 50 reacted completely. Water was added to the reaction system, followed by extraction twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 51. Crude compound 51 was subjected to column chromatography (PE / EA = 2 / 3) to give compound 51 (3.10 g, 4.77 mmol, overall yield: 68.93%). ESI-MS: m / z 651.3 [M+H] +

[0277] Synthesis of compound 52:

[0278] Compound 51 (3.10 g, 4.77 mmol, 1.0 eq.) was dissolved in ultra-dry DCM (35 mL). DCI (507 mg, 4.29 mmol, 0.9 eq.) was added to the reaction system, and after purging with nitrogen, bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.72 g, 5.72 mmol, 1.2 eq.) was added. The reaction was carried out at room temperature for 30 minutes. TLC analysis showed that compound 51 reacted completely. A saturated aqueous sodium bicarbonate solution was added to the reaction system, followed by extraction with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 52. Crude compound 52 was subjected to column chromatography (PE / EA = 1 / 1) to obtain compound 52 (2.86 g, 3.36 mmol, 70.44% yield). 1 H NMR(400MHz,DMSO-d6)δ11.35(s,1H),7.55–7.10(m,15H),6.92–6.85(m,4H),5.7 5(d,J=4.9Hz,1H),5.65(dd,J=8.1,2.2Hz,1H),4.75–4.41(m,2H),4.36–4.28(m,1 H),4.12–3.98(m,1H),3.96–3.76(m,8H),3.45(s,3H),3.15–3.04(m,2H),2.94–2. 71(m,2H),1.55–1.38(m,2H),1.16(dd,J=10.9,4.2Hz,9H),0.85(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.40(s),148.51(s).ESI-MS:m / z 851.4[M+H] +

[0279] Example 12: Synthesis of Compound 56

[0280]

[0281] Synthesis of compound 53:

[0282] The dried compound 8 (10.00, 26.03 mmol, 1.0 eq.) was dissolved in ultra-dry THF (100 mL). The reaction mixture was cooled to -20 °C and stirred at this temperature for 20 minutes. The entire reaction was carried out under nitrogen protection. Then, a 1.0 mol / L magnesium phenyl bromide solution (78.09 mL, 78.09 mmol, 3.0 eq.) was slowly added dropwise. After the addition was complete, the mixture was allowed to return to room temperature and stirred. TLC and LCMS analysis showed that compound 8 reacted completely. The reaction was quenched by adding saturated ammonium chloride solution, and the mixture was extracted twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 53. Crude product 53 was subjected to column chromatography (PE / EA = 2 / 3) to obtain compound 53 (2.35 g, 5.08 mmol, 19.52% yield) (TLC: R). f =0.42, PE / EA=1 / 3). ESI-MS:m / z 463.2[M+H] +

[0283] Synthesis of compound 54:

[0284] Compound 53 (2.35 g, 5.08 mmol, 1.0 eq.) was dissolved in DCE (25 mL). AgNO3 (0.86 g, 5.08 mmol, 1.0 eq.) and 2,4,6-trimethylpyridine (1.23 g, 10.16 mmol, 2.0 eq.) were added to the reaction system, followed by DMTrCl (2.58 g, 7.62 mmol, 1.5 eq.). The reaction system was heated at 80 °C overnight. TLC analysis showed that compound 53 reacted completely. Water was added to the reaction system, followed by extraction twice with dichloromethane. The combined organic phases were washed with 5% citric acid aqueous solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 54 (3.56 g), which was directly used in the next reaction. ESI-MS: m / z 765.4 [M+H] +

[0285] Synthesis of compound 55:

[0286] Crude compound 54 (3.56 g) was dissolved in THF (40 mL), and 1.0 mol / L TBAF solution (6.10 mL, 6.10 mmol, 1.2 eq.) was added to the reaction system. The reaction was allowed to proceed overnight at room temperature. TLC analysis showed that compound 54 reacted completely. Water was added to the reaction system, followed by extraction twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 55. Crude compound 55 was then subjected to column chromatography (PE / EA = 2 / 3) to give compound 55 (2.02 g, 3.11 mmol, overall yield: 61.22%). ESI-MS: m / z 651.3 [M+H] +

[0287] Synthesis of compound 56:

[0288] Compound 55 (2.02 g, 3.11 mmol, 1.0 eq.) was dissolved in ultra-dry DCM (35 mL). DCI (331 mg, 2.80 mmol, 0.9 eq.) was added to the reaction system, and after purging with nitrogen, bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.12 g, 3.73 mmol, 1.2 eq.) was added. The reaction was carried out at room temperature for 30 minutes. TLC analysis showed that compound 55 reacted completely. A saturated aqueous sodium bicarbonate solution was added to the reaction system, followed by extraction with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 56. Crude compound 56 was subjected to column chromatography (PE / EA = 1 / 1) to obtain compound 56 (1.82 g, 2.14 mmol, 68.81% yield). 1 H NMR(400MHz,DMSO-d6)δ11.38(s,1H),7.55–7.12(m,15H),6.90–6.85(m,4H),5.7 9(d,J=4.9Hz,1H),5.62(dd,J=8.1,2.2Hz,1H),4.79–4.41(m,2H),4.36–4.28(m,1 H),4.12–3.98(m,1H),3.95–3.74(m,8H),3.42(s,3H),3.15–3.01(m,2H),2.92–2. 71(m,2H),1.55–1.38(m,2H),1.14(dd,J=10.9,4.2Hz,9H),0.83(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.41(s),148.57(s).ESI-MS:m / z 851.4[M+H] +

[0289] Example 13: Synthesis of Compound 60

[0290]

[0291] Synthesis of compound 57:

[0292] The dried compound 8 (10.00, 26.03 mmol, 1.0 eq.) was dissolved in ultra-dry THF (100 mL). The reaction mixture was cooled to -20 °C and stirred at this temperature for 20 minutes. The entire reaction was carried out under nitrogen protection. Then, a 1.0 mol / L benzyl magnesium bromide solution (78.09 mL, 78.09 mmol, 3.0 eq.) was slowly added dropwise. After the addition was complete, the mixture was allowed to return to room temperature and stirred. TLC and LCMS analysis showed that compound 8 reacted completely. The reaction was quenched by adding saturated ammonium chloride solution. The mixture was extracted twice with ethyl acetate, and the organic phases were combined and washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 57. Crude product 57 was subjected to column chromatography (PE / EA = 2 / 3) to obtain compound 57 (3.56 g, 7.48 mmol, 28.74% yield) (TLC: R). f =0.46, PE / EA=1 / 3). ESI-MS:m / z 477.2[M+H] +

[0293] Synthesis of compound 58:

[0294] Compound 57 (3.56 g, 7.48 mmol, 1.0 eq.) was dissolved in DCE (35 mL). AgNO3 (1.27 g, 7.48 mmol, 1.0 eq.) and 2,4,6-trimethylpyridine (1.81 g, 14.96 mmol, 2.0 eq.) were added to the reaction system, followed by DMTrCl (3.80 g, 11.22 mmol, 1.5 eq.). The reaction system was heated at 80 °C overnight. TLC analysis showed that compound 57 reacted completely. Water was added to the reaction system, followed by extraction twice with dichloromethane. The combined organic phases were washed with 5% citric acid aqueous solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 58 (5.16 g), which was used directly in the next reaction. ESI-MS: m / z 779.4 [M+H] +

[0295] Synthesis of compound 59:

[0296] Crude compound 58 (5.16 g) was dissolved in THF (50 mL), and 1.0 mol / L TBAF solution (8.98 mL, 8.98 mmol, 1.2 eq.) was added to the reaction system. The reaction was allowed to proceed overnight at room temperature. TLC analysis showed that compound 58 reacted completely. Water was added to the reaction system, followed by extraction twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 59. Crude compound 59 was then subjected to column chromatography (PE / EA = 2 / 3) to give compound 59 (3.23 g, 5.00 mmol, overall yield: 66.84%). ESI-MS: m / z 665.3 [M+H] +

[0297] Synthesis of compound 60:

[0298] Compound 59 (3.23 g, 5.00 mmol, 1.0 eq.) was dissolved in ultra-dry DCM (35 mL). DCI (531 mg, 4.50 mmol, 0.9 eq.) was added to the reaction system, and after purging with nitrogen, bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.81 g, 6.00 mmol, 1.2 eq.) was added. The reaction was carried out at room temperature for 30 minutes. TLC analysis showed that compound 59 reacted completely. A saturated aqueous sodium bicarbonate solution was added to the reaction system, followed by extraction with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 60. Crude product 60 was subjected to column chromatography (PE / EA = 1 / 1) to obtain compound 60 (3.05 g, 3.53 mmol, 70.60% yield). 1 H NMR(400MHz,DMSO-d6)δ11.35(s,1H),7.55–7.19(m,15H),6.90–6.85(m,4H),5.7 5(d,J=4.9Hz,1H),5.65(dd,J=8.1,2.2Hz,1H),4.61–4.42(m,1H),4.36–4.28(m,1 H),4.12–3.98(m,1H),3.94–3.74(m,9H),3.42(s,3H),3.15–3.01(m,2H),2.91–2. 53(m,4H),1.53–1.38(m,2H),1.16(dd,J=10.9,4.2Hz,9H),0.83(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.42(s),148.56(s).ESI-MS:m / z 865.4[M+H] +

[0299] Example 14: Synthesis of Compound 64

[0300]

[0301] Synthesis of compound 61:

[0302] The dried compound 8 (10.00, 26.03 mmol, 1.0 eq.) was dissolved in ultra-dry THF (100 mL). The reaction mixture was cooled to -20 °C and stirred at this temperature for 20 minutes. The entire reaction was carried out under nitrogen protection. Then, a 1.0 mol / L benzyl magnesium bromide solution (78.09 mL, 78.09 mmol, 3.0 eq.) was slowly added dropwise. After the addition was complete, the mixture was allowed to return to room temperature and stirred. TLC and LCMS analysis showed that compound 8 reacted completely. The reaction was quenched by adding saturated ammonium chloride solution. The mixture was extracted twice with ethyl acetate, and the combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 61. Crude product 61 was subjected to column chromatography (PE / EA = 2 / 3) to obtain compound 61 (3.01 g, 6.32 mmol, 24.28% yield) (TLC: R). f =0.43, PE / EA=1 / 3). ESI-MS:m / z 477.2[M+H] +

[0303] Synthesis of compound 62:

[0304] Compound 61 (3.01 g, 6.32 mmol, 1.0 eq.) was dissolved in DCE (30 mL). AgNO3 (1.07 g, 6.32 mmol, 1.0 eq.) and 2,4,6-trimethylpyridine (1.53 g, 12.64 mmol, 2.0 eq.) were added to the reaction system, followed by DMTrCl (3.21 g, 9.48 mmol, 1.5 eq.). The reaction system was heated at 80 °C overnight. TLC analysis showed that compound 61 reacted completely. Water was added to the reaction system, followed by two extractions with dichloromethane. The combined organic phases were washed with 5% citric acid aqueous solution and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 62 (4.80 g), which was used directly in the next reaction. ESI-MS: m / z 779.4 [M+H] +

[0305] Synthesis of compound 63:

[0306] Crude compound 62 (4.80 g) was dissolved in THF (50 mL), and 1.0 mol / L TBAF solution (7.58 mL, 7.58 mmol, 1.2 eq.) was added to the reaction system. The reaction was allowed to proceed overnight at room temperature. TLC analysis showed that compound 62 reacted completely. Water was added to the reaction system, followed by extraction twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 63. Crude compound 63 was then subjected to column chromatography (PE / EA = 2 / 3) to give compound 63 (2.80 g, 4.22 mmol, overall yield: 66.77%). ESI-MS: m / z 665.3 [M+H] +

[0307] Synthesis of compound 64:

[0308] Compound 63 (2.80 g, 4.22 mmol, 1.0 eq.) was dissolved in ultra-dry DCM (30 mL). DCI (449 mg, 3.80 mmol, 0.9 eq.) was added to the reaction system, and after purging with nitrogen, bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.53 g, 5.06 mmol, 1.2 eq.) was added. The reaction was carried out at room temperature for 30 minutes. TLC analysis showed that compound 63 reacted completely. A saturated aqueous sodium bicarbonate solution was added to the reaction system, followed by extraction with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 64. Crude compound 64 was subjected to column chromatography (PE / EA = 1 / 1) to obtain compound 64 (2.46 g, 2.85 mmol, 67.54% yield). 1 H NMR(400MHz,DMSO-d6)δ11.36(s,1H),7.56–7.10(m,15H),6.91–6.82(m,4H),5.7 6(d,J=4.9Hz,1H),5.63(dd,J=8.1,2.2Hz,1H),4.62–4.41(m,1H),4.37–4.26(m,1 H),4.13–3.98(m,1H),3.92–3.71(m,9H),3.41(s,3H),3.16–3.02(m,2H),2.92–2. 53(m,4H),1.52–1.37(m,2H),1.15(dd,J=10.9,4.2Hz,9H),0.84(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.46(s),148.59(s).ESI-MS:m / z 865.4[M+H] +

[0309] Example 15: Synthesis of Compound 76

[0310]

[0311] The synthetic route for compound 76 is the same as in Example 1, except that the substrate uridine used in the synthesis of compound 2 from compound 1 in Example 1 is changed to 2'-fluoro-2'-deoxyuridine. The remaining steps are similar to those in Example 1. The NMR data of the obtained nucleoside compound 76 are shown below:

[0312] 1 H NMR(400MHz,DMSO-d6)δ11.35(s,1H),7.55–7.18(m,10H),6.92–6.81(m,4H),5.73(d, J=4.9Hz,1H),5.64(dd,J=8.1,2.2Hz,1H),5.23–4.98(m,1H),4.62–4.41(m,1H),4.13 –3.98(m,1H),3.95–3.75(m,9H),3.15–3.05(m,2H),2.91–2.72(m,2H),1.52–1.38(m, 2H), 1.25 (dd, J=11.4, 2.2Hz, 3H), 1.13 (dd, J=10.9, 4.2Hz, 9H), 0.83 (t, J=6.7Hz, 3H). 19 F NMR (377MHz, DMSO-d6) δ-200.11 (ddd, J=52.2, 22.0 16.9Hz). 31 P NMR(162MHz,DMSO-d6)δ149.41(s),148.54(s).ESI-MS:m / z 777.3[M+H] +

[0313] Example 16: Synthesis of Compound 80

[0314]

[0315] The synthetic route for compound 80 is the same as in Example 2, except that the substrate compound 8 used in the synthesis of compound 13 in Example 2 is changed to compound 72. The remaining steps are similar to those in Example 2. The NMR data of the obtained nucleoside compound 80 are shown below:

[0316] 1H NMR(400MHz,DMSO-d6)δ11.36(s,1H),7.55–7.18(m,10H),6.93–6.85(m,4H),5.75(d, J=4.9Hz,1H),5.66(dd,J=8.1,2.2Hz,1H),5.25–4.95(m,1H),4.61–4.43(m,1H),4.12 –3.97(m,1H),3.93–3.73(m,9H),3.13–3.03(m,2H),2.91–2.71(m,2H),1.53–1.38(m, 2H), 1.25 (dd, J=11.4, 2.2Hz, 3H), 1.15 (dd, J=10.9, 4.2Hz, 9H), 0.85 (t, J=6.7Hz, 3H). 19 F NMR (377MHz, DMSO-d6) δ-200.11 (ddd, J=52.2, 19.3, 17.4Hz). 31 P NMR(162MHz,DMSO-d6)δ149.41(s),148.54(s).ESI-MS:m / z 777.3[M+H] +

[0317] Example 17: Synthesis of Compound 92

[0318]

[0319] The synthetic route for compound 92 is the same as in Example 1, except that the substrate uridine used in the synthesis of compound 2 from compound 1 in Example 1 is changed to 2'-deoxyuridine. The remaining steps are similar to those in Example 1. The NMR data of the obtained nucleoside compound 92 are shown below:

[0320] 1 H NMR(400MHz,DMSO-d6)δ11.35(s,1H),7.55–7.18(m,10H),6.93–6.85(m,4H),6.17(t, J=6.8,6.6Hz,1H),5.79(d,J=4.9Hz,1H),4.65–4.45(m,1H),4.10–3.98(m,1H),3.95– 3.75(m,9H),3.15–3.02(m,2H),2.95–2.71(m,2H),2.45–2.11(m,2H),1.55–1.34(m,2 H), 1.25 (dd, J=11.4, 2.2Hz, 3H), 1.13 (dd, J=10.9, 4.2Hz, 9H), 0.83 (t, J=6.7Hz, 3H). 31P NMR(162MHz,DMSO-d6)δ149.43(s),148.59(s).ESI-MS:m / z 759.4[M+H] +

[0321] Example 18: Synthesis of Compound 96

[0322]

[0323] The synthetic route for compound 96 is the same as in Example 2, except that in Example 2, the substrate compound 8 used in the synthesis of compound 13 was changed to compound 88. The remaining steps are similar to those in Example 2. The NMR data of the obtained nucleoside compound 96 are shown below:

[0324] 1 H NMR(400MHz,DMSO-d6)δ11.36(s,1H),7.54–7.16(m,10H),6.96–6.84(m,4H),6.16(t, J=6.8,6.6Hz,1H),5.76(d,J=4.9Hz,1H),4.66–4.41(m,1H),4.16–3.96(m,1H),3.91– 3.71(m,9H),3.16–3.03(m,2H),2.96–2.73(m,2H),2.46–2.11(m,2H),1.56–1.38(m,2 H), 1.23 (dd, J=11.4, 2.2Hz, 3H), 1.13 (dd, J=10.9, 4.2Hz, 9H), 0.83 (t, J=6.7Hz, 3H). 31 P NMR(162MHz,DMSO-d6)δ149.46(s),148.61(s).ESI-MS:m / z 759.4[M+H] +

[0325] Example 19: Synthesis of Compound 100

[0326]

[0327] The synthetic route for compound 100 is the same as in Example 3, except that the substrate compound 8 used in the synthesis of compound 17 in Example 3 is changed to compound 88. The remaining steps are similar to those in Example 3. The NMR data of the obtained nucleoside compound 100 are shown below:

[0328] 1H NMR(400MHz,DMSO-d6)δ11.36(s,1H),7.56–7.17(m,10H),6.94–6.83(m,4H),6.15( t,J=6.8,6.6Hz,1H),5.76(d,J=4.9Hz,1H),4.63–4.46(m,1H),4.10–3.97(m,1H),3. 96–3.74(m,9H),3.14–3.01(m,2H),2.96–2.70(m,2H),2.46–2.10(m,2H),1.64–1.31 (m,4H),1.15(dd,J=10.9,4.2Hz,9H),0.91(t,J=13.5Hz,3H),0.84(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.37(s),148.42(s).ESI-MS:m / z 773.4[M+H] +

[0329] Example 20: Synthesis of Compound 104

[0330]

[0331] The synthetic route for compound 104 is the same as in Example 4, except that the substrate compound 8 used in the synthesis of compound 21 is changed to compound 88. The remaining steps are similar to those in Example 4. The NMR data of the obtained nucleoside compound 104 are shown below:

[0332] 1 H NMR(400MHz,DMSO-d6)δ11.35(s,1H),7.55–7.15(m,10H),6.95–6.85(m,4H),6.13( t,J=6.8,6.6Hz,1H),5.72(d,J=4.9Hz,1H),4.61–4.45(m,1H),4.11–3.96(m,1H),3. 95–3.76(m,9H),3.16–3.00(m,2H),2.95–2.71(m,2H),2.47–2.11(m,2H),1.65–1.32 (m,4H),1.16(dd,J=10.9,4.2Hz,9H),0.90(t,J=13.5Hz,3H),0.83(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.39(s),148.45(s).ESI-MS:m / z 773.4[M+H] +

[0333] Example 21: Synthesis of Compound 108

[0334]

[0335] The synthetic route for compound 108 is the same as in Example 5, except that in Example 5, the substrate compound 8 used to synthesize compound 25 was changed to compound 88. The remaining steps are similar to those in Example 5. The NMR data of the obtained nucleoside compound 108 are shown below:

[0336] 1 H NMR(400MHz,DMSO-d6)δ11.35(s,1H),7.56–7.17(m,10H),6.93–6.84(m,4H),6. 15(t,J=6.8,6.6Hz,1H),5.78(d,J=4.9Hz,1H),4.62–4.42(m,1H),4.37–4.27(m, 1H),4.16–3.97(m,1H),3.92–3.74(m,9H),3.15–3.00(m,2H),2.91–2.70(m,2H), 2.27–1.94(m,2H),1.54–1.35(m,2H),1.14–0.88(m,15H),0.84(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.35(s),148.50(s).ESI-MS:m / z 787.4[M+H] +

[0337] Example 22: Synthesis of Compound 112

[0338]

[0339] The synthetic route for compound 112 is the same as in Example 6, except that in Example 6, the substrate compound 8 used in the synthesis of compound 29 was changed to compound 88. The remaining steps are similar to those in Example 6. The NMR data of the obtained nucleoside compound 112 are shown below:

[0340] 1H NMR(400MHz,DMSO-d6)δ11.35(s,1H),7.57–7.17(m,10H),6.93–6.81(m,4H),6. 11(t,J=6.8,6.6Hz,1H),5.78(d,J=4.9Hz,1H),4.62–4.41(m,1H),4.37–4.25(m, 1H),4.15–3.97(m,1H),3.94–3.74(m,9H),3.15–3.00(m,2H),2.92–2.70(m,2H), 2.26–1.90(m,2H),1.54–1.37(m,2H),1.14–0.89(m,15H),0.84(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.40(s),148.58(s).ESI-MS:m / z 787.4[M+H] +

[0341] Example 23: Synthesis of Compound 116

[0342]

[0343] The synthetic route for compound 116 is the same as in Example 7, except that in Example 7, the substrate compound 8 used in the synthesis of compound 33 was changed to compound 88. The remaining steps are similar to those in Example 7. The NMR data of the obtained nucleoside compound 116 are shown below:

[0344] 1 H NMR(400MHz,DMSO-d6)δ11.38(s,1H),7.56–7.10(m,10H),6.91–6.82(m,5H),6.13 (t,J=6.8,6.6Hz,1H),5.76(d,J=4.9Hz,1H),5.43–5.00(m,2H),4.63–4.40(m,1H), 4.10–3.97(m,1H),3.95–3.71(m,9H),3.16–3.00(m,2H),2.95–2.70(m,2H),2.27–1 .91(m,2H),1.56–1.32(m,2H),1.15(dd,J=10.9,4.2Hz,9H),0.84(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.29(s),148.35(s).ESI-MS:m / z 771.4[M+H] +

[0345] Example 24: Synthesis of Compound 120

[0346]

[0347] The synthetic route for compound 120 is the same as in Example 8, except that the substrate compound 8 used in the synthesis of compound 37 in Example 8 is changed to compound 88. The remaining steps are similar to those in Example 8. The NMR data of the obtained nucleoside compound 120 are shown below:

[0348] 1 H NMR(400MHz,DMSO-d6)δ11.35(s,1H),7.55–7.11(m,10H),6.95–6.83(m,5H),6.15 (t,J=6.8,6.6Hz,1H),5.73(d,J=4.9Hz,1H),5.42–5.01(m,2H),4.65–4.43(m,1H), 4.15–3.98(m,1H),3.94–3.72(m,9H),3.13–3.01(m,2H),2.95–2.71(m,2H),2.28–1 .92(m,2H),1.54–1.31(m,2H),1.13(dd,J=10.9,4.2Hz,9H),0.83(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.33(s),148.44(s).ESI-MS:m / z 771.4[M+H] +

[0349] Example 25: Synthesis of Compound 124

[0350]

[0351] The synthetic route for compound 124 is the same as in Example 9, except that in Example 9, the substrate compound 8 used in the synthesis of compound 41 was changed to compound 88. The remaining steps are similar to those in Example 9. The NMR data of the obtained nucleoside compound 124 are shown below:

[0352] 1H NMR(400MHz,DMSO-d6)δ11.36(s,1H),7.57–7.18(m,10H),6.99–6.84(m,4H),6.13 (t,J=6.8,6.6Hz,1H),5.76(d,J=4.9Hz,1H),4.61–4.43(m,1H),4.13–3.93(m,1H), 3.93–3.71(m,9H),3.53-3.35(m,1H),3.12–3.00(m,2H),2.91–2.70(m,2H),2.28–1 .91(m,2H),1.51–1.31(m,2H),1.12(dd,J=10.9,4.2Hz,9H),0.82(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.41(s),148.53(s).ESI-MS:m / z 769.3[M+H] +

[0353] Example 26: Synthesis of Compound 128

[0354]

[0355] The synthetic route for compound 128 is the same as in Example 10, except that in Example 10, the substrate compound 8 used to synthesize compound 45 was changed to compound 88. The remaining steps are similar to those in Example 10. The NMR data of the obtained nucleoside compound 128 are shown below:

[0356] 1 H NMR(400MHz,DMSO-d6)δ11.38(s,1H),7.58–7.17(m,10H),6.98–6.88(m,4H),6.14 (t,J=6.8,6.6Hz,1H),5.74(d,J=4.9Hz,1H),4.64–4.44(m,1H),4.18–3.94(m,1H), 3.98–3.74(m,9H),3.54-3.38(m,1H),3.14–3.00(m,2H),2.94–2.74(m,2H),2.24–1 .90(m,2H),1.54–1.30(m,2H),1.14(dd,J=10.9,4.2Hz,9H),0.84(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.44(s),148.57(s).ESI-MS:m / z 769.3[M+H] +

[0357] Example 27: Synthesis of Compound 132

[0358]

[0359] The synthetic route for compound 132 is the same as in Example 11, except that the substrate compound 8 used in the synthesis of compound 49 in Example 11 is changed to compound 88. The remaining steps are similar to those in Example 11. The NMR data of the obtained nucleoside compound 132 are shown below:

[0360] 1 H NMR(400MHz,DMSO-d6)δ11.36(s,1H),7.55–7.11(m,15H),6.91–6.86(m,4H),6.13 (t,J=6.8,6.6Hz,1H),5.72(d,J=4.9Hz,1H),4.74–4.43(m,1H),4.37–4.27(m,1H), 4.12–3.97(m,1H),3.91–3.75(m,9H),3.16–3.03(m,2H),2.97–2.72(m,2H),2.24–1 .91(m,2H),1.56–1.38(m,2H),1.13(dd,J=10.9,4.2Hz,9H),0.84(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.41(s),148.53(s).ESI-MS:m / z 821.4[M+H] +

[0361] Example 28: Synthesis of Compound 136

[0362]

[0363] The synthetic route for compound 136 is the same as in Example 12, except that in Example 12, the substrate compound 8 used in the synthesis of compound 53 was changed to compound 88. The remaining steps are similar to those in Example 12. The NMR data of the obtained nucleoside compound 136 are shown below:

[0364] 1H NMR(400MHz,DMSO-d6)δ11.35(s,1H),7.56–7.10(m,15H),6.92–6.87(m,4H),6.14 (t,J=6.8,6.6Hz,1H),5.73(d,J=4.9Hz,1H),4.75–4.44(m,1H),4.37–4.22(m,1H), 4.11–3.96(m,1H),3.90–3.74(m,9H),3.13–3.02(m,2H),2.98–2.71(m,2H),2.23–1 .90(m,2H),1.57–1.37(m,2H),1.14(dd,J=10.9,4.2Hz,9H),0.83(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.42(s),148.58(s).ESI-MS:m / z 821.4[M+H] +

[0365] Example 29: Synthesis of Compound 140

[0366]

[0367] The synthetic route for compound 140 is the same as in Example 13, except that the substrate compound 8 used in the synthesis of compound 57 in Example 13 is changed to compound 88. The remaining steps are similar to those in Example 13. The NMR data of the obtained nucleoside compound 140 are shown below:

[0368] 1 H NMR(400MHz,DMSO-d6)δ11.36(s,1H),7.56–7.18(m,15H),6.91–6.86(m,4H), 6.12(t,J=6.8,6.6Hz,1H),5.72(d,J=4.9Hz,1H),4.62–4.41(m,1H),4.35–4.2 7(m,1H),3.95–3.73(m,9H),3.14–3.00(m,2H),2.90–2.55(m,4H),2.21–1.91( m,2H),1.54–1.38(m,2H),1.13(dd,J=10.9,4.2Hz,9H),0.84(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.41(s),148.52(s).ESI-MS:m / z 835.4[M+H] +

[0369] Example 30: Synthesis of Compound 144

[0370]

[0371] The synthetic route for compound 144 is the same as in Example 14, except that the substrate compound 8 used in the synthesis of compound 61 is changed to compound 88. The remaining steps are similar to those in Example 14. The NMR data of the obtained nucleoside compound 144 are shown below:

[0372] 1 H NMR(400MHz,DMSO-d6)δ11.33(s,1H),7.53–7.17(m,15H),6.92–6.85(m,4H), 6.13(t,J=6.8,6.6Hz,1H),5.73(d,J=4.9Hz,1H),4.61–4.42(m,1H),4.31–4.2 3(m,1H),3.91–3.72(m,9H),3.14–3.01(m,2H),2.91–2.56(m,4H),2.21–1.90( m,2H),1.54–1.37(m,2H),1.12(dd,J=10.9,4.2Hz,9H),0.83(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.43(s),148.58(s).ESI-MS:m / z 835.4[M+H] +

[0373] Example 31: Synthesis of Compound 156

[0374]

[0375] The synthetic route for compound 156 is the same as in Example 1, except that the substrate uridine used in the synthesis of compound 2 is changed to 2'-O-(2-methoxyethyl)uridine. The remaining steps are similar to those in Example 1. The NMR data of the obtained nucleoside compound 156 are shown below:

[0376] 1H NMR(400MHz,DMSO-d6)δ11.39(s,1H),7.55–7.20(m,10H),6.90–6.81(m,4H),5.79(d,J=4.9Hz ,1H),5.62(dd,J=8.1,2.2Hz,1H),4.61–4.42(m,1H),4.34–4.28(m,1H),4.10–3.97(m,1H),3. 95–3.73(m,9H),3.57–3.51(m,4H),3.42(s,3H),3.13–3.01(m,2H),2.92–2.71(m,2H),1.55–1 .38(m,2H),1.25(dd,J=11.4,2.2Hz,3H),1.13(dd,J=10.9,4.2Hz,9H),0.83(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.42(s),148.59(s).ESI-MS:m / z 833.4[M+H] +

[0377] Example 32: Synthesis of Compound 160

[0378]

[0379] The synthetic route for compound 160 is the same as in Example 2, except that the substrate compound 8 used in the synthesis of compound 13 in Example 2 is changed to compound 152. The remaining steps are similar to those in Example 2. The NMR data of the obtained nucleoside compound 160 are shown below:

[0380] 1 H NMR(400MHz,DMSO-d6)δ11.38(s,1H),7.58–7.21(m,10H),6.92–6.80(m,4H),5.78(d,J=4.9Hz ,1H),5.60(dd,J=8.1,2.2Hz,1H),4.60–4.41(m,1H),4.35–4.27(m,1H),4.11–3.97(m,1H),3. 94–3.70(m,9H),3.54–3.47(m,4H),3.40(s,3H),3.12–3.00(m,2H),2.90–2.70(m,2H),1.54–1 .37(m,2H),1.23(dd,J=11.4,2.2Hz,3H),1.12(dd,J=10.9,4.2Hz,9H),0.82(t,J=6.7Hz,3H). 31P NMR(162MHz,DMSO-d6)δ149.44(s),148.60(s).ESI-MS:m / z 833.4[M+H] +

[0381] Example 33: Synthesis of Compound 172

[0382]

[0383] The synthetic route for compound 172 is the same as in Example 1, except that the substrate uridine used in the synthesis of compound 2 is changed to 2'-O-[2-(methylamino)-2-oxoethyl]-uridine. The remaining steps are similar to those in Example 1. The NMR data of the obtained nucleoside compound 172 are shown below:

[0384] 1 H NMR(400MHz,DMSO-d6)δ11.35(s,1H),7.85–7.78(m,1H)7.55–7.18(m,10H),6.90–6.85(m,4H ),5.72(d,J=4.9Hz,1H),5.60(dd,J=8.1,2.2Hz,1H),4.60–4.41(m,1H),4.34–4.29(m,1H),4. 10–3.98(m,1H),3.95–3.75(m,9H),3.47(s,2H),3.15–3.01(m,2H),2.92–2.70(m,5H),1.55–1 .38(m,2H),1.23(dd,J=11.4,2.2Hz,3H),1.12(dd,J=10.9,4.2Hz,9H),0.83(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.44(s),148.58(s).ESI-MS:m / z 846.4[M+H] +

[0385] Example 34: Synthesis of Compound 176

[0386]

[0387] The synthetic route for compound 176 is the same as in Example 2, except that the substrate compound 8 used in the synthesis of compound 13 in Example 2 is changed to compound 168. The remaining steps are similar to those in Example 2. The NMR data of the obtained nucleoside compound 176 are shown below:

[0388] 1H NMR(400MHz,DMSO-d6)δ11.33(s,1H),7.84–7.79(m,1H)7.55–7.18(m,10H),6.90–6.85(m,4H ),5.75(d,J=4.9Hz,1H),5.62(dd,J=8.1,2.2Hz,1H),4.60–4.41(m,1H),4.36–4.28(m,1H),4. 10–3.98(m,1H),3.97–3.77(m,9H),3.47(s,2H),3.15–3.01(m,2H),2.92–2.71(m,5H),1.53–1 .37(m,2H),1.23(dd,J=11.4,2.2Hz,3H),1.13(dd,J=10.9,4.2Hz,9H),0.83(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.48(s),148.59(s).ESI-MS:m / z 846.4[M+H] +

[0389] Example 35: Synthesis of Compound 190

[0390]

[0391] Synthesis of compound 178:

[0392] The dried compound 177 (20.00 g, 81.90 mmol, 1.0 eq.) was dissolved in ultra-dry DMF (200 mL). Diphenyl carbonate (21.05 g, 98.28 mmol, 1.2 eq.) and sodium bicarbonate (0.55 g, 6.55 mmol, 0.08 eq.) were added to the reaction system, and the reaction mixture was heated to 100 °C and stirred for 4 hours. TLC and LCMS analysis showed that compound 177 reacted completely. After cooling the reaction system to room temperature, the reaction mixture was added dropwise to methyl tert-butyl ether (2.0 L), stirred for 15 minutes, filtered as a solid, dispersed in methanol (200 mL), and stirred for 15 minutes. The solid was filtered and dried under vacuum to give compound 178 (14.97 g, 65.60 mmol, 80.10% yield). ESI-MS: m / z 229.1 [M+H] +

[0393] Synthesis of compound 179:

[0394] The dried compound 178 (14.97 g, 65.60 mmol, 1.0 eq.) was dissolved in ultra-dry DMF (150 mL). Sodium methoxide (17.01 g, 314.88 mmol, 4.8 eq.) was added to the reaction system, and the mixture was stirred at room temperature for 1 hour. TLC and LCMS analysis showed that compound 178 reacted completely. The pH was adjusted to approximately 7 with 1 mol / L hydrochloric acid aqueous solution. The mixture was filtered, and the filtrate was concentrated to obtain crude product 179. Crude product 179 was subjected to column chromatography (DCM / MeOH = 15 / 1) to obtain compound 179 (15.68 g, 60.72 mmol, 92.56% yield). ESI-MS: m / z 259.1 [M+H] +

[0395] The subsequent synthesis steps of compound 190 are the same as in Example 1, except that the substrate uridine used in the synthesis of compound 2 from compound 1 in Example 1 is changed to compound 179. The remaining steps are similar to those in Example 1. The NMR data of the obtained nucleoside compound 190 are shown below:

[0396] 1 H NMR (400MHz, DMSO-d6) δ11.38(s,1H),7.58–7.20(m,10H),6.93–6.85(m,4H),5.77(d,J=4 .9Hz,1H),5.62(dd,J=8.1,2.2Hz,1H),4.61–4.42(m,1H),4.35–4.28(m,1H),4.10–3.97( m,1H),3.95–3.74(m,9H),3.42(s,3H),3.15–3.01(m,2H),2.92–2.71(m,2H),1.55–1.38( m,2H),1.23(dd,J=11.4,2.2Hz,3H),1.13(dd,J=10.9,4.2Hz,9H),0.83(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ150.51(s),149.33(s).ESI-MS:m / z 789.4[M+H] +

[0397] Example 36: Synthesis of Compound 190

[0398]

[0399] The synthetic route for compound 194 is the same as in Example 2, except that the substrate compound 8 used in the synthesis of compound 13 in Example 2 is changed to compound 186. The remaining steps are similar to those in Example 2. The NMR data of the obtained nucleoside compound 194 are shown below:

[0400] 1 H NMR (400MHz, DMSO-d6) δ11.37(s,1H),7.55–7.21(m,10H),6.95–6.83(m,4H),5.78(d,J=4 .9Hz,1H),5.61(dd,J=8.1,2.2Hz,1H),4.62–4.43(m,1H),4.34–4.29(m,1H),4.11–3.96( m,1H),3.93–3.71(m,9H),3.41(s,3H),3.13–3.03(m,2H),2.93–2.73(m,2H),1.54–1.37( m,2H),1.24(dd,J=11.4,2.2Hz,3H),1.15(dd,J=10.9,4.2Hz,9H),0.84(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ150.48(s),149.30(s).ESI-MS:m / z 789.4[M+H] +

[0401] Example 37: Synthesis of Compound 197

[0402]

[0403] Synthesis of compound 191:

[0404] Compound 5 (15.00 g, 40.49 mmol, 1.0 eq.) was dissolved in ultra-dry THF (150 mL). The reaction system was cooled to -20 °C and stirred at this temperature for 20 minutes. The entire reaction was carried out under nitrogen protection. Subsequently, 1.0 mol / L methyl magnesium bromide solution (121.47 mL, 121.47 mmol, 3.0 eq.) was slowly added dropwise. After the addition was complete, the mixture was brought back to room temperature and stirred. TLC and LCMS analysis showed that compound 8 reacted completely. The reaction was quenched by adding saturated ammonium chloride solution. The mixture was extracted twice with ethyl acetate, and the organic phases were combined and washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 191. Crude product 191 was subjected to column chromatography (PE / EA = 2 / 3) to obtain compound 191 (8.60 g, 22.25 mmol, 54.95% yield). ESI-MS: m / z 387.2 [M+H] +

[0405] Synthesis of compound 192:

[0406] The dried compound 191 (8.60 g, 22.25 mmol, 1.0 eq.) was dissolved in ultra-dry acetonitrile (90 mL). 2-Iodobenzoic acid (13.71 g, 48.95 mmol, 2.2 eq.) was added to the reaction system. The reaction system was placed in an oil bath and heated to 80 °C, and stirred at this temperature for 2 hours. The entire reaction was carried out under nitrogen protection. TLC and LCMS analysis showed that compound 191 reacted completely. The reaction mixture was removed from the oil bath and cooled to 0 °C. Insoluble matter was removed by filtration, and the filtrate was concentrated to obtain crude compound 192. Crude compound 192 was subjected to column chromatography (PE / EA = 2 / 3) to obtain compound 192 (7.49 g, 19.48 mmol, 87.55% yield). ESI-MS: m / z 385.2 [M+H] +

[0407] Synthesis of compound 193:

[0408] Methyltriphenylphosphine bromide (15.31 g, 42.86 mmol, 2.2 eq.) was dissolved in ultradry THF (150 mL). The reaction system was cooled to 0 °C and stirred continuously for 30 minutes. Potassium tert-butoxide (4.81 g, 42.86 mmol, 2.2 eq.) was added. After the addition was complete, the reaction was stirred at 0 °C for 20 minutes. Then, a THF solution of compound 192 (7.49 g, 19.48 mmol, 1.0 eq.) in 80 mL was slowly added dropwise. After the addition was complete, the ice bath was removed and the reaction was stirred at a lower temperature. TLC and LCMS analysis showed that compound 192 reacted completely. The reaction system was concentrated to remove some THF, and then extracted twice with ethyl acetate solution. The organic phases were combined and washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 193. Crude product 193 was then subjected to column chromatography (PE / EA = 1 / 1) to give compound 193 (5.85 g, 15.29 mmol, 78.49% yield). ESI-MS: m / z 383.2 [M+H] +

[0409] Synthesis of compound 194:

[0410] Compound 193 (5.85 g, 15.29 mmol, 1.0 eq.) was dried and dissolved in ultra-dry THF (60 mL). 0.5 mol / L 9-boronbicyclo[3.3.1]nonane (91.74 mL, 45.87 mmol, 3.0 eq.) was added, and the mixture was stirred overnight at room temperature. TLC and LCMS analysis showed that compound 193 reacted completely. The reaction system was cooled to 0 °C and stirred continuously for 30 minutes. Methanol (60 mL) and water (90 mL) were slowly added, followed by sodium perborate tetrahydrate (11.76 g, 76.45 mmol, 5.0 eq.). After the addition was complete, the ice bath was removed, and the reaction was stirred overnight. TLC and LCMS analysis showed that the intermediate was completely consumed. The system was filtered and concentrated to remove some of the solvent. Water was added, and the mixture was extracted twice with dichloromethane. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 194. Crude product 194 was subjected to column chromatography (PE / EA = 2 / 3) to give compound 194 (1.38 g, 3.45 mmol, 22.56% yield). (TLC:R) f =0.40, PE / EA=1 / 3). ESI-MS:m / z 401.2[M+H] +

[0411] Synthesis of compound 195:

[0412] Compound 194 (1.38 g, 3.45 mmol, 1.0 eq.) was dried and dissolved in ultradry pyridine (15 mL). DMTrCl (1.40 g, 4.14 mmol, 1.2 eq.) was added, and the mixture was stirred overnight at room temperature. TLC and LCMS analysis showed that compound 194 reacted completely. Water was added to the reaction mixture, and the mixture was extracted twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 195 (2.05 g), which was used directly in the next step. ESI-MS: m / z 703.3 [M+H] +

[0413] Synthesis of compound 196:

[0414] Crude compound 195 (2.05 g) was dissolved in THF (20 mL), and 1.0 mol / L TBAF solution (4.14 mL, 4.14 mmol, 1.2 eq.) was added to the reaction system. The reaction was allowed to proceed overnight at room temperature. TLC analysis showed that compound 195 reacted completely. Water was added to the reaction system, followed by extraction twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 196. Crude compound 196 was subjected to column chromatography (PE / EA = 2 / 3) to give compound 196 (1.35 g, 2.29 mmol, overall yield: 66.38%). ESI-MS: m / z 589.3 [M+H] +

[0415] Synthesis of compound 195:

[0416] Compound 196 (1.35 g, 2.29 mmol, 1.0 eq.) was dissolved in ultra-dry DCM (15 mL). DCI (243 mg, 2.06 mmol, 0.9 eq.) was added to the reaction system, and after purging with nitrogen, bis(diisopropylamino)(2-cyanoethoxy)phosphine (0.83 g, 2.75 mmol, 1.2 eq.) was added. The reaction was carried out at room temperature for 30 minutes. TLC analysis showed that compound 196 reacted completely. A saturated aqueous sodium bicarbonate solution was added to the reaction system, followed by extraction with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude 196. Crude 196 was then subjected to column chromatography (PE / EA = 1 / 1) to obtain compound 196 (1.30 g, 1.65 mmol, 72.05% yield). 1 H NMR (400MHz, DMSO-d6) δ11.36 (s, 1H), 7.55–7.17 (m, 10H), 6.91–6.86 (m, 4H), 5.78 (d, J = 4. 9Hz,1H),5.61(dd,J=8.1,2.2Hz,1H),4.62–4.42(m,1H),4.35–4.27(m,1H),4.12–3.99(m, 1H),3.96–3.74(m,8H),3.59–3.13(m,5H),3.13–3.01(m,2H),2.91–2.72(m,2H),2.37–2.0 2(m,1H),1.23(dd,J=11.4,2.2Hz,3H),1.14(dd,J=10.9,4.2Hz,9H),0.85(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.38(s),148.41(s).ESI-MS:m / z789.4[M+H] +

[0417] Example 38: Synthesis of Compound 201

[0418]

[0419] Synthesis of compound 198:

[0420] Compound 193 (10.00 g, 26.14 mmol, 1.0 eq.) was dried and dissolved in ultra-dry THF (100 mL). 0.5 mol / L 9-boronbicyclo[3.3.1]nonane (156.84 mL, 78.42 mmol, 3.0 eq.) was added, and the mixture was stirred overnight at room temperature. TLC and LCMS analysis showed that compound 193 reacted completely. The reaction system was cooled to 0 °C and stirred continuously for 30 minutes. Methanol (100 mL) and water (150 mL) were slowly added, followed by sodium perborate tetrahydrate (20.11 g, 130.70 mmol, 5.0 eq.). After the addition was complete, the ice bath was removed, and the reaction was stirred overnight. TLC and LCMS analysis showed that the intermediate was completely consumed. The system was filtered and concentrated to remove some of the solvent. Water was added, and the mixture was extracted twice with dichloromethane. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 198. Crude product 198 was subjected to column chromatography (PE / EA = 2 / 3) to give compound 198 (2.11 g, 5.27 mmol, 20.16% yield). (TLC:R) f =0.37, PE / EA=1 / 3). ESI-MS:m / z 401.2[M+H] +

[0421] Synthesis of compound 199:

[0422] Compound 198 (2.11 g, 5.27 mmol, 1.0 eq.) was dried and dissolved in ultradry pyridine (20 mL). DMTrCl (2.14 g, 6.32 mmol, 1.2 eq.) was added, and the mixture was stirred overnight at room temperature. TLC and LCMS analysis showed that compound 198 reacted completely. Water was added to the reaction mixture, and the mixture was extracted twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude product 199 (3.35 g), which was used directly in the next step. ESI-MS: m / z 703.3 [M+H] +

[0423] Synthesis of compound 200:

[0424] Crude compound 199 (3.35 g) was dissolved in THF (35 mL), and 1.0 mol / L TBAF solution (6.32 mL, 6.32 mmol, 1.2 eq.) was added to the reaction system. The reaction was allowed to proceed overnight at room temperature. TLC analysis showed that compound 199 reacted completely. Water was added to the reaction system, followed by extraction twice with ethyl acetate. The combined organic phases were washed with water and saturated brine. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 200. Crude compound 200 was subjected to column chromatography (PE / EA = 2 / 3) to give compound 200 (2.20 g, 3.74 mmol, overall yield: 70.97%). ESI-MS: m / z 589.3 [M+H] +

[0425] Synthesis of compound 201:

[0426] Compound 200 (2.20 g, 3.74 mmol, 1.0 eq.) was dissolved in ultra-dry DCM (25 mL). DCI (398 mg, 3.37 mmol, 0.9 eq.) was added to the reaction system, and after purging with nitrogen, bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.35 g, 4.49 mmol, 1.2 eq.) was added. The reaction was carried out at room temperature for 30 minutes. TLC analysis showed that compound 200 reacted completely. A saturated aqueous sodium bicarbonate solution was added to the reaction system, followed by extraction with dichloromethane. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain crude compound 201. Crude compound 201 was subjected to column chromatography (PE / EA = 1 / 1) to obtain compound 201 (2.28 g, 2.89 mmol, 77.27% yield). 1 H NMR (400MHz, DMSO-d6) δ11.35 (s, 1H), 7.56–7.18 (m, 10H), 6.92–6.85 (m, 4H), 5.75 (d, J = 4. 9Hz,1H),5.62(dd,J=8.1,2.2Hz,1H),4.63–4.41(m,1H),4.31–4.25(m,1H),4.11–3.98(m, 1H),3.95–3.75(m,8H),3.55–3.15(m,5H),3.11–3.00(m,2H),2.90–2.71(m,2H),2.35–2.0 1(m,1H),1.24(dd,J=11.4,2.2Hz,3H),1.13(dd,J=10.9,4.2Hz,9H),0.83(t,J=6.7Hz,3H). 31 P NMR(162MHz,DMSO-d6)δ149.36(s),148.42(s).ESI-MS:m / z789.4[M+H] +

[0427] Example 39: Synthesis of Compound 217 (EX000-H)

[0428]

[0429] Synthesis of compound 203:

[0430] The dried compound 202 (63.3 g, 151.3 mmol, 1.0 eq.) (Biode, Lot.: DPP170) was dissolved in 300 mL of ultra-dry toluene, and N2 was replaced three times. The reaction system was then cooled to -78 °C, and DIBAL-H (32.3 g, 226.9 mmol, 1.5 eq.) was slowly added dropwise. After the addition was complete, the reaction continued at -78 °C. TLC monitoring after 1 hour showed that compound 1 was completely consumed. Post-treatment: The reaction was quenched by adding 15 mL of acetone at -78 °C, and then the reaction system was warmed to room temperature. 180 mL of 2.5 N HCl and 270 mL of water were added, followed by extraction three times with ethyl acetate. The organic phases were combined and washed with saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain crude compound 203 (59.5 g). This was used directly in the next reaction. ESI-MS: m / z 421.5 [M+H] +

[0431] Synthesis of compound 204:

[0432] Crude compound 203 (59.5 g, 141.5 mmol, 1.0 eq.) was dissolved in 600 mL of ultra-dry DCM, and N2 was replaced three times. Then, Et3SiH (49.3 g, 424.5 mmol, 3.0 eq.) was added, and the reaction system was cooled to -78 °C. Then, boron trifluoride diethyl ether (40.1 g, 283.0 mmol, 2.0 eq.) was added. After the addition was complete, the reaction was continued at -78 °C. After 20 hours of reaction, TLC monitoring showed that the starting material was completely consumed. Post-processing: The reaction was quenched by slowly adding 200 mL of saturated NaHCO3 aqueous solution to the reaction system at room temperature. Then, the mixture was extracted three times with DCM. The organic phases were combined and washed with saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain crude compound 204. The crude compound 3 was purified by column chromatography (18% ethyl acetate in petroleum ether) to give compound 204 (32.0 g, 79.1 mmol, overall two-step yield: 56.0%). ESI-MS: m / z 405.5 [M+H] +

[0433] Synthesis of compound 205:

[0434] Compound 204 (32.0 g, 79.1 mmol, 1.0 eq.) was dissolved in 200 mL of methanol. Palladium on carbon (1.7 g, 15.9 mmol, 0.2 eq.) was then added to the system, followed by three H2 substitutions. The reaction was then carried out at room temperature. After 15 hours of reaction, TLC monitoring showed that compound 204 was completely consumed. Post-processing: The solution was directly filtered through diatomaceous earth, and the filtrate was collected and concentrated under empty air to obtain crude compound 205 (11.6 g). This was used directly in the next reaction. ESI-MS: m / z 135.1 [M+H] +

[0435] Synthesis of compound 206:

[0436] Crude compound 205 (10.6 g, 79.1 mmol, 1.0 eq.) was dissolved in 150 mL of pyridine. The reaction system was then cooled to 0 °C, and TIPDSCl2 (26.2 g, 83.1 mmol, 1.05 eq.) was slowly added. After the addition was complete, the system was brought back to room temperature. After 15 hours of reaction, TLC monitoring showed that compound 205 had been completely consumed. Post-processing: The solvent was first removed by vacuum concentration, and then 200 mL of saturated NaHCO3 aqueous solution was added to the oily crude product. The product was then extracted three times with ethyl acetate. The organic phases were combined and washed with saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain crude compound 206. Crude compound 206 was purified by column chromatography (20% ethyl acetate in petroleum ether) to obtain compound 206 (17.8 g, 47.3 mmol, overall yield: 60%). ESI-MS: m / z 377.7 [M+H] +

[0437] Synthesis of compound 207:

[0438] Compound 206 (12.8 g, 34.0 mmol, 1.0 eq) was dissolved in 200 mL of ultra-dry DMF. The reaction system was then cooled to 0 °C. NaH (2.04 g, 51.0 mmol, 1.5 eq.) was added in two batches over 20 min. After the addition was complete, the reaction was continued at 0 °C for another 20 min. Then, iodomethane (9.65 g, 68.0 g, 2.0 eq.) was added. After the addition was complete, the reaction was brought to room temperature. After 2 hours of reaction, TLC monitoring showed that compound 206 was completely consumed. Post-processing: The reaction system was first cooled to 0℃, then 50 mL of saturated NH4Cl aqueous solution was slowly added dropwise to quench the reaction. The mixture was then extracted three times with ethyl acetate. The organic phases were combined and washed with saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain crude compound 207. Crude compound 207 was purified by column chromatography (10% ethyl acetate in petroleum ether) to obtain compound 207 (10.6 g, 27.1 mmol, 80% yield). ESI-MS: m / z 391.7 [M+H] +

[0439] Synthesis of compound 208:

[0440] Compound 207 (11.6 g, 29.7 mmol, 1.0 eq) was dissolved in 100 mL of ultradry THF, followed by the addition of 1 M TBAF (11.65 g, 44.5 mmol, 1.5 eq.). The mixture was stirred at room temperature. After 16 hours of reaction, TLC monitoring showed complete consumption of compound 207. Post-treatment: direct vacuum concentration yielded crude compound 208, which was then purified by column chromatography (10% methanol in dichloroform) to obtain compound 208 (4.3 g, 29.0 mmol, 98% yield). ESI-MS: m / z 149.2 [M+H] +

[0441] Synthesis of compound 209:

[0442] Compound 208 (4.3 g, 29.0 mmol, 1.0 eq.) was dissolved in 30 mL of pyridine, followed by the addition of DMTrCl (9.8 g, 31.9 mmol, 1.1 eq.). The reaction was allowed to proceed at room temperature. After 1.5 hours, TLC monitoring showed complete consumption of compound 208. Post-treatment: The reaction was quenched at room temperature by adding 40 mL of saturated NaHCO3 aqueous solution, followed by extraction three times with ethyl acetate. The organic phases were combined and washed with saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain crude compound 209. Crude compound 209 was purified by column chromatography (30% ethyl acetate in petroleum ether) to obtain compound 209 (10.1 g, 22.4 mmol, 77% yield). ESI-MS: m / z 451.5 [M+H] +

[0443] Synthesis of compound 210:

[0444] Compound 209 (4.1 g, 9.1 mmol, 1.0 eq.) was dissolved in 40 mL of ultra-dry DMF. Imidazole (3.1 g, 45.5 mmol, 5.0 eq.) was then added to the reaction system with stirring, followed by the addition of TBSCl (3.4 g, 22.8 mmol, 2.5 eq.). After the addition was complete, the reaction was allowed to proceed at room temperature. TLC monitoring after 2 hours showed that compound 209 had been completely consumed. Post-treatment: At room temperature, 40 mL of water was added to the reaction system to quench the reaction, followed by extraction three times with ethyl acetate. The combined organic phases were washed with saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain crude compound 210. Crude compound 210 was purified by column chromatography (10% ethyl acetate in petroleum ether) to obtain compound 210 (4.8 g, 8.5 mmol, 93% yield). ESI-MS: m / z 565.8 [M+H] +

[0445] Synthesis of compound 211:

[0446] Compound 210 (4.8 g, 8.5 mmol, 1.0 eq.) and Et3SiH (2.47 g, 21.2 mmol, 2.5 eq.) were dissolved in 40 mL of ultra-dry DCM. The system was then cooled to 0 °C, and dichloroacetic acid (5.5 g, 42.5 mmol, 5.0 eq.) was slowly added dropwise at 0 °C. After the addition was complete, the reaction was continued at 0 °C. After 20 min of reaction, TLC monitoring showed that compound 210 was completely consumed. The reaction was quenched by adding 10 mL of ammonia water dropwise at 0 °C, followed by extraction three times with DCM. The organic phases were combined and washed with saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain crude compound 211. Crude compound 211 was purified by column chromatography (40% ethyl acetate in petroleum ether) to obtain compound 211 (1.7 g, 6.5 mmol, 76% yield). ESI-MS: m / z 263.4 [M+H]+

[0447] Synthesis of compound 212:

[0448] Compound 211 (1.6 g, 6.1 mmol, 1.0 eq.) was dissolved in 20 mL of ultradry ACN, and then IBX (3.41 g, 12.2 mmol, 2.0 eq.) was added to the reaction system. The reaction mixture was then heated to 80 °C. After 2 hours of reaction, TLC monitoring showed that compound 211 had been completely consumed. The mixture was cooled to room temperature, then filtered to remove insoluble impurities. The filtrate was collected and concentrated under vacuum to obtain crude compound 212 (1.66 g). This crude compound was used directly in the next reaction. ESI-MS: m / z 261.4 [M+H] +

[0449] Synthesis of compound 213:

[0450] Methyltriphenylphosphine bromide (3.48 g, 9.8 mmol, 1.6 eq.) was dissolved in 20 mL of ultra-dry THF. The reaction system was then cooled to 0 °C. 1 M potassium tert-butoxide (1.1 g, 9.8 mmol, 1.6 eq.) was added dropwise to the reaction system at 0 °C. After the addition was complete, the reaction was allowed to proceed at 0 °C for 10 min. Then, compound 232 (1.59 g, 6.1 mmol, 1.0 eq.) was dissolved in 5 mL of THF solution and added to the reaction system at 0 °C. After the addition was complete, the reaction was allowed to proceed at room temperature. After 2 hours of reaction, the reaction was monitored by TLC, and compound 212 was completely consumed. The reaction was quenched by adding 10 mL of saturated NH4Cl aqueous solution to the reaction system under ice bath conditions. The mixture was extracted three times with ethyl acetate, and the combined organic phases were washed with saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain crude compound 213. Crude compound 213 was purified by column chromatography (16% ethyl acetate in petroleum ether) to obtain compound 213 (0.85 g, 3.3 mmol, 54% yield). ESI-MS: m / z 259.4 [M+H] +

[0451] Synthesis of compound 214:

[0452] Compound 213 (0.85 g, 3.3 mmol, 1.0 eq.) was dissolved in 10 mL of ultra-dry THF. The reaction system was then cooled to 0 °C. 9-borabicyclo[3.3.1]nonan-9-yl (2.4 g, 19.7 mmol, 6.0 eq.) was added to the reaction system at 0 °C. After the addition was complete, the system was allowed to return to room temperature. After 16 hours of reaction, TLC monitoring showed that compound 213 was completely consumed. The reaction system was then cooled to 0 °C. 20 mL of a mixed solution of methanol and THF (methanol:THF = 1:1) was slowly added dropwise to the system at 0 °C. Then, 15 mL of water and sodium perborate (12.2 g, 78.9 mmol, 24.0 eq.) were added. After the addition was complete, the reaction was continued at 0 °C. After 24 hours of reaction, TLC monitoring showed that the intermediate was completely consumed. Post-processing: Insoluble impurities were removed by filtration. The filter cake was washed with 20 mL of ethyl acetate, and the filtrate was collected and extracted three times with ethyl acetate. The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain crude compound 214. Crude compound 214 was purified by column chromatography (5% methanol indichloroform) to obtain compound 214 (0.8 g, 2.9 mmol, 88% yield). ESI-MS: m / z 277.5 [M+H] +

[0453] Synthesis of compound 215:

[0454] Compound 214 (0.8 g, 2.9 mmol, 1.0 eq.) was dissolved in 10 mL of ultradry pyridine, followed by the addition of DMTrCl (1.1 g, 3.2 mmol, 1.1 eq.). The reaction was allowed to proceed at room temperature. After 1.5 hours, TLC monitoring showed complete consumption of compound 214. Post-treatment: The reaction was quenched at room temperature by adding 20 mL of saturated NaHCO3 aqueous solution, followed by extraction three times with ethyl acetate. The combined organic phases were washed with saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain crude compound 215. Crude compound 215 was purified by column chromatography (10% ethyl acetate in petroleum ether) to obtain compound 215 (1.48 g, 2.6 mmol, 88% yield). ESI-MS: m / z 579.8 [M+H] +

[0455] Synthesis of compound 216:

[0456] Compound 215 (1.48 g, 2.6 mmol, 1.0 eq) was dissolved in 10 mL of ultradry THF, followed by the addition of 1 M TBAF (1.0 g, 3.9 mmol, 1.5 eq.). The mixture was stirred at room temperature. After 2 hours of reaction, TLC monitoring showed that compound 215 was completely consumed. The solution was directly concentrated under vacuum to obtain crude compound 216. Crude compound 216 was purified by column chromatography (15% ethyl acetate in petroleum ether) to obtain compound 216 (1.1 g, 2.4 mmol, 92% yield). ESI-MS: m / z 465.6 [M+H] +

[0457] Synthesis of compound 217:

[0458] The dried compound 216 (1.0 g, 2.65 mmol, 1.0 eq.) was dissolved in 10 mL of ultra-dry DCM. DIPEA (0.61 g, 4.7 mmol, 2.0 eq.) and DMAP (60 mg, 0.47 mmol, 0.2 eq.) were added to the reaction mixture, followed by nitrogen purging for protection. The reaction system was cooled to 0℃, and CEP-Cl (0.84 g, 3.6 mmol, 1.5 eq.) was slowly added dropwise. After the addition was complete, the reaction was allowed to proceed at room temperature. After 1 hour of reaction, TLC monitoring showed that compound 216 was completely consumed. Post-processing: 10 mL of saturated sodium bicarbonate aqueous solution was added to the reaction system to quench the reaction. The system was extracted three times with dichloromethane, and the organic phases were combined and washed with saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure to obtain crude compound 217. Crude compound 217 was purified by column chromatography (20% ethyl acetate in petroleum ether) to obtain compound 217 (0.7 g, 1.0 mmol, 44% yield). 1 H NMR (400MHz, DMSO-d6) δ7.38-7.34(m,2H),7.29(t,J=8.0Hz,2H),7.24-7.20(m,5H),6.88-6.86(m,4H),3.97-3.91(m,1H),3.87-3.76(m,4H),3 .73(s,6H),3.62-3.56(m,3H),3.33(s,3H),2.03(t,J=8.0Hz,2H),2.80 -2.72(m,2H),1.92-1.82(m,1H),1.65-1.56(m,1H),1.17-1.14(m,12H). 31 PNMR(162MHz,DMSO-d6)δ148.8,148.3.ESI-MS:m / z 665.7[M+H] +

[0459] Example 40: Synthesis of modified nucleoside single-stranded sequences and 3' nuclease stability analysis

[0460] Experiment 1: Synthesis of sequences for in vitro 3' exonuclease stability analysis

[0461] The synthesis of the sequence is no different from the usual phosphoramide solid-phase synthesis method. When synthesizing nucleotides modified at various positions of the SS and AS chains, the original nucleotides of the parent sequence are replaced with the phosphoramide monomers synthesized above.

[0462] The synthesis process is briefly described as follows: Using an LK-48E synthesizer (Lingkun), starting with a Universal CPG carrier, nucleoside phosphoramidamide monomers were linked one by one according to the synthesis program. Except for the synthesis of (EX001-U) to (EX002-U) and (EX000-H) described in this invention, the remaining nucleoside monomer raw materials, deoxythymidine phosphoramidamide nucleoside monomer (dT) and 2'-O-methylRNA (Um), were purchased from Shanghai Zhaowei. 5'-Ethylthio-1H-tetrazole (ETT) was used as the activator (0.6M acetonitrile solution), 0.22M PADS dissolved in a 1:1 volume ratio of trimethylpyridine (Suzhou Kelama) solution was used as the sulfiding agent, and iodopyridine / aqueous solution (Kelama) was used as the oxidizing agent.

[0463] After solid-phase synthesis, the oligonucleotides were cleaved from the solid support and soaked in a 3:1 solution of 28% ammonia and ethanol at 50°C for 16 hours. After centrifugation, the supernatant was transferred to another centrifuge tube, concentrated, and evaporated to dryness. Purification was then performed using C18 reversed-phase chromatography with 0.1M TEAA and acetonitrile as the mobile phase, and DMTr was removed using 3% trifluoroacetic acid solution. The target oligonucleotides were collected, lyophilized, identified as the target product by LCMS, and quantified by UV (260 nm) spectroscopy.

[0464] Table 1: Sequences used for in vitro 3' exonuclease stability analysis

[0465] name sequence(5'→3') EX0512-PO-0000 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTUm EX0512-PO-0001 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdT(EX000-U) EX0512-PO-0002 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdT(EX001-U) EX0512-PO-0003 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdT(EX002-U) EX0512-PO-0040 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTUmUm EX0512-PO-0041 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdT(EX000-U)(EX000-U) EX0512-PO-0042 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdT(EX001-U)(EX001-U) EX0512-PO-0043 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdT(EX002-U)(EX002-U) EX0512-PO-0080 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdT(EX000-H) EX0512-PO-0081 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdT(EX000-H)(EX000-H) EX0512-PS-0000 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTsdTsUm EX0512-PS-0001 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTsdTs(EX000-U) EX0512-PS-0002 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTsdTs(EX001-U) EX0512-PS-0003 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTsdTs(EX002-U) EX0512-PS-0040 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTsUmsUm EX0512-PS-0041 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTs(EX000-U)s(EX000-U) EX0512-PS-0042 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTs(EX001-U)s(EX001-U) EX0512-PS-0043 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTs(EX002-U)s(EX002-U) EX0512-PS-0080 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTsdTs(EX000-H) EX0512-PS-0081 dTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTdTs(EX000-H)s(EX000-H) EX0512-PS-0082 UmsUfsAmUmAmGfAmGmCmAmAmGmAmAfCmAfCmUmGmUmUmsUms(EX000-H) EX0512-PS-0083 UmsUfsAmUmAmGfAmGmCmAmAmGmAmAfCmAfCmUmGmUmUms(EX000-H)s(EX000-H) EX0512-PS-0084 AmsAmsCmAmGmUmGfUmUfCfUfUmGmCmUmCmUmAmUmAmsAms(EX000-H) EX0512-PS-0085 AmsAmsCmAmGmUmGfUmUfCfUfUmGmCmUmCmUmAmUmAmAms(EX000-H)s(EX000-H)

[0466] dT: 2'-deoxythymidine; Um: 2'-OMe-uridine; "m" indicates that the nucleotide adjacent to the left of the letter m is modified with 2'-OMe, "f" indicates that the nucleotide adjacent to the left of the letter f is modified with 2'-F, "s" indicates that the two nucleotides adjacent to the left and right of the letter s are modified with a PS backbone; "(EX001-U)~(EX002-U)" and "(EX000-H)" are nucleotides introduced into the aforementioned nucleotide monomer chain of the present invention; EX000-U are oligonucleotides introduced into the following nucleotide monomer chain:

[0467] Experiment 2: Stability analysis of 3' nucleases containing modified nucleoside single strands

[0468] Oligonucleotides were incubated at 37°C at a concentration of 17.5 mM in a buffer containing 10 mM Tris-HCl (pH 8.0), 2 mM MgCl2, and Snake Venom phosphodiesterase I (20 mU / mL). Immediately after mixing with the enzyme, a 200 pM sample was collected as an approximate sample at approximately T = 0 minutes. At each time point (0.5, 1, 2, 4, 6, 8, 10, 12, 24, and 48 hours), a 200 pM sample of the reaction mixture was collected and rapidly frozen in liquid nitrogen with a buffer containing 10 mM EDTA (3 times the sample volume). Frozen samples were stored at -80°C until high-performance liquid chromatography (HPLC) analysis. The length of the oligonucleotides at each time point was quantified by measuring the AUC of the full-length peak. Exonuclease digestion data are summarized in Tables 2 and 3.

[0469] Table 2. Remaining full-length oligonucleotides at different time points

[0470]

[0471] Table 3. Half-life of different oligonucleotides

[0472] Name Half life(h) Name Half life(h) EX0512-PO-0000 0.12 EX0512-PS-0000 1.21 EX0512-PO-0001 6.69 EX0512-PS-0001 29.49 EX0512-PO-0002 9.15 EX0512-PS-0002 33.04 EX0512-PO-0003 9.69 EX0512-PS-0003 33.97 EX0512-PO-0040 0.22 EX0512-PS-0040 1.23 EX0512-PO-0041 6.67 EX0512-PS-0041 29.70 EX0512-PO-0042 9.14 EX0512-PS-0042 33.14 EX0512-PO-0043 9.68 EX0512-PS-0043 34.17 EX0512-PO-0080 8.06 EX0512-PS-0080 33.28 EX0512-PO-0081 8.84 EX0512-PS-0081 34.16 EX0512-PS-0082 36.53 EX0512-PS-0083 40.34 EX0512-PS-0084 39.59 EX0512-PS-0085 42.11

[0473] Example 41: Targeted Mouse TTR siRNA Sequence and Synthesis

[0474] The synthesis of siRNA sequences is no different from the usual phosphoramide solid-phase synthesis method. When synthesizing nucleotides modified at various positions of the SS and AS chains, the original nucleotides of the parent sequence are replaced with the phosphoramide monomers synthesized above.

[0475] The synthesis process is briefly described as follows: Using an LK-48E synthesizer (Lingkun), starting with a Universal CPG carrier, nucleoside phosphoramide monomers were linked one by one according to the synthesis program. Except for the synthesis of (EX001-U) to (EX038-U) and (EX000-H) described above, the remaining nucleoside monomer raw materials, such as 2'-F RNA and 2'-O-methyl RNA, were purchased from Shanghai Zhaowei. 5'-Ethylthio-1H-tetrazole (ETT) was used as the activator (0.6M acetonitrile solution), 0.22M PADS dissolved in a 1:1 volume ratio of trimethylpyridine (Suzhou Kelama) solution was used as the sulfiding agent, and iodopyridine / water solution (Kelama) was used as the oxidizing agent.

[0476] After solid-phase synthesis, the oligonucleotides were cleaved from the solid support and soaked in a 3:1 solution of 28% ammonia and ethanol at 50°C for 16 hours. After centrifugation, the supernatant was transferred to another centrifuge tube, concentrated, and evaporated to dryness. Purification was then performed using C18 reversed-phase chromatography with 0.1M TEAA and acetonitrile as the mobile phase, and DMTr was removed using 3% trifluoroacetic acid solution. The target oligonucleotides were collected, lyophilized, identified as the target product by LCMS, and quantified by UV (260 nm) spectroscopy.

[0477] The obtained single-stranded oligonucleotides were annealed according to complementary pairing in equimolar ratios, and the resulting double-stranded siRNA was dissolved in 1xPBS and adjusted to the required concentration for the experiment.

[0478] Table 4: Sequences containing protected compounds

[0479]

[0480]

[0481]

[0482] “m” means that the nucleotide to the left of the letter m is modified with 2'-OMe, “f” means that the nucleotide to the left of the letter f is modified with 2'-F, “s” means that the two nucleotides to the left and right of the letter s are modified with PS backbone, “(EX001-U)~(EX036-U)” and “(EX000-H)” are nucleotides introduced into the chain by the aforementioned nucleotide monomers of the present invention; the EX000-U structure is as described above.

[0483] Example 42: In vitro silencing efficacy of TTR target mRNA and modified nucleoside duplexes

[0484] Activity screening steps

[0485] Cell culture and transfection:

[0486] Hepa1-6 cells (ATCC, cat#CRL1830) were cultured at 37°C and 5% CO2 until near confluence in DMEM (Invitrogen, cat#11965092) containing 10% FBS (Ausgenex, cat#FBS500-S) and 1% penicillin-streptomycin. The cells were then digested and resuspended in seeding medium (DMEM + 10% FBS), and 5000 cells / well / 90 μL were seeded into 96-well cell culture plates (Corning, cat#3904) and incubated overnight at 37°C and 5% CO2. Transfection conditions were as follows: 4.6 μL of Opti-MEM (Gibco, cat#31985-070) and 0.4 μL of Lipofectamine RNAiMax (Invitrogen, Carlsbad CA, cat#13778-150) were mixed with 5 μL of siRNA per well and incubated at room temperature for 15 minutes. The mixture was then added to each well of a 96-well plate prepared the previous day at 10 μL. The plates were incubated at 37°C with 5% CO2 for 48 h. The final concentrations of siRNAs used in the experiments were 10 nM, 1 nM, and 0.1 nM.

[0487] RNA extraction and reverse transcription into cDNA:

[0488] Cell lysis to extract RNA was performed according to the Cells-to-Ct bulk lysis reagents (Invitrogen #4391851C) manufacturer's instructions. 1) Aspirate the old culture medium from each well and wash twice with 100 μL PBS. 2) Carefully aspirate the PBS. Add 50 μL of lysis buffer to each well. 3) Vortex at 500 rpm for 5 minutes at room temperature. 4) Add 5 μL of stop solution to each well and vortex at 500 rpm for 2 minutes at room temperature. If cDNA synthesis is to be performed immediately, the plate should be placed on ice.

[0489] Reverse transcription was performed according to the Cells-to-CT Bulk Fast Advanced RT Reagent (Invitrogen #A39110) manufacturer's instructions: Mixtures were prepared (per well: 25 μL 2×Fast Advanced RT Buffer, 2.5 μL 20×RT Fast Advanced Enzyme Mix, and 22.5 μL total RNA). cDNA was synthesized using a Biometra T Advanced 96SG (analytikjena) following these steps: 37°C for 30 min, 95°C for 5 min, and incubated at 4°C. The cDNA was stored at -20°C or immediately analyzed by real-time PCR.

[0490] Real-time PCR:

[0491] 4.33 μL of cDNA and 0.17 μL of 60X GAPDH TaqMan probe (Invitrogen cat, cat#4448491), 0.5 μL of 20X TTR TaqMan probe (Invitrogen, cat#4351370), and 5 μL of... FAST PCR Master Mix (Applied Biosystems, cat#4444965) was mixed and added to a 96-well plate (Axygen, cat#PCR-96-FLT-C) for real-time PCR detection. The instrument used was... 7 (Applied Biosystems), the system program is: 50℃ for 2 min, 95℃ for 20 s, and 40 cycles of 90℃ for 1 s and 60℃ for 20 s. Unless otherwise specified, each siRNA should be transfected in 3 replicates.

[0492] Data analysis was performed using the ΔΔCt method to analyze real-time data, which was then normalized using mock datasets. The specific calculation method was: ΔCt = Ct(target gene) – Ct(GAPDH), ΔΔCt = ΔCt(detection sample) - ΔCt(Mock), Relative mRNA expression to Mock = 2. -ΔΔCt %Inhibition vsMock = {1 - Expression fold(sample tested) / Expression fold(Mock)} * 100. The final results are shown in Table 5.

[0493] Table 5: q-PCR in vitro activity screening data

[0494]

[0495]

[0496] Example 43: Synthesis of siRNA sequence for in vivo evaluation

[0497] The synthesis of siRNA sequences is no different from the usual phosphoramide solid-phase synthesis method. When synthesizing nucleotides modified at various positions of the SS and AS chains, the original nucleotides of the parent sequence are replaced with the phosphoramide monomers synthesized above.

[0498] The synthesis process is briefly described as follows: Using an LK-48E synthesizer (Lingkun), starting with a Universal CPG (Dinaxinke) carrier, nucleoside phosphoramide monomers were linked one by one according to the synthesis program. Except for the nucleoside monomer compounds described in this invention, the other nucleoside monomer raw materials, such as 2'-F RNA and 2'-O-methyl RNA, were purchased from Shanghai Zhaowei, and L96 was purchased from Tangzhi Pharmaceutical. 5'-Ethylthio-1H-tetrazole (ETT) was used as the activator (0.6M acetonitrile solution), 0.22M PADS dissolved in a 1:1 volume ratio of trimethylpyridine (Suzhou Kelema) solution was used as the sulfiding agent, and iodopyridine / water solution (Kelema) was used as the oxidizing agent.

[0499] After solid-phase synthesis, the oligonucleotides were cleaved from the solid support and soaked in a 3:1 solution of 28% ammonia and ethanol at 50°C for 16 hours. After centrifugation, the supernatant was transferred to another centrifuge tube, concentrated, and evaporated to dryness. Purification was then performed using C18 reversed-phase chromatography with 0.1M TEAA and acetonitrile as the mobile phase, and DMTr was removed using 3% trifluoroacetic acid solution. The target oligonucleotides were collected, lyophilized, identified as the target product by LCMS, and quantified by UV (260 nm) spectroscopy.

[0500] The obtained single-stranded oligonucleotides and sodium acetate were ultrafiltered and salt-replaced using a 3KD ultrafiltration tube. According to the equimolar ratio, they were paired complementary and annealed. Finally, the resulting double-stranded siRNA-L96 conjugate (Table 6) was dissolved in water and adjusted to the required concentration for the experiment.

[0501] Table 6. Double-stranded siRNA-L96 conjugates

[0502]

[0503] “m” means that the nucleotide to the left of the letter m is modified with 2'-OMe, “f” means that the nucleotide to the left of the letter f is modified with 2'-F, “s” means that the two nucleotides to the left and right of the letter s are modified with PS backbone, “(EX001-U)~(EX002-U)” and “(EX000-H)” are nucleotides introduced into the chain by the aforementioned nucleotide monomers of the present invention; the EX000-U structure is as described above.

[0504] Example 44: In vivo activity evaluation of siRNA duplexes containing modified nucleosides

[0505] The in vivo activity of compounds containing L96 conjugates (see Table 6) against TTR target mRNA was evaluated using wild-type C57BL / 6 mice (Speford (Beijing) Biotechnology Co., Ltd.).

[0506] Six- to eight-week-old C57BL / 6 mice were administered a single subcutaneous injection of the compound at a dose of 0.5 mg / kg. Orbital blood was collected in EP tubes before administration and on days 7, 14, 21, 28, and 35 post-administration. After the blood samples were allowed to stand at room temperature for two hours, they were centrifuged at 5500 rpm for 10 minutes at 4°C to separate and collect serum, which was then used to detect TTR levels in the animal serum.

[0507] Serum TTR levels were detected by enzyme-linked immunosorbent assay (ELISA). The mouse Prealbumin ELISA kit (Abcam, catalog number: ab282297) was used for ELISA detection, and all samples were tested according to the kit instructions. Absorbance at 450 nm was read on a Tecan SPARK microplate reader, and the data from the standards (from the aforementioned ELISA kit) were fitted to a parametric standard curve to determine serum TTR protein levels (in μg / mL). The protein content of each animal was compared with its corresponding pre-drug serum protein content to determine the percentage of TTR remaining relative to pre-drug levels.

[0508] ELISA results showed ( Figure 1 Both siRNA duplexes can effectively reduce serum TTR levels, indicating that these modified nucleoside compounds can maintain the silencing activity of siRNA sequences in vivo. Furthermore, EX0512-0001-L96, EX0512-0002-L96, EX0512-0038-L96, and EX0512-0039-L96 exhibit better in vivo silencing persistence than EX0512-0037-L96.

Claims

1. A nucleoside compound of Formula I, or a deuterated thereof, or a stereoisomer thereof: in, X 1 X 2 Each is independently selected from O or S; R 1 R 2 The components are independently selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, substituted C2-C6 ynyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, -(C0-C2 alkylene)-(3-10 membered carbide ring), -(C0-C2 alkylene)-(4-10 membered heterocycle), -(C0-C2 alkylene)-(6-10 membered aromatic ring), and -(C0-C2 alkylene)-(5-10 membered aromatic heterocycle); wherein the alkylene, carbide ring, heterocycle, aromatic ring, and aromatic heterocycle are optionally surrounded by 1, 2, or 3 R's. 1a Replace; and R 1 R 2 They are not both hydrogen; R 3 R 4 R 5 R 6 They are independently selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl, C1-C6 alkoxy, and substituted C1-C6 alkoxy, respectively. R 7 Selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, substituted C2-C6 ynyl, C1-C6 alkoxy, substituted C1-C6 alkoxy; Each R 1a They are independently selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl, C1-C6 alkoxy, and substituted C1-C6 alkoxy, respectively. The substituents in the substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, and substituted C1-C6 alkoxy groups are selected from hydrogen, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 alkoxy, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)(C1-C6 alkyl), -NHC(O)(C1-C6 alkyl), -C(O)(C1-C6 alkyl), -C(O)NH(C1-C6 alkyl), and -C(O)N(C1-C6 alkyl)(C1-C6 alkyl); Nu is a hydrogen or nucleoside base.

2. The nucleoside compound according to claim 1, characterized in that: The compounds represented by Formula I are shown in Formula IIa and Formula IIb: Among them, X 1 X 2 R 1 R 2 R 3 R 4 R 5 R 6 R 7 Nu as described in claim 1; Preferably, the compounds represented by Formula I are as shown in Formula IIIa, IIIb, IIIc, and IIId: Among them, X 1 X 2 R 1 R 2 R 3 R 4 R 5 R 6 R 7 Nu as described in claim 1; More preferably, R 3 R 4 R 5 R 6 Each of the following is independently selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, vinyl, ethynyl, methoxy, and methoxymethyl; more preferably, R 3 R 4 R 5 R 6 Both are hydrogen.

3. The nucleoside compound according to any one of claims 1-2, characterized in that: Compounds represented by Formula I are shown in Formulas IVa, IVb, IVc, and IVd: Among them, X 1 X 2 R 1 R 2 R 7 Nu as described in claim 1; Preferably, Nu is a nucleoside base, and the base is selected from: Preferably, R 2 For hydrogen, R 1 Selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxymethyl, methoxyethyl, vinyl, ethynyl, methoxy, ethoxy, cyclopropyl, cyclobutyl, cyclopropylmethyl, phenyl, benzyl, phenethyl, Or, R 1 For hydrogen, R 2 Selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxymethyl, methoxyethyl, vinyl, ethynyl, methoxy, ethoxy, cyclopropyl, cyclobutyl, cyclopropylmethyl, phenyl, benzyl, phenethyl, More preferably, R 7 Selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxymethyl, methoxyethyl, vinyl, ethynyl, methoxy, ethoxy, -O-C2H4-OCH3, -O-C2H4-C(O)NH(CH3).

4. The nucleoside compound according to any one of claims 1-3, characterized in that: The nucleoside compound is specifically: Wherein, Nu is as described in claim 1 or claim 3.

5. The nucleoside compound according to any one of claims 1-4, characterized in that: The nucleoside compound is specifically:

6. The following nucleoside compounds, or their deuterated derivatives, or their stereoisomers:

7. Use of the nucleoside compound according to any one of claims 1-6 in the preparation of oligonucleotides; preferably, use of the nucleoside compound according to any one of claims 1-10 as an intermediate in the preparation of oligonucleotides; more preferably, the oligonucleotide is siRNA, antisense nucleic acid, saRNA, miRNA or nucleic acid aptamer.

8. An oligonucleotide comprising at least one structure as shown in Formula V or Formula V', and wherein... Linked to the rest of the oligonucleotide; in, X 1 X 2 X 3 Each is independently selected from O or S; R 1 R 2 The components are independently selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, substituted C2-C6 ynyl, C1-C6 alkoxy, substituted C1-C6 alkoxy, -(C0-C2 alkylene)-(3-10 membered carbide ring), -(C0-C2 alkylene)-(4-10 membered heterocycle), -(C0-C2 alkylene)-(6-10 membered aromatic ring), and -(C0-C2 alkylene)-(5-10 membered aromatic heterocycle); wherein the alkylene, carbide ring, heterocycle, aromatic ring, and aromatic heterocycle are optionally surrounded by 1, 2, or 3 R's. 1a Replace; and R 1 R 2 They are not both hydrogen; R 3 R 4 R 5 R 6 They are independently selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl, C1-C6 alkoxy, and substituted C1-C6 alkoxy, respectively. R 7 Selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, substituted C2-C6 ynyl, C1-C6 alkoxy, substituted C1-C6 alkoxy; Each R 1a They are independently selected from hydrogen, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl, C1-C6 alkoxy, and substituted C1-C6 alkoxy, respectively. The substituents in the substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, and substituted C1-C6 alkoxy groups are selected from hydrogen, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 alkoxy, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)(C1-C6 alkyl), -NHC(O)(C1-C6 alkyl), -C(O)(C1-C6 alkyl), -C(O)NH(C1-C6 alkyl), and -C(O)N(C1-C6 alkyl)(C1-C6 alkyl); Nu is a hydrogen or nucleoside base; Preferably, the structure represented by formula V or formula V' is as shown in formulas VIIIa, VIIIb, VIIIc, VIIId, VIIIa', VIIIb', VIIIc', and VIIId':

9. The oligonucleotide according to claim 8, characterized in that: Nu is a nucleoside base, and the base is selected from A, U, G, C, T, or the bases shown below: Preferably, R 2 For hydrogen, R 1 Selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxymethyl, methoxyethyl, vinyl, ethynyl, methoxy, ethoxy, cyclopropyl, cyclobutyl, cyclopropylmethyl, phenyl, benzyl, phenethyl, Or, R 1 For hydrogen, R 2 Selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxymethyl, methoxyethyl, vinyl, ethynyl, methoxy, ethoxy, cyclopropyl, cyclobutyl, cyclopropylmethyl, phenyl, benzyl, phenethyl, R 7 Selected from hydrogen, fluorine, chlorine, bromine, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, methoxymethyl, methoxyethyl, vinyl, ethynyl, methoxy, ethoxy, -O-C2H4-OCH3, -O-C2H4-C(O)NH(CH3).

10. The oligonucleotide according to any one of claims 8 to 9, characterized in that: The oligonucleotide is siRNA, antisense nucleic acid, saRNA, miRNA, or nucleic acid aptamer; preferably, the oligonucleotide is siRNA; more preferably, the siRNA comprises a sense strand and an antisense strand; wherein, the structure shown in Formula V or Formula V' is the 1st, 2nd, 3rd, 4th, or 5th nucleotide at the 3' end of the antisense strand of the siRNA, or the structure shown in Formula V or Formula V' is the 1st, 2nd, 3rd, 4th, or 5th nucleotide at the 3' end of the sense strand of the siRNA.

Images