SNP (Single Nucleotide Polymorphism) molecular marker related to rabbit peeled net head weight as well as primer group, detection kit and application of SNP molecular marker

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to an SNP (Single Nucleotide Polymorphism) molecular marker related to rabbit peeled net head weight as well as a primer group, a detection kit and application of the SNP molecular marker. The SNP molecular marker is located at the 191bp position in a nucleotide sequence shown in SEQ ID NO.1, C / T polymorphism exists on the site, the site polymorphism is highly related to the weight of a rabbit peeled net head, and CC type is used as a dominant genotype. By applying the molecular marker and the detection method provided by the invention, molecular marker-assisted breeding can be efficiently carried out on the peeled net head weight character of the rabbit, and a reliable technical means is provided for improving the carcass quality and the economic value of the rabbit.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to an SNP molecular marker related to the net head weight of rabbits after skinning, its primer set, detection kit, and applications. Background Technology

[0002] The head of an animal is not only an important indicator of breed identification but also directly impacts its health, reproduction, and economic benefits. In rabbit production, rabbits with high net head weight typically have higher survival rates and faster growth rates. This means they can reach the standard weight for sale or processing in a shorter time, thus improving breeding efficiency and economic benefits. Furthermore, rabbit breeds with high net head weight often exhibit better meat quality, characterized by tender meat and good color, making them more popular in the meat processing market. Especially in regions like Sichuan and Chongqing in my country, spicy rabbit heads made from skinned rabbit heads are a popular specialty food, generating huge demand for raw materials. Larger rabbit heads command better selling prices and have greater market competitiveness. Therefore, genetically improving head weight traits in domestic rabbit breeding is of great significance to both rabbit production and consumption.

[0003] However, traditional breeding techniques often rely on phenotypic analysis of rabbits for selection and mating. But the phenotypic weight trait in rabbits is difficult to measure in vivo, resulting in poor accuracy in phenotypic estimation and low breeding efficiency. Currently, research on rabbit head weight is scarce. While phenotypic weight is controlled by numerous genes, the effects of most molecular markers are small and lack practical breeding value. Therefore, identifying rabbit molecular markers with significant genetic effects and high breeding value for molecular breeding is of particular importance for genetically improving rabbit phenotypic head weight. Summary of the Invention

[0004] The purpose of this invention is to provide a SNP molecular marker related to the rabbit's head weight after skinning. This molecular marker enables simple and rapid detection of the rabbit's head weight after skinning, providing a reliable technical means for breeding rabbit breeds with high head weight after skinning.

[0005] This invention provides an SNP molecular marker associated with the head weight trait of rabbits after skinning, wherein the SNP molecular marker is located at 191 bp in the nucleotide sequence shown in SEQ ID NO.1 and exhibits C / T polymorphism at the site.

[0006] As a preferred embodiment, the mutation site of the SNP molecular marker is N at position 191 bp in the nucleotide sequence shown in SEQ ID NO.1, where N is C or T.

[0007] The present invention provides a primer set for detecting the above-mentioned SNP molecular markers, the primer set comprising: an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.3.

[0008] This invention provides a detection kit for the rabbit head weight trait after skinning, comprising the above-mentioned SNP molecular markers and / or the above-mentioned primer set.

[0009] This invention provides the application of the above-mentioned SNP molecular markers, primer sets, or detection kits in rabbit genetic breeding.

[0010] As a preferred embodiment, the rabbits include meat rabbits and dual-purpose rabbits.

[0011] As a preferred embodiment, the genetic breeding trait includes: net head weight of the rabbit after skinning.

[0012] This invention provides a method for identifying the head weight trait of rabbits after skinning. Using genomic DNA from the rabbit tissue to be tested as a template, PCR amplification is performed using the primer set described above to obtain PCR products. The PCR products are sequenced, and the genotype at position 191 bp in the nucleotide sequence shown in SEQ ID NO.1 is determined based on the sequencing results. The head weight trait of rabbits after skinning is identified based on the genotype.

[0013] As a preferred embodiment, the rabbit tissue includes rabbit ear tissue.

[0014] As a preferred option, the genotypes include: CC, TT and CT, with CC being the dominant genotype.

[0015] Beneficial Effects: This invention provides a SNP molecular marker associated with the skinned head weight trait in rabbits. The SNP molecular marker is located at 191 bp in the nucleotide sequence shown in SEQ ID NO.1, and exhibits C / T polymorphism at this site. Rabbit breeds with high net head weight not only have advantages in survival rate, growth rate, and market time, but also show better meat quality, characterized by tender meat and good color, making their meat products more popular in the market. The embodiments of this invention verify the effect of the molecular marker on the skinned head weight trait, enabling simple and rapid identification of the skinned head weight trait and establishing an efficient and accurate molecular marker-assisted breeding technology. This technology is easily applied to the genetic improvement of the skinned head weight trait in breeding rabbits. In the highly competitive rabbit meat market, the SNP molecular marker provided by this invention can screen and identify higher-quality rabbit head and other rabbit meat by-products, meeting current consumer demand for rabbit head products, thereby improving the profitability and return on investment in rabbit farming. Attached Figure Description

[0016] Figure 1 This is a gel electrophoresis image of the DNA fragment containing the molecular markers screened in the examples; where lane M represents the 2000bp Marker molecular weight standard, and the 2000bp Marker molecular weight bands are 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp from top to bottom. Figure 2 This is a sequencing peak diagram of the DNA fragment containing the molecular markers screened in the examples. Detailed Implementation

[0017] This invention provides an SNP molecular marker associated with the head weight trait of rabbits after skinning, wherein the SNP molecular marker is located at 191 bp in the nucleotide sequence shown in SEQ ID NO.1 and exhibits C / T polymorphism at the site.

[0018] The mutation site described in this invention is located at 31055597 bp on rabbit chromosome 9, with the variant site being G / T; the genome is listed in the NCBI BioProject database with the project number PRJNA1020055. For ease of description, the nucleotide sequence of the gene fragment containing the SNP molecular marker is shown in SEQ ID NO.1: 5'-CCCCACACCCCTCTTTAACTGCCTTTCAATTTATTTATTTATTTATTTATTTCATTAATTTTTTTTTAAAGAAAGATTTTGAAAGGCAGTTGCAGAGAGAGAGAGCTTCCATCTACTGATTCACTCTCCAAATGGCCACAGTGGCCAGGGCTGAGCCAGGCCAAAGCCAGGAGCTTCATCCAAGTCTCCCANGTGGCTGCAGGGACCCAAACACTTGAACTATCTTCTACTGCCTTCCAGTCCATTAGCAGGGAGCTGAATTGGAAGTGGAGCATCTGGGACTAGAACCAGTGCCAATATGGGATGCTGGTGCTGTAG-3'; The mutation site is N at position 191 bp in the nucleotide sequence shown in SEQ ID NO.1, where N is C or T. The mutation at the N site (marked in red) leads to polymorphism.

[0019] The present invention provides a primer set for detecting the above-mentioned SNP molecular markers, the primer set comprising: the nucleotide sequence of the upstream primer as shown in SEQ ID NO.2: 5'-CCCCACACCCCTCTTTAACT-3'; and the nucleotide sequence of the downstream primer as shown in SEQ ID NO.3: 5'-CTACAGCACCAGCATCCCAT-3'.

[0020] This invention provides a detection kit for the rabbit's skinned head weight trait, comprising the aforementioned SNP molecular markers or the aforementioned primer set. Furthermore, the detection kit also includes PCR Mix reagents.

[0021] This invention provides the application of the aforementioned SNP molecular markers, primer sets, or detection kits in rabbit genetic breeding. As a preferred embodiment, the genetic breeding trait includes: rabbit head weight after skinning. The SNP molecular markers of this invention differ from existing molecular markers associated with rabbit head weight after skinning, enabling simple and efficient identification of the rabbit head weight trait. This provides a basis for the identification and screening of rabbit breeds with high head weight after skinning, and breeding rabbits with high head weight after skinning can provide higher quality rabbit heads and related rabbit meat by-products, meeting current consumer demand for rabbit head products.

[0022] In a preferred embodiment, the rabbits include meat rabbits and dual-purpose rabbits; the meat rabbits include the Kangda meat rabbit V strain; the dual-purpose rabbits refer to various common dual-purpose rabbits. The Kangda meat rabbit V strain is bred through generations of crossbreeding of Ipru PS59 and CD54. For a description of the body shape, reproductive performance, and production performance of the Kangda meat rabbit V strain, please refer to DB37 / T 2844-2016 "Kangda No. 3 Meat Rabbit Breeding System".

[0023] In a preferred embodiment, the aid includes the following steps: determining the above-mentioned SNP molecular markers of rabbits, and making the following selections based on the SNP molecular markers: selecting individuals with the CC genotype at the locus as breeding rabbits; culling individuals with the CT and TT genotypes at the locus, so as to increase the frequency of the C allele at the locus generation by generation, thereby increasing the net head weight of the offspring rabbits after skinning.

[0024] This invention provides a method for identifying the head weight trait of rabbits after skinning. Using genomic DNA from the rabbit tissue to be tested as a template, PCR amplification is performed using the primer set described above to obtain PCR products. The PCR products are sequenced, and the genotype at position 191 bp in the nucleotide sequence shown in SEQ ID NO.1 is determined based on the sequencing results. The head weight trait of rabbits after skinning is identified based on the genotype.

[0025] As a preferred implementation method, genomic DNA of rabbits is extracted from rabbit ear tissue, which is the easiest tissue sample to obtain; and collecting ear tissue will not affect other traits of meat rabbits, such as weight and hormone levels; at the same time, from the perspective of animal welfare, it is the least harmful to meat rabbits; genomic DNA can also be extracted from tissues in other locations.

[0026] As a preferred embodiment, the specific steps for extracting genomic DNA are as follows: 1) Cut rabbit ear tissue into a paste, add buffer GA, and vortex until completely suspended; 2) Add proteinase K solution, mix well, and digest overnight; the digestion temperature can be 50~60℃, for example 56℃; 3) Add buffer GB, mix well, and let stand until the solution becomes clear; the standing temperature can be 65~75℃, for example 70℃, and the time can be 5~15min, for example 10min; 4) Add anhydrous ethanol and vortex to mix well; the vortexing time can be 10~20s, for example 15s, at which time flocculent precipitation may occur; 5) Add the solution obtained in 4) and the flocculent precipitate to the adsorption column of the collection tube, and centrifuge to remove waste liquid; the adsorption column can be CB3; 6) Add buffer to the adsorption column. 7) Add wash buffer PW to adsorption column CB3 and centrifuge to remove waste liquid; The centrifugation speed in steps 5) to 7) can be 10,000 to 15,000 rpm, for example 12,000 rpm, and the time can be 20 to 40 seconds, for example 30 seconds; 8) Repeat step 7, repeating 1 to 2 times; 9) Centrifuge again to remove waste liquid and thoroughly dry the adsorption column; the centrifugation speed can be 10,000 to 15,000 rpm, for example 12,000 rpm, and the time can be 1 to 3 minutes, for example 2 minutes; 10) Add 50 to 200 μL of elution buffer TE to the adsorption column, centrifuge to collect the solution, which is the genomic DNA solution; before centrifugation, it can be placed at room temperature for 2 to 5 minutes, and the centrifugation parameters are the same as in step 9). In this embodiment of the invention, the integrity of genomic DNA can be determined using a nucleic acid protein analyzer; wherein, the A260 / A280 ratio is between 1.7 and 2.1, and the A260 / A230 ratio is between 1.8 and 2.2, which are considered to be of acceptable integrity.

[0027] In a preferred embodiment, PCR amplification was performed on the genomic DNA sample from the aforementioned rabbit tissue. The PCR amplification reaction system consisted of: 1 μL DNA template, 0.5 μL each of the primers shown in SEQ ID NO.2 and SEQ ID NO.3, and 10 μL PCR Mix reagent (2×M5 Taq HiFi PCR Mix, Mei5bio). The PCR amplification reaction conditions were: 94℃, 3 min; 28 cycles (94℃, 25 s; 56~58℃, 20 s; 72℃, 10 s); 72℃, 5 min; 4℃, ∞.

[0028] In a preferred embodiment, the PCR product is sequenced, and the genotype at position 191 bp in the nucleotide sequence shown in SEQ ID NO.1 is determined based on the sequencing results. The net head weight of the rabbit after skinning is then identified based on the genotype. The genotypes include CC, TT, and CT, with CC being the dominant genotype.

[0029] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, provides an SNP molecular marker related to the net head weight of rabbits after skinning, along with its primer set, detection kit, and applications. However, these descriptions should not be construed as limiting the scope of protection of the present invention.

[0030] Example 1 I. Sample Collection The experimental rabbit group consisted of 1512 V-strain meat rabbits from Kangda Rabbit Industry Co., Ltd., which had free access to food and water and maintained consistent feeding methods and rearing conditions. Before slaughter, ear tissue samples were collected from all experimental rabbits and preserved in 75% ethanol for the extraction of rabbit genomic DNA (specific methods were based on the instructions provided with the genomic DNA kit produced by Beijing Tiangen Biotech Co., Ltd.).

[0031] II. Determination of Net Head Weight After Peeling All rabbits in the experiment were housed individually in cages according to a uniform feeding standard. They were bled to death at 70 days of age and slaughtered. The rabbits were cut off at the first cervical vertebra along the horizontal axis, and the weight of the skinned head was recorded. The data were then processed and outliers were removed.

[0032] III. Extraction and Detection of Rabbit Genomic DNA Rabbit genomic DNA was extracted from rabbit ear tissue using the TIANamp Genomic DNA Kit manufactured by Beijing Tiangen Biotech Co., Ltd. The specific operational steps are as follows: 1) Cut the rabbit ear tissue sample into a paste, add 200 μL of buffer GA, and shake until completely suspended.

[0033] 2) Add 20 μL of proteinase K solution, mix well, and digest overnight in a 56°C water bath.

[0034] 3) Add 200 μL of buffer GB, mix thoroughly by inverting, and incubate at 70°C for 10 min. The solution should become clear.

[0035] 4) Add 200 μL of anhydrous ethanol and shake thoroughly for 15 seconds. Flocculent precipitate may appear at this time.

[0036] 5) Add the obtained solution and flocculent precipitate into an adsorption column CB3 (place the adsorption column in the collection tube), centrifuge at 12000 rpm for 30 s, and discard the waste liquid.

[0037] 6) Add 500 μL of buffer GD to the adsorption column, centrifuge at 12,000 rpm for 30 s, and discard the waste liquid.

[0038] 7) Add 600 μL of PW wash buffer to the adsorption column, centrifuge at 12,000 rpm for 30 s, and discard the waste liquid.

[0039] 8) Repeat step 7 twice.

[0040] 9) Centrifuge at 12,000 rpm for 2 minutes and discard the waste liquid. Place the adsorption column CB3 at room temperature until it is completely dry.

[0041] 10) Add 200 μL of elution buffer TE to the adsorption column, incubate at room temperature for 3 min, centrifuge at 12,000 rpm for 2 min, and collect the solution, which is the DNA solution.

[0042] 11) Mix 2 μL of the obtained DNA solution with 1 μL of loading buffer, load the mixture onto a 1% agarose gel, and electrophoresis at 120V for about 20 minutes. Observe the electrophoresis results under UV light and take pictures to determine the integrity of the DNA. The results are shown in the table below. Figure 1 The extracted DNA was tested for quality using a NanoDrop 2000 nucleic acid and protein analyzer (Thermo Fisher Scientific, USA). An A260 / A280 ratio between 1.7 and 2.1 and an A260 / A230 ratio between 1.8 and 2.2 were considered acceptable.

[0043] IV. Data Processing and Analysis 1. Phenotypic Data Analysis Descriptive statistical analysis was performed on the measured pelvic head weight using R statistical analysis software, including calculating the mean, standard deviation, maximum and minimum values ​​of this trait.

[0044] 2. Genome-wide association analysis GWAS analysis was performed using GMAT 2.0 software. The following mixed model was used to analyze the data, and the model formula is as follows: y = Xβ + Zα + Wμ + e; Where y is the vector of phenotypic traits; X represents the vector of covariates (PCA principal components obtained from population deconstruction analysis); β represents the vector of corresponding coefficients, including the intercept term; Z represents the vector of marker genotypes; α represents the effect size of the marker; and Wμ represents the vector of random polygenic effects, where μ ~ N(0, Gσ). a2 ), σ a 2 This refers to the genetic variance, where G represents the constructed genome relation matrix; e is a vector of random residuals, satisfying e ~ N(0, Iσ). 2 ), σ 2 Wherein is the residual variance.

[0045] 3. Test the significance of the association between SNP and trait.

[0046] When a certain SNP satisfies P < 2.47 × 10 -6 Under certain conditions, we consider this SNP to be significant at the whole genome level.

[0047] V. Genotype Determination and Quality Control of Genotype Data Genomic DNA samples extracted from 1512 rabbit ear samples were analyzed for SNP sites using low-depth resequencing technology. The analytical results obtained based on the above detection methods are shown below. Figure 2 See Table 1. Figure 2 To screen for DNA fragments containing molecular markers, PLINK software was used to perform quality control checks on the raw genotype data of all individuals. The criteria for quality control were: SNP call rate > 90%, minor allele frequency (MAF) > 0.01, and a p-value < 10 for the Hardy-Weinberg equilibrium (HWE) test. -6 The standard is based on indicators such as a sample call rate > 90%.

[0048] Table 1. Effects of the C / T variant site on the net head weight of skinned rabbits in the Kangda V strain rabbit population.

[0049] Table 1 shows the effect of the C / T variant site on the net head weight after skinning in the Kangda V strain meat rabbit population; among them... A p-value of <0.05 indicates a significant difference. P < 0.01 indicates a highly significant difference; the trait values ​​in the table are the mean ± standard error.

[0050] Table 1 shows that individuals with the CC genotype had significantly higher net head weight after skinning; individuals with the TT genotype had significantly lower net head weight after skinning; and individuals with the CC genotype had significantly higher net head weight after skinning than individuals with the TT genotype (P<0.01). For the rabbit net head weight trait, the C gene was an enhancing gene and the T gene was a diminishing gene. Further statistical analysis revealed that the additive effect of the C gene was 26.93g, and the dominant effect between the C and A genes was 17.14g.

[0051] In rabbit breeding, by selecting individuals with the CC genotype and increasing the gene frequency of the C gene in the population, the net head weight after skinning can be increased, the carcass value can be improved, and economic benefits can be enhanced.

[0052] Example 2 Detection of SNP molecular markers A method for detecting SNP molecular markers associated with the net head weight of a rabbit after skinning, the method comprising the following steps: extracting genomic DNA from the rabbit to be tested, performing PCR amplification on the DNA sample, sequencing the PCR amplification product, and interpreting the polymorphism at the nucleotide site at 191 bp in the sequence shown in SEQ ID NO.1 of the rabbit based on the sequencing results.

[0053] Primers were designed based on rabbit variant sites using PrimerPremier 5.0 software and synthesized by Shanghai Bioengineering Technology Co., Ltd. The primer pair sequences are as follows: Upstream primer (SEQ ID NO.2): 5'-CCCCACACCCCTCTTTAACT-3'; Downstream primer (SEQ ID NO.3): 5'-CTACAGCACCAGCATCCCAT-3'.

[0054] Using the extracted DNA as a template, PCR amplification was performed according to the designed primers: Take 1 μL of DNA template, 0.5 μL each of the primers shown in SEQ ID NO.2 and SEQ ID NO.3, and 10 μL of PCR Mix reagent (2×M5 Taq HiFi PCR Mix, Mei5bio); set the PCR amplification system as follows: 94℃, 3 min; 28 cycles (94℃, 25 s; 57℃, 20 s; 72℃, 10 s); 72℃, 5 min; 4℃, ∞.

[0055] 100 ng of extracted DNA was analyzed by 1% agarose gel electrophoresis. The results were observed under an imaging system; concentrated and bright bands indicated excellent extraction. Figure 1 .

[0056] Figure 1 The middle lane M represents the 2000bp marker molecular weight standard. The 2000bp marker molecular weight bands, from top to bottom, are 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp.

[0057] like Figure 1 As shown, the PCR product was detected by electrophoresis in a 1% agarose gel, and the amplified target fragment was approximately 317 bp in size.

[0058] Example 3: Successive Generation Breeding I. Successive generation selection and breeding steps: Successive generation selection involves choosing individuals with superior traits as parents to reproduce the next generation, thereby improving the performance of offspring. The specific steps of successive generation selection are as follows: 1. Screen for individuals with the CC genotype: First, you need to identify individuals in the study population with the CC genotype. Based on the genotyping results, screen for all individuals with a high peeled head weight who also have the CC genotype. These individuals are typically identified using genotyping techniques (SNP testing).

[0059] 2. Assess phenotypic performance: For CC-type individuals, assess whether their pelvic head weight is consistently high or whether they meet the set trait criteria. Statistical analysis (t-test) is used to confirm significant differences in pelvic head weight between CC-type individuals and other genotypes (such as TT-type) to ensure the selection of individuals that meet the target trait criteria.

[0060] 3. Select superior individuals for breeding: Among individuals with the CC genotype, those with the highest peltated head weight were selected as parents. Considering factors such as genetic diversity and health, the diversity of the gene pool was also ensured during the selection process.

[0061] 4. Reproduction and monitoring: The selected superior CC-type individuals were mated to reproduce the next generation. The phenotypic performance of the new generation was monitored regularly, especially the net head weight after skinning, to ensure that genetic selection improved the traits.

[0062] 5. Intergenerational assessment: Evaluations are conducted in each generation to ensure that the peltated net head weight of each generation outperforms that of the previous generation. Based on the statistical results, breeding strategies can be adjusted, potentially gradually increasing the selection efforts for individuals with the CC genotype until the target trait is maximized.

[0063] II. Results of Subsequent Breeding: 1. Improvement in traits: Since the CC genotype shows a significant positive correlation with net head weight after skinning, selective breeding of CC-type individuals will lead to a gradual increase in net head weight after skinning across generations. In purebred rabbit populations, this selection will help to fix the trait of higher net head weight after skinning, thereby continuously improving the overall net head weight level of the population.

[0064] 2. Genetic Progress: Successive generations of selective breeding can lead to changes in genotypic structure, with the frequency of the CC genotype gradually increasing. If the phenotypic performance of CC individuals is superior to other genotypes (such as TT), the proportion of CC individuals in the population may increase after multiple generations of selective breeding, thereby driving the overall performance of the population toward the target trait.

[0065] 3. Stability and sustainability: While selective breeding may yield significant initial progress, long-term breeding can encounter genotypic convergence (genetic bottleneck effect), necessitating constant attention to maintaining genetic diversity. Introducing external individuals for mating at appropriate times during the breeding process can preserve genetic diversity and prevent excessive inbreeding from negatively impacting population health and performance.

[0066] Example 4: Validation in the offspring population of crosses between the Kangda V line and other varieties I. Test Samples Fifteen healthy male rabbits from the core group of the Kangda V lineage, with the genotype CC at the specified SNP locus, were selected as the sires. Sixty healthy female rabbits each from the Ira meat rabbit (breed A) and Qixing meat rabbit (breed B), whose genetic backgrounds differ significantly from the Kangda V lineage, were selected as the dams. Feeding methods, rearing conditions, and methods for determining the net head weight after skinning were the same as in Example 1. The sire male rabbits were randomly assigned and mated with female rabbits of the two breeds respectively to construct two hybrid combinations: Combination HV×A: Kangda V series × Ira meat rabbit; Combination HV×B: Kangda V series × Qixing meat rabbit.

[0067] II. Measurement Items and Methods Genotyping: Genotyping of each individual at the SNP locus was performed, and the results were recorded as CC, CT or TT. The determination method was the same as in Example 1.

[0068] Characteristics determination: The method for determining the net head weight after peeling is the same as in Example 1.

[0069] III. Results and Analysis Statistical analysis (t-test) confirmed the significant difference in pelvic head weight between CC-type individuals and other genotypes, and the results were evaluated in the F1 generation.

[0070] The genotypic distribution and phenotypic data of the F1 generation of the two hybrid combinations are shown in Table 2. As can be seen from the table, under different hybridization backgrounds, individuals with the CC genotype had the highest mean net head weight after pelting, while individuals with the TT genotype had the lowest.

[0071] Table 2. Distribution of SNP genotypes and phenotypic statistics of head weight after shaving in different F1 hybrid populations.

[0072] Therefore, the embodiments verify the effect of the SNP molecular marker on the rabbit's skinned head weight trait, which can easily and quickly identify the rabbit's skinned head weight trait and establish an efficient and accurate molecular marker-assisted breeding technology to provide higher quality rabbit head and other rabbit meat by-products, thus meeting the current consumer demand for rabbit head products.

[0073] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A SNP molecular marker associated with the rabbit's skinned head weight trait, characterized in that, The SNP molecular marker is located at 191 bp in the nucleotide sequence shown in SEQ ID NO.1, and a C / T polymorphism exists at this site.

2. The SNP molecular marker according to claim 1, characterized in that, The mutation site is the nucleotide sequence shown in SEQ ID NO.1, where N is C or T at position 191 bp.

3. A primer set for detecting the SNP molecular marker as described in claim 1 or 2, characterized in that, The primer set includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.

3.

4. A test kit for detecting the head weight of skinned rabbits, characterized in that, Includes the SNP molecular markers as described in claim 1 or 2 and / or the primer set as described in claim 3.

5. The application of the SNP molecular marker of claim 1 or 2, the primer set of claim 3, or the detection kit of claim 4 in the genetic breeding of rabbits.

6. The application according to claim 5, characterized in that, The rabbits mentioned include meat rabbits and dual-purpose rabbits.

7. The application according to claim 5, characterized in that, The genetic breeding traits include: the net head weight of the rabbit after skinning.

8. A method for identifying the head weight of a skinned rabbit, characterized in that, Using genomic DNA from the rabbit tissue to be tested as a template, PCR amplification was performed using the primer set described in claim 3 to obtain PCR products; The PCR product was sequenced, and the genotype at position 191 bp in the nucleotide sequence shown in SEQ ID NO.1 was determined based on the sequencing results. The rabbit's head weight after skinning was then identified based on the genotype.

9. The identification method according to claim 8, characterized in that, The rabbit tissue includes: rabbit ear tissue.

10. The identification method according to claim 8, characterized in that, The genotypes include: CC, TT and CT, with CC being the dominant genotype.

Images