Method for constructing chalcone glycoside genetic engineering strain by using glycosyltransferase and application of chalcone glycoside genetic engineering strain

Abstract

The invention discloses a method for constructing a pressed butterfly mycin glycoside gene engineering strain by using glycosyl transferase and application of the pressed butterfly mycin glycoside gene engineering strain. A strong promoter kasOp * is introduced to the upstream of a glucoside transferase gene pie28 of Streptomyces psammoticus SCSIO NS126, the nucleotide sequence of the strong promoter kasOp * is as shown in SEQ ID NO. 1, and the nucleotide sequence of the glucoside transferase pie28 is as shown in SEQ ID NO. 2. The invention also discloses a preparation method of the Streptomyces psammoticus SCSIO NS126, and the preparation method of the Streptomyces psammoticus SCSIO NS126 comprises the following steps of: introducing the strong promoter kasOp * into the upstream of the glucoside transferase gene pie28. The streptomyces gene engineering strain Streptomyces sp. SK-kas28 constructed by the invention can efficiently express the chalcone glycoside, is widely applied to fermentation production of the chalcone glycoside, and is used for research and development of new drugs for treating kidney diseases and the like.

Description

Technical Field

[0001] This invention belongs to the field of microbial metabolic engineering technology, and relates to a method and application for constructing pteropterin glycoside genetically engineered strains using glycosyltransferases. Background Technology

[0002] Pieridins are a class of α-pyridone antibiotics derived from microorganisms, showing promising potential for pharmaceutical development (Journal of Antibiotics, 2016, 69:582). Pieridin glycoside derivatives have significant potential in treating renal cell carcinoma, inhibiting organ fibrosis, and treating acute kidney injury and chronic kidney disease (Journal of Medicinal Chemistry, 2019, 62:7058; Theranostics, 2022, 12:7158; Acta Pharmaceutica Sinica B, 2024, 14:3232). Furthermore, compared to pieridin aglycones, pieridin glycosides exhibit significantly reduced toxicity, demonstrating greater potential for new drug development (Journal of Medicinal Chemistry, 2021, 64:9943).

[0003] Currently, there are no reports on the total chemical synthesis of pterostilbene glycosides, and the yield of pterostilbene glycosides in wild-type strains is low (patent ZL202410857442.1), severely restricting its new drug development. To address this bottleneck, metabolic engineering strategies have shown significant value. Promoter engineering is an effective means of optimizing the expression of key genes in microbial biosynthetic pathways. In Streptomyces, by replacing or introducing strong promoters, the transcriptional efficiency of target biosynthetic genes can be significantly improved, thereby promoting the accumulation of end products. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides a method and application for constructing pterostilbene glycoside genetically engineered strains using glycosyltransferases. A strong promoter is recombinated and inserted into Streptomyces. Streptomyces psammoticus SCSIONS126 glycosidase gene pie28 Upstream, efforts are made to increase the expression level of glycoside transferase genes to achieve efficient production of pteropterin glycosides.

[0005] Glycosyltransferases are key enzymes in the synthesis of pterostilbene glycosides. Based on this, this study employed promoter engineering technology to integrate a strong promoter into wild-type Streptomyces. Streptomyces psammoticus SCSIO NS126 (Patent ZL202410857442.1) glycosyltransferase gene pie28Upstream of the gene, the transcription level of the gene is enhanced, aiming to increase the expression level of the glycoside transferase gene and achieve efficient production of pteropterin glycoside, providing a reliable preparation basis for its subsequent development.

[0006] The first objective of this invention is to provide a glycosyltransferase. pie28 It is characterized in that its nucleotide sequence is shown in SEQ ID NO.2.

[0007] A second objective of this invention is to provide an engineered strain that produces high levels of pyrodactylin, which is used to... Streptomyces psammoticus SCSIO NS126 glycosyltransferase gene pie28 Upstream import strong promoter kasO p * The strong promoter mentioned above kasO p * The nucleotide sequence is shown in SEQ ID NO.1, and the glycosyltransferase is described. ​ The nucleotide sequence is shown in SEQ ID NO.2.

[0008] Preferably, the engineered strain that produces high levels of pyrodactyl is... ​ sp. SK-kas28, this strain is deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), with accession number GDMCC NO. 67270, deposit date November 11, 2025, deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province.

[0009] The promoter ​ p* is derived from Streptomyces cerevisiae. ​ .

[0010] The glycosyltransferase ​ Derived from Streptomyces ​ SCSIONS126, this strain is deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC) with accession number GDMCC NO. 64524, deposit date of April 19, 2024, and address of Building 59, 5th Floor, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, and is disclosed in patent CN202410857442.1.

[0011] This invention also provides a method for constructing the above-mentioned high-yield pterostilbene engineered strain, comprising the following steps: [The text abruptly ends here, likely due to an incomplete sentence or missing information.] ​ SCSIO NS126 glycosyltransferase gene ​ Upstream import strong promoter ​ p * The strong promoter mentioned above ​ p *The nucleotide sequence is shown in SEQ ID NO.1, and the glycosyltransferase is described. ​ The nucleotide sequence is shown in SEQ ID NO.2.

[0012] Preferably, the specific steps are as follows:

[0013] a. Obtained by PCR ​ p* fragment, ​ Upstream and downstream homologous arm fragments, using ​ I enzyme and ​ III enzyme linearization vector pYH7;

[0014] b. ​ p* fragments, ​ Upstream and downstream homologous arms and linearized vector pYH7 were ligated by T4 ligase to obtain ligation product pYH7-KasOp-28.

[0015] c. Plasmid pYH7-KasOp-28 is introduced into competent cells of E. coli. ​ ET12567 / pUZ8002; Transfer of pYH7-KasOp-28 to Streptomyces via conjugation transfer ​ SCSIO NS126 was used to screen and obtain engineered strains.

[0016] This invention also provides a method for producing pteropterin using an engineered strain that produces high levels of pteropterin, comprising the following steps:

[0017] The engineered strain is fermented to produce pirimicatin, and the structural formula of pirimicatin is shown in any of the following: .

[0018] That is, 13-hydroxypiericidin A 10-O-α-D-glucose(1→6)-β-D-glucoside (6''Glc-13OH-GPA), 4'-O-β-D-glucosepiericidin A 10-O-α-D-glucose(1→6)-β-D-glucoside (6''Gal-4'Glc-GPA), piericidin A 10-O-β-D-glucoside(1→6)-α-D-galactose (6''Gal-GPA), 13-hydroxyglucopiericidinA (13OH-GPA), 4'-O-β-glucoseglucopiericidin A (4'Glc-GPA), 7-demethyl- 13-hydroxyglucopiericidin A (7DeMe-GPA), glucopiericidin A (GPA).

[0019] The fermentation medium is formulated as follows: per liter, it contains: 20 g soluble starch, 10 g cottonseed powder, 5 g yeast extract, 20 g maltodextrin, 5 g malt extract, 2 g MgSO4·7H2O, 2 g NaCl, 20 g CaCO3, 1 L water, and pH 7.0-7.2.

[0020] The fermentation process involves culturing at 28°C for 7 days.

[0021] This invention also provides the application of engineered strains that produce high levels of pyrotropin in the production of pyrotropin.

[0022] Compared with the prior art, the beneficial effects of the present invention are:

[0023] (1) This invention provides a method using a strong promoter ​ p * Insertion into glycosyltransferase ​ Upstream, to promote the production of pteropterin glycosides, the efficient synthesis of pteropterin glycosides was achieved. ​ and 2 ).

[0024] (2) This invention provides a genetically engineered strain capable of efficiently synthesizing pteropterin glycosides. ​ sp. SK-kas28, with a total yield of 32.35 mg / L of 7 pterocaryonin glycosides, compared to the publicly available wild-type producing strain. ​ The optimal yield of SCSIO NS126 (total yield of 7 glycosides 18.74 mg / L) was increased by 72.6%.

[0025] (3) The Streptomyces genetically engineered strains constructed in this invention ​ sp. SK-kas28 can efficiently express pteropterin glycosides and is widely used in the fermentation production of pteropterin glycosides for the research and development of new drugs for the treatment of kidney diseases.

[0026] ​ sp. SK-kas28 is deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC) with accession number GDMCC NO. 67270, deposited on November 11, 2025. The deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, 510070, China. Attached Figure Description

[0028] ​ A schematic diagram illustrating the construction of a pteropterin glycoside gene-engineered strain using glycosyltransferase and promoter engineering;

[0029] ​ This is a chemical structure diagram of the pterostilbene glycosides (6''Glc-13OH-GPA, 6''Gal-4'Glc GPA, 6''Gal-GPA, 13OH-GPA, 4'Glc-GPA, 7DeMe-GPA, GPA) used in this invention. Detailed Implementation

[0030] Those skilled in the art will understand that the techniques disclosed in the following embodiments represent those discovered by the inventors that work well in the practice of this invention. However, many changes can be made to the specific embodiments disclosed, still obtaining the same or similar results without departing from the spirit and scope of the invention.

[0031] Example 1

[0032] This embodiment developed a method for glycosyltransferases. ​ Upstream insertion of strong promoter ​ p * The method for constructing the homologous recombinant plasmid pYH7-KasOp-28, as described in this embodiment, specifically includes the following steps:

[0033] (1) Design upstream primer: TGTTCACATTCGAACGGTCTCTGC and downstream primer AACTCCCCCAGTCCTGCACG, to ​ Using genomic DNA as a template, the promoter is amplified. ​The p-fraction was then excised and gel-recovered. Upstream primers were designed: AGGCGAATACTTCATATGcggggacatgaccatgatcc and downstream primers: AGACCGTTCGAATGTGAACAcgcttgctcagttaccggca, for use with Streptomyces. ​ Using SCSIO NS126 genomic DNA as a template, amplification ​ The upstream homologous arm fragment was excised and gel-recovered. Upstream primers were designed: GTGCAGGACTGGGGGAGTTttccccatgtcccgctcct and downstream primers: CTGCAGGCATGCAAGCTTggaccgccagggtcaacgtgac, using Streptomyces. ​ Using SCSIO NS126 genomic DNA as a template, amplification ​ Downstream homologous arm fragments are cut and recycled.

[0034] (2) The PYH7 vector (published in Microbiology (2006), 152, 3507–3515) was used... ​ I enzyme and ​ The sample was double-digested with enzyme III, and then gelled and recovered after being incubated in a water bath at 37°C for 2.5 h.

[0035] (3) ​ p* fragments, ​ Upstream and downstream homologous arms and linearized PYH7 vector were ligated at 16℃ for 8 h using T4 ligase to obtain the ligation product pYH7-KasOp-28.

[0036] (4) Take one Escherichia coli DH5α competent cell and thaw it on ice. Add the ligation product from (3) to the competent cell, mix gently and incubate on ice for 30 min. Heat shock at 42℃ for 90 s and then incubate on ice for 2 min. Add 500 uL LB liquid medium and incubate at 37℃ and 200 rpm for 1 h.

[0037] (5) The competent cells transformed with the ligation product were spread on LB plates containing apramycin (100 mg / L), dried, and cultured at 37°C for 16 h.

[0038] (6) Pick a single colony from the plate and inoculate it into LB liquid medium containing apramycin (100 mg / L) and incubate overnight in a shaking incubator (37°C, 200 rpm).

[0039] (7) Send the overnight cultured bacterial solution for sequencing to screen for the correct plasmid.

[0040] (8) Based on the sequencing results, plasmid pYH7-KasOp-28 was extracted using a plasmid extraction kit.

[0041] Example 2

[0042] This embodiment constructs an Escherichia coli parent strain for transforming plasmid pYH7-KasOp-28 into Streptomyces. This embodiment specifically includes the following steps:

[0043] (1) Take 1 piece ​ ET12567 / pUZ8002 competent cells were thawed on ice, and 2 μL of plasmid pYH7-KasOp-28 was added and incubated on ice for 30 min. After heat shock at 42°C for 90 s, the cells were incubated on ice for another 2 min. 500 μL of LB liquid medium was added and the cells were incubated at 37°C and 200 rpm for 1 h.

[0044] (2) Competent cells transformed with plasmid pYH7-KasOp-28 were plated on LB plates containing apramycin (100 mg / L), kanamycin (50 mg / L) and chloramphenicol (25 mg / L), dried, and cultured at 37°C for 16 h.

[0045] (3) Pick a single colony from the plate and inoculate it into LB liquid medium containing apramycin (100 mg / L), kanamycin (50 mg / L) and chloramphenicol (25 mg / L), and incubate in a shaking incubator for 12 h (37℃, 200 rpm).

[0046] (4) Using bacterial culture as a template, PCR was performed with upstream primer caaccacatctacgtcgtcc and downstream primer ctggaggtggcctgtgcctg to verify whether pYH7-KasOp-28 was successfully transformed. ​ ​ ET12567 / pUZ8002 was used to obtain plasmid pYH7-KasOp-28. ​ ET12567 / pUZ8002.

[0047] Example 3

[0048] This embodiment provides the plasmid pYH7-KasOp-28 obtained in Example 2. ​ ​ ET12567 / pUZ8002 was used as the parent, and plasmid pYH7-KasOp-28 was transferred into the embryo via conjugation transfer. ​ In sp.SCSIO NS126, and through homologous recombination, the pYH7-KasOp-28 carried by it... ​ p * Insert into​ In the genome of sp. SCSIO NS126 ​ Upstream, thereby obtaining genetically engineered strains that produce high levels of pteropterin glycosides. ​ Implementation of sp. SK-kas28.

[0049] This embodiment specifically includes the following steps:

[0050] (1) Preparation of Streptomyces spores: ​ The spores of sp. SCSIO NS126 were scraped off with a sterile bamboo stick, added to LB liquid medium, vortexed to disperse the spores, incubated in a 50 ℃ water bath for 10 min, and then cultured in a shaker for 4–6 h (28 ℃, 200 rpm).

[0051] (2) Conjugation transfer: Streptomyces SCSIO NS126 spores and those from Example 2 were transferred together. ​ ​ ET12567 / pUZ8002 bacterial cells, thoroughly mixed, were coated onto a substrate containing Mg. 2+ The culture medium was incubated at 28°C for 20 h.

[0052] (3) Conjugate screening: 20 h after conjugate transfer, the entire culture dish was fully covered with 1 mL of sterile water containing 1 mg of trimethoprim and 1 mg of apramycin, dried in a laminar flow hood, and incubated at 28 °C.

[0053] (4) Promoter insertion verification screening: 5–7 days after conjugation transfer, growing conjugates were picked and streaked onto MS plates supplemented with trimethoprim (50 mg / L) and apramycin (100 mg / L). The plates were incubated at 28°C until the conjugates grew. Colony PCR was performed using the upstream primer gcagaaccggacgaagcgtc and the downstream primer ctggaggtggcctgtgcctg to screen the colonies. ​ p * Promoter successfully inserted ​ The positive clones upstream are engineered strains. ​ sp. SK-kas28.

[0054] engineered strains ​ sp. SK-kas28 is deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC) with accession number GDMCC NO. 67270, deposited on November 11, 2025. The deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province, 510070, China.

[0055] Example 4

[0056] This embodiment provides the use of engineered strains.​ Production method of pterocaryonin glycosides by sp. SK-kas28.

[0057] 4.1) Fermentation method of strain

[0058] engineered strains ​ Sp. SK-kas28 was cut into pieces and inoculated into seed culture medium (D-mannitol 20g, soybean peptone 10g, soybean oil 2.5g, dipotassium hydrogen phosphate 0.35g, water 1L, pH 7.0, mixed thoroughly and sterilized for later use), and cultured at 28℃ and 200 rpm for 48 h to obtain seed liquid; 3% by volume of seed liquid was inoculated into fermentation medium (soluble starch 20g, cottonseed meal 10g, yeast extract 5g, maltodextrin 20g, malt extract 5g, anhydrous magnesium sulfate 2g, sodium chloride 2g, calcium carbonate 2g, water 1L, pH 7.0-7.2, mixed thoroughly and sterilized for later use), and cultured at 28℃ and 200 rpm for 7 days. ​ sp. SCSIO NS126 was treated in the same way as a control.

[0059] 4.2) Extraction and yield detection of pteropterin glycosides:

[0060] engineered strains ​ sp. SK-KAS28 or ​On day 7 of fermentation of sp. SCSIO NS126, the fermentation broth was extracted with an equal volume of ethyl acetate and sonicated for 25 min. The supernatant was then evaporated and concentrated to obtain an extract. The extraction of the effective fraction of pteropterin glycosides and the isolation and identification of pteropterin glycosides were consistent with the implementation scheme of the published patent (ZL202410857442.1). The seven piericidin glycosides disclosed in the patent (ZL202410857442.1) are 13-hydroxypiericidin A 10-O-α-D-glucose(1→6)-β-D-glucoside (6''Glc-13OH-GPA), 4'-O-β-D-glucosepiericidin A 10-O-α-D-glucose(1→6)-β-D-glucoside (6''Gal-4'Glc-GPA), piericidin A 10-O-β-D-glucoside(1→6)-α-D-galactose (6''Gal-GPA), 13-hydroxyglucopiericidin A (13OH-GPA), 4'-O-β-glucose glucopiericidin A (4'Glc-GPA), and 7-demethyl-13-hydroxyglucopiericidin A. (7DeMe-GPA), glucopiericidin A(GPA), chemical structures as follows ​ As shown in Table 1, the individual yields and total yields of pteropterin glycosides were calculated.

[0061] Under the same conditions, engineered strains ​ The total yield of sp. SK-kas28 pteropterin glycosides (the total amount of the above 7 glycosides) was 32.35 mg / L, which is higher than that of the publicly reported wild-type producing strain. ​ The optimal yield of SCSIONS126 (total yield of 7 glycosides 18.74 mg / L) was increased by 72.6%.

[0062] Table 1. Yields of pterocaryonin glycosides in engineered strain SK-kas28 and original strain SCSIO NS126

[0063] The specific amino acid and nucleotide sequences involved in the invention are as follows:

[0064] SEQ ID NO.1: TGTTCACATTCGAACGGTCTCTGCTTTGACAACATGCTGTGCGGTGTTGTAAAGTCGTGGCCAGGAGAATACGACAGCGTGCAGGACTGGGGGAGTT

[0065] SEQ ID NO.2:

Claims

1. A glycoside transferase pie28 Its characteristics are, Its nucleotide sequence is shown in SEQ ID NO.

2.

2. An engineered strain that produces high levels of pyrodactylin, characterized in that, Is towards Streptomyces psammoticus SCSIO NS126 glycosyltransferase gene pie28 Upstream import strong promoter kasO p * The strong promoter mentioned above kasO p * The nucleotide sequence is shown in SEQ ID NO.1, and the glycosyltransferase is described. pie28 The nucleotide sequence is shown in SEQ ID NO.

2.

3. The engineered strain according to claim 2, characterized in that, The engineered strain that produces high levels of pyrodactyl is Streptomyces sp. SK-kas28, accession number GDMCC NO. 67270.

4. A method for constructing an engineered strain that produces high levels of cyclophosphamide as described in claim 2, characterized in that, Includes the following steps: Towards Streptomyces psammoticus SCSIO NS126 glycosyltransferase gene pie28 Upstream import strong promoter kasO p * The strong promoter mentioned above kasO p * The nucleotide sequence is shown in SEQ ID NO.1, and the glycosyltransferase is described. pie28 The nucleotide sequence is shown in SEQ ID NO.

2.

5. The construction method according to claim 4, characterized in that, The specific steps are as follows: a. Obtained by PCR kasO p* fragment, pie28 Upstream and downstream homologous arm fragments, using Nde I enzyme and Hind III enzyme linearization vector pYH7; b. kasO p* fragments, pie28 Upstream and downstream homologous arms and linearized vector pYH7 were ligated by T4 ligase to obtain ligation product pYH7-KasOp-28. c. Plasmid pYH7-KasOp-28 is introduced into competent cells of E. coli. Escherichia coli ET12567 / pUZ8002; Transfer of pYH7-KasOp-28 to Streptomyces via conjugation transfer Streptomyces psammoticus SCSIO NS126 was used to screen and obtain engineered strains.

6. A method for producing pterostilbene using the engineered strain with high pterostilbene production as described in claim 2 or 3, characterized in that, Includes the following steps: The engineered strain is fermented to produce pirimicatin, and the structural formula of pirimicatin is shown in any of the following: 。 7. The method according to claim 6, characterized in that, The fermentation medium is formulated as follows: per liter, it contains: 20 g soluble starch, 10 g cottonseed powder, 5 g yeast extract, 20 g maltodextrin, 5 g malt extract, 2 g MgSO4·7H2O, 2 g NaCl, 20 g CaCO3, 1 L water, and pH 7.0-7.

2.

8. The method according to claim 7, characterized in that, The fermentation process involves culturing at 28°C for 7 days.

9. The application of the engineered strain of high-yield pyrotropin according to claim 2 or 3 in the production of pyrotropin, wherein the structural formula of the pyrotropin is shown in any of the following: 。

Images