A high-efficiency induction method of sugarcane hairy roots based on WIND1-ruby

By using Agrobacterium rhizogenes co-expressing WIND1 and the Ruby reporter gene at the base of sugarcane shoots, the problem of sugarcane hairy root induction was solved, achieving efficient and simple hairy root induction and visual screening, which is suitable for sugarcane gene function research and secondary metabolite production.

CN121975859BActive Publication Date: 2026-06-26SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610449970.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-04-08
Publication Date
2026-06-26
Estimated Expiration
2046-04-08

AI Technical Summary

Technical Problem

The sugarcane hairy root induction system is difficult to establish in sugarcane. Existing methods are cumbersome to operate, have unstable transformation efficiency, and positive identification is time-consuming and labor-intensive. Traditional methods rely on destructive molecular techniques, making it difficult to achieve efficient and visual screening.

Method used

A co-expressing Agrobacterium rhizogenes containing WIND1 and Ruby reporter genes was used to infect the bud base of sugarcane stem segments. Direct treatment was performed via injection to optimize the concentration of the inoculum. WIND1 was used to promote cell dedifferentiation and root primordia formation at the wound site, combined with visual screening using the Ruby reporter gene.

Benefits of technology

It achieves efficient induction of sugarcane hairy roots, simplifies the operation process, improves conversion efficiency, enables visual screening, is applicable to different sugarcane varieties, shortens the cycle, and provides a stable technical platform.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121975859B_ABST
    Figure CN121975859B_ABST
Patent Text Reader

Abstract

The application provides a high-efficiency sugarcane hairy root induction method based on WIND1-Ruby, and belongs to the field of plant biotechnology.The method is to use co-expression Agrobacterium rhizogenes containing WIND1 and Ruby reporter genes to infect the bud base of sugarcane node segments with germination buds, and through culture and induction, positive sugarcane hairy roots are obtained.The Ruby reporter gene in the vector used in the application can make the induced hairy roots present a characteristic ruby red color, realizing the visualization of the transformation event, and the positive hairy roots can be quickly identified without complex staining or molecular detection.The application further introduces the WIND1 transcription factor in the vector, significantly overcoming the technical obstacles of weak regeneration ability and low transformation efficiency of the sugarcane bud base.The sugarcane hairy root induction system established by the application has the advantages of simple operation, high transformation efficiency, visual screening, short cycle and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant biotechnology and relates to an efficient method for inducing hairy roots in sugarcane based on WIND1-Ruby. Background Technology

[0002] sugar cane( Saccharum officinarum Sugarcane is a globally important sugar and energy crop. Its genome is large and complex, making genetic transformation difficult and severely hindering the progress of functional genomics research and molecular breeding. The hairy root culture system utilizes Agrobacterium rhizogenes (…). Agrobacterium rhizogenes The numerous adventitious roots produced after infecting plants are characterized by rapid growth, hormone autonomy, genetic stability, and strong ability to synthesize secondary metabolites. They are ideal materials for studying gene function, root biology, plant-microbe interactions, and the production of secondary metabolites.

[0003] Currently, hairy root induction systems have been successfully established in various plants, such as cotton and soybean. However, no reports have been made on hairy root induction systems for sugarcane, an important crop. The reason for this is that sugarcane tissues throughout the plant (including stem segments, leaves, and bud bases) generally suffer from poor regeneration capacity, insensitivity to Agrobacterium infection, and difficulty in stable transformation of induced adventitious roots. In particular, when bud bases are used as explants, their cells are in a relatively quiescent state, making it difficult to initiate root primordia differentiation, resulting in extremely low or unstable transformation efficiency using existing methods. Current methods often use explants such as leaves and stem segments for co-culture, which suffers from cumbersome operations, unstable transformation efficiency, and time-consuming and labor-intensive positive identification.

[0004] Furthermore, traditional identification of positive hairy roots typically relies on molecular techniques such as PCR and GUS staining, which are not only time-consuming but also destructive. In recent years, the emergence of visual reporter genes such as Ruby has provided new possibilities for real-time, non-destructive monitoring of transgenic events. The Ruby gene enables transformed tissues to accumulate betalains, exhibiting a bright red color, greatly facilitating the screening of positive materials.

[0005] However, in previous studies, our team found that using only Agrobacterium rhizogenes carrying the Ruby reporter gene to treat the base of sugarcane buds did not result in ideal hairy root induction efficiency, indicating that there is an inherent regeneration barrier at the base of sugarcane buds.

[0006] Therefore, it is necessary to establish a simple, efficient, and visually screenable method for inducing sugarcane hairy roots, which is of great significance for promoting basic research on sugarcane and the application of biotechnology. Summary of the Invention

[0007] To address the above problems, this invention provides a highly efficient method for inducing hairy roots in sugarcane based on WIND1-Ruby.

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0009] A method for efficient induction of sugarcane hairy roots based on WIND1-Ruby is described. The method involves infecting the bud base of sugarcane stem segments with budding shoots with Agrobacterium rhizogenes containing co-expressed WIND1 and Ruby reporter genes, followed by culture and induction to obtain positive sugarcane hairy roots.

[0010] The co-expressing Agrobacterium rhizogenes containing the WIND1 and Ruby reporter genes was obtained by introducing a vector containing the WIND1 and Ruby reporter genes into Agrobacterium rhizogenes.

[0011] The vector containing WIND1 and the Ruby reporter gene is a plant binary expression vector with a pCAMBIA1302 backbone, the T-DNA region containing only the Ruby reporter gene expression cassette driven by the MAS promoter, and the WIND1 transcription factor coding sequence driven by another CaMV 35S promoter.

[0012] The sequence of the coding region of the Ruby gene is shown in SEQ ID NO: 1;

[0013] The sequence of the coding region of the WIND1 gene is shown in SEQ ID NO: 2.

[0014] Furthermore, the method includes the following specific steps:

[0015] Agrobacterium rhizogenes containing co-expressed WIND1 and Ruby reporter genes was activated and cultured to obtain an infected bacterial solution;

[0016] Select sugarcane stem segments with sprouting buds;

[0017] The infecting bacterial solution was inoculated at the base of the buds on sugarcane stem segments;

[0018] The inoculated sugarcane stem segments were cultured to induce the production of hairy roots from the inoculation site.

[0019] Furthermore, the OD of the infected bacterial solution 600 It ranges from 0.6 to 0.8.

[0020] Furthermore, the specific preparation process of the infecting bacterial solution is as follows:

[0021] Strain activation: Agrobacterium rhizogenes co-expressing the WIND1 and Ruby reporter genes was streaked on a solid plate and incubated upside down;

[0022] Liquid culture: Pick a single colony and inoculate it into liquid culture medium, then incubate overnight with shaking;

[0023] Expanded culture and collection: Transfer the overnight culture to liquid culture medium and continue culturing. Centrifuge the resulting bacterial solution and discard the supernatant.

[0024] Resuspension: The bacterial pellet was resuspended in infection buffer [1 / 2 MS liquid medium (pH 5.6) containing 100 μM acetylsuccinone and 10 mM 2-morpholinoethanesulfonic acid], and the OD was adjusted accordingly. 600 After standing and activating, the infected bacterial solution is obtained.

[0025] Furthermore, during the extended culture and collection process, the overnight culture was further cultured in liquid medium until OD (October Expiratory Time). 600 The value reaches 0.4~1.0.

[0026] Furthermore, the specific process for obtaining the vector containing the WIND1 and Ruby reporter genes is as follows: Using a plasmid containing the Ruby reporter gene as a template, the coding region of the Ruby gene is amplified. After double digestion with NcoI and BstEII, the amplification product is inserted between the MAS promoter and NOS terminator of the pCAMBIA1302 backbone using seamless cloning technology to construct the p1302-Ruby vector. Then, the p1302-Ruby vector is digested with XhoI restriction endonuclease to remove the original HygR selection marker gene. Next, using a plasmid containing the Arabidopsis thaliana AtWIND1 coding sequence as a template, the coding region of the WIND1 gene is amplified. The linearized vector is seamlessly cloned and ligated with the WIND1 amplification product, so that the WIND1 gene replaces the original HygR selection marker, and is placed under the drive of the dual CaMV 35S promoter to obtain the p1302-WIND1-Ruby vector.

[0027] Furthermore, the Agrobacterium rhizogenes strain is K599 or other suitable Agrobacterium rhizogenes strains.

[0028] Furthermore, a method for infecting the base of the buds of sugarcane stem segments with budding shoots is to inject an infection solution containing co-expressed Agrobacterium rhizogenes containing WIND1 and Ruby reporter genes into the tissue at the base of the bud using a microsyringe.

[0029] Sugarcane varieties include, but are not limited to, ROC22, GT42, LC05-136, and LC1541;

[0030] The cultivation conditions are: temperature 25~28℃, relative humidity 70~80%, and photoperiod of 16h light / 8h darkness.

[0031] The beneficial effects of the efficient sugarcane hairy root induction method based on WIND1-Ruby of the present invention are as follows:

[0032] This invention introduces the WIND1 (WOUND INDUCED DEDIFFERENTIATION 1) transcription factor into a vector carrying the Ruby reporter gene. WIND1 is a key regulator of plant wound-induced dedifferentiation, which can activate the cytokinin signaling pathway and promote callus formation and root primordia development. This invention is the first to co-express WIND1 and the Ruby reporter gene in Agrobacterium rhizogenes, and through synergistic effects, it significantly overcomes the technical bottleneck of inducing hairy roots at the base of sugarcane shoots.

[0033] Compared with existing technologies, this invention overcomes the technical problem of sugarcane bud base regeneration barrier: the whole sugarcane tissue regeneration ability is poor, especially the bud base is difficult to induce hairy roots. This invention introduces the WIND1 transcription factor into the sugarcane hairy root induction system for the first time, and uses the ability of WIND1 to promote cell dedifferentiation and root primordia formation at the wound site to break through the key technical bottleneck of the difficulty in inducing hairy roots at the sugarcane bud base from the mechanism, and achieves efficient transformation.

[0034] Highly targeted and easy to operate: This invention is the first to use the injection method to directly treat the buds of sugarcane nodes. Compared with the traditional explant co-culture method, it eliminates the cumbersome steps of explant preparation, disinfection, and co-culture, making the operation simpler and faster.

[0035] High conversion efficiency: This invention optimizes the concentration of the infecting bacterial solution, making it achieve high conversion efficiency at OD. 600 The induction efficiency was optimal at a coefficient of 0.6-0.8, and the method was found to be well-suited for various sugarcane varieties (such as ROC22, GT42, LC05-136, and LC1541). Co-expression of WIND1 and Ruby significantly improved the transformation efficiency compared to the control group using only the Ruby vector.

[0036] Visual screening: This invention introduces a Ruby reporter gene, which makes successfully transformed hairy roots exhibit a characteristic ruby ​​red color; this feature allows researchers to visually, quickly, and non-destructively screen positive hairy roots in the early stages of induction without any staining or molecular detection, greatly improving screening efficiency and accuracy.

[0037] Broad application prospects: This invention provides an efficient, stable, and visualized technical platform for sugarcane gene function research (such as root development and stress resistance gene verification), secondary metabolite production, and variety improvement using gene editing technologies such as CRISPR / Cas9.

[0038] This invention optimizes the concentration (OD) of Agrobacterium rhizogenes infection solution. 600The method was validated and its applicability to different sugarcane main varieties was verified. In particular, the Ruby reporter gene in the vector used in this invention enables the induced hairy roots to exhibit a characteristic ruby ​​red color, realizing the visualization of transformation events and allowing for rapid identification of positive hairy roots without complex staining or molecular detection. Furthermore, this invention significantly overcomes the technical obstacles of weak regeneration ability and low transformation efficiency of sugarcane bud base by introducing the WIND1 transcription factor into the vector. The sugarcane hairy root induction system established in this invention has the advantages of simple operation, high transformation efficiency, visual screening, and short cycle, providing an efficient and stable technical platform for sugarcane gene function research, secondary metabolite production, and variety improvement. Attached Figure Description

[0039] Figure 1 This is a schematic diagram of the p1302-Ruby carrier structure in Embodiment 1 of the present invention;

[0040] Figure 2 This is the result of efficient induction of sugarcane hairy roots based on WIND1-Ruby in Example 1 of the present invention. Figure a is a schematic diagram of the p1302-Ruby vector structure, showing the basic elements of the T-DNA region of the p1302-Ruby vector; Figure b is a graph showing the changes of hairy roots over time after injection, showing the occurrence of hairy roots at the base of sugarcane nodes and the appearance of the Ruby red phenotype at 0, 8, 10 and 15 days after injection; Figure c is a comparison of the induction efficiency (i.e., hairy root induction rate) after infection of the bacterial solution containing the WIND1-Ruby vector and the bacterial solution containing the p1302-Ruby vector, where the induction efficiency of the bacterial solution containing the p1302-Ruby vector was increased by 2.5 times.

[0041] Figure 3 This invention presents the induction results of a highly efficient sugarcane hairy root induction method based on WIND1-Ruby. Figure a shows the PCR identification results of red hairy roots and unconverted sugarcane root tissue in Example 1, where M is the marker, CK is the water control, T1, T2, and T3 are the identification results of red hairy roots, and N1, N2, and N3 are the identification results of unconverted sugarcane root tissue. Figure b shows the induction results of different OD values ​​in Example 2. 600 The effect of bacterial inoculation values ​​(0.4, 0.6, 0.8, 1.0) on the induction rate of hairy roots; Figure c shows the induction efficiency results for different sugarcane varieties, specifically at the optimal OD value (OD). 600 =0.8), the method of the present invention was used to statistically analyze the induction efficiency of four different sugarcane main varieties (ROC22, GT42, LC05-136, LC1541). Detailed Implementation

[0042] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can also be implemented in other ways different from those described herein. Those skilled in the art can make similar extensions without departing from the spirit of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below. The present invention will be further described in detail below with reference to specific embodiments to enable those skilled in the art to understand it.

[0043] Furthermore, for specific techniques or conditions not specified in the detailed embodiments disclosed below, please refer to the techniques or conditions described in the literature in this field (e.g., refer to *Molecular Cloning: A Laboratory Manual*, 3rd edition, translated by Sambrook et al., Science Press) or the product instructions. Reagents whose manufacturers are not specified are all commonly available products.

[0044] Materials and Methods:

[0045] Plant materials: Healthy stem segments of the main sugarcane varieties ROC22, GT42, LC05-136, and LC1541.

[0046] Strains and vectors: Agrobacterium rhizogenes strain K599, and a plant expression vector containing the WIND1-Ruby reporter gene (structure shown in figure). Figure 2 (As shown in Figure a). Vector construction and transformation of Agrobacterium are routine techniques in this field.

[0047] Main reagents: YEB medium, antibiotics (such as kanamycin, streptomycin, etc., selected according to the resistance of the vector and strain), acetylsuccinone (AS), etc.

[0048] Example 1: A Highly Efficient Method for Inducing Hairy Roots in Sugarcane Based on WIND1-Ruby

[0049] This embodiment describes a highly efficient method for inducing hairy roots in sugarcane based on WIND1-Ruby, comprising the following specific steps:

[0050] S1. Carrier Construction:

[0051] The vector used in this invention is a plant binary expression vector based on the pCAMBIA1302 backbone. The control vector is named p1302-Ruby, whose T-DNA region contains only the Ruby reporter gene expression cassette driven by the MAS promoter (containing genes related to betalain synthesis). The construction method of the control vector p1302-Ruby is as follows: using a plasmid containing the Ruby reporter gene as a template, the Ruby gene coding region (the sequence of the Ruby gene coding region is shown in SEQ ID NO: 1) is amplified using seamless cloning primers Ruby-F (ATACACCAAATCGCCatggatcatgcgaccctc) and Ruby-R (AATTCGAGCTGGTCACCtcactatcactggaggct). After double digestion with NcoI and BstEII, the amplification product is inserted between the MAS promoter and NOS terminator of the pCAMBIA1302 backbone using seamless cloning technology to construct the p1302-Ruby vector (structure shown in SEQ ID NO: 1). Figure 1 (As shown).

[0052] The vector backbone used in this invention is pCAMBIA1302, which was modified to obtain two binary expression vectors. The experimental vector was named p1302-WIND1-Ruby, whose T-DNA region contains a Ruby reporter gene expression cassette driven by the MAS promoter, and a WIND1 transcription factor coding sequence (derived from Arabidopsis thaliana AtWIND1) driven by another CaMV 35S promoter. The experimental vector p1302-WIND1-Ruby is based on the p1302-Ruby vector with the WIND1 transcription factor further introduced. The specific construction process is as follows: First, the p1302-Ruby vector was digested with XhoI restriction endonuclease to remove the original HygR selection marker gene; then, using a plasmid containing the Arabidopsis thaliana AtWIND1 coding sequence as a template, the coding region of the WIND1 gene was amplified using seamless cloning primers Wind-F (tacaaatctatctctctcgagATGGCAGCTGCTATGAATTT) and Wind-R (attattatggagaaactcgagAGCTAGAATCGAATCCCAATCGATCTC) (the sequence of the WIND1 gene coding region is shown in SEQ ID NO: 2); the linearized vector was seamlessly cloned and ligated with the WIND1 amplification product, so that the WIND1 gene replaced the original HygR selection marker and was placed under the dual CaMV 35S promoter drive. The positive clone verified by sequencing was named p1302-WIND1-Ruby vector (structure shown in...). Figure 2 (as shown in Figure a).

[0053] The p1302-Ruby vector and the p1302-WIND1-Ruby vector were introduced into Agrobacterium rhizogenes strain K599 by electroporation, respectively. The corresponding positive clones (i.e. Agrobacterium rhizogenes K599 containing the p1302-Ruby vector and Agrobacterium rhizogenes K599 containing the p1302-WIND1-Ruby vector) were obtained by kanamycin and streptomycin screening and PCR identification, and stored at -80℃ for later use.

[0054] S2. Preparation of Agrobacterium rhizogenes bacterial culture:

[0055] S21. Strain activation: Agrobacterium rhizogenes K599 containing the p1302-Ruby vector and Agrobacterium rhizogenes K599 containing the p1302-WIND1-Ruby vector, stored at -80℃, were streaked on YEB solid plates containing 50 mg / L kanamycin (or other appropriate antibiotics) and incubated upside down at 28℃ for 2 days.

[0056] S22. Liquid culture: Pick the corresponding single colony and inoculate it into 5 mL of YEB liquid medium containing 50 mg / L kanamycin (or other corresponding antibiotics), and culture overnight at 28°C and 220 rpm with shaking.

[0057] S23. Expanded Culture and Collection: Transfer 1 mL of the corresponding overnight culture to 50 mL of fresh YEB liquid medium (containing 50 mg / L kanamycin and 20 mg / L acetylsalicylic acid) and continue culturing until OD. 600 Approximately 0.8. Transfer the resulting bacterial culture to a sterile centrifuge tube, centrifuge at 5000 rpm for 10 min at room temperature, and discard the supernatant.

[0058] S24. Resuspension: Resuspend the corresponding bacterial pellets in 1 / 2 MS liquid medium (pH 5.6) containing 100 μM acetylsuccinone and 10 mM 2-morpholinoethanesulfonic acid, and adjust the OD values ​​accordingly. 600 The concentration was increased to 0.8, and the mixture was allowed to stand at room temperature for 1-2 hours to activate it before use, thus obtaining the corresponding infecting bacterial solution.

[0059] S3. Preparation of plant materials:

[0060] Select healthy, disease-free sugarcane stalk segments and cultivate them until the buds at the nodes sprout. Cut the segments into segments containing a single bud. Place the segments in a moist vermiculite or sand bed to promote sprouting. Once the buds have sprouted to 1-2 cm, they are ready for use. Each treatment group has 30 independent replicates (i.e., 30 sugarcane node buds), and the experiment is independently replicated 3 times.

[0061] S4, Injection Infection:

[0062] Aspirate the appropriate bacterial inoculum using a 1 mL sterile syringe (equipped with a 30G needle). Select the junction between the bud base and the stem node, gently insert the needle into the tissue, and slowly inject the bacterial inoculum until a noticeable infiltration sensation is felt at the injection site. Treat 30 sugarcane buds (using ROC22 variety) for each concentration. Buds injected with sterile culture medium serve as negative controls.

[0063] S5. Cultivation and Induction:

[0064] Each injected sugarcane segment was placed in an artificial climate chamber for cultivation, with a temperature of 28℃, humidity of 75%, and a photoperiod of 16 hours of light / 8 hours of darkness. Regular observation and moisturizing were maintained to prevent the segments from drying out.

[0065] S6. Observation Results:

[0066] Starting from the 8th day after injection, the occurrence and color changes of the hairy roots were continuously observed. Specific changes are as follows: Figure 2 As shown in Figure b, it can be seen that on day 8 post-injection, white root primordia protrusions began to appear at the injection site in both treatment groups; by day 15, the hairy roots in both groups had significantly elongated. Specifically, about 8 days post-injection, white or pale yellow root primordia protrusions could be observed at the injection site. As the culture time increased (10-15 days), the roots continued to elongate. In particular, betaine began to accumulate in the successfully transformed hairy roots, with the color gradually spreading from the base to the root tip, eventually turning the entire root a bright ruby ​​red. In contrast, the callus or adventitious roots that may have formed at the wound sites of untransformed or control treatments (injected with sterile culture medium) remained white or yellowish-brown, never showing red.

[0067] S7. Induction Rate Statistics and Results:

[0068] On day 15 post-injection, the induction of hairy roots in both treatment groups was statistically analyzed. Simultaneously, the positive hairy root rate was calculated based on whether the hairy roots exhibited a ruby-red color. All data are expressed as mean ± standard deviation (SD), and Student's t-test was used for significance analysis (P < 0.05 was considered statistically significant). The specific calculation method is as follows:

[0069] Hairy root induction rate (%) = (number of sugarcane segments that produced hairy roots / total number of injected segments) × 100%.

[0070] The percentage of positive hairy roots (%) is calculated as follows: (Number of hairy root segments showing red color / Total number of injected segments) × 100%.

[0071] Among them, the results of hairy root induction rate are as follows: Figure 2As shown in Figure c, the hairy root induction rate in the control group (Ruby only) was 20.4% ± 2.6%, while the hairy root induction rate in the experimental group (Ruby-WIND1 co-expression) was as high as 51.8% ± 5.4%, approximately 2.5 times higher than the control group, a statistically significant difference (P < 0.01). Simultaneously, the positive hairy root rate results showed that the proportion of positive hairy roots (appearing ruby ​​red) was significantly higher in the experimental group than in the control group, indicating that the introduction of WIND1 not only increased the frequency of hairy root occurrence but also promoted the success rate of transgenic events.

[0072] S8. Molecular Verification:

[0073] To further confirm the relationship between the red color and transformation, red hairy roots, white hairy roots (if present), and untransformed sugarcane root tissues were excised, and DNA was extracted. PCR amplification was performed using Ruby gene-specific primers (JD-Ruby-1F: GCTTTCCGATCATCGGCAAC; JD-Ruby-1R: CTTTGAACTCTTGGCTGGTATGG). The amplified products were separated by 1.5% agarose gel electrophoresis at 120V for 30 min. The gel imaging system was used to observe and photograph the results. Figure 3 As shown in Figure a.

[0074] The PCR amplification system consisted of: 10 μL of 2×Novazia P525 Mix (Vazyme #P525); 0.8 μL of JD-Ruby-1F (10 μM); 0.8 μL of JD-Ruby-1R (10 μM); 1 μL of template DNA (approximately 50 ng); and ddH2O to a final volume of 20 μL.

[0075] The PCR amplification program was as follows: pre-denaturation at 95℃ for 3 min; then 35 cycles, each cycle consisting of denaturation at 95℃ for 15 sec, annealing at 54℃ for 15 sec, extension at 72℃ for 30 sec; after the cycle, final extension at 72℃ for 5 min, and finally incubation at 4℃.

[0076] Depend on Figure 3 As shown in Figure a, the expected 450bp specific band was amplified only in the ruby-red hairy root DNA sample, while no target band appeared in the untransformed sugarcane root tissue. This confirms that the Ruby reporter gene has been stably integrated into the red hairy root genome, verifying the reliability of the visual screening.

[0077] Example 2: Hairy root induction with different OD values

[0078] This embodiment employs a highly efficient sugarcane hairy root induction method based on WIND1-Ruby for different OD values. 600The infecting bacterial suspensions were screened as follows:

[0079] This embodiment uses *Agrobacterium rhizogenes* K599 containing the p1302-WIND1-Ruby vector obtained in step S1 of Example 1. The *Agrobacterium rhizogenes* bacterial suspension was prepared according to the method in Example 1, with the only difference being that during the resuspension process, the bacterial precipitate was resuspended in 1 / 2 MS liquid medium (pH 5.6) containing 100 μM acetylsuccinone and 10 mM 2-morpholinoethanesulfonic acid, and the OD was adjusted accordingly. 600 After activating at room temperature for 1-2 hours to 0.4, 0.6, 0.8, and 1.0, different OD values ​​were obtained. 600 The inoculum solutions were then injected according to the method in Example 1, with each concentration treating 20-30 sugarcane buds (using ROC22 variety as material). Buds injected with sterile culture medium were used as a negative control. After injection, the buds were cultured and induced for 15 days according to the method in Example 1. Approximately 15 days after injection, the induction of hairy roots was observed and statistically analyzed. The induction rate was calculated as the percentage of segments with roots generated at the injection site out of the total number of injected segments. The results are as follows: Figure 3 As shown in Figure b, it can be seen that OD 600 The treatment groups with values ​​of 0.6 and 0.8 showed the highest induction efficiency, significantly higher than the treatment groups with values ​​of 0.4 and 1.0, indicating that the optimal OD value for the infecting bacterial culture was [value missing]. 600 It ranges from 0.6 to 0.8.

[0080] Example 3: Induction of hairy roots in different sugarcane varieties

[0081] This embodiment employs a highly efficient sugarcane hairy root induction method based on WIND1-Ruby to induce hairy roots in different sugarcane varieties, as detailed below:

[0082] This embodiment uses Agrobacterium rhizogenes K599 containing the p1302-WIND1-Ruby vector obtained in step S1 of Example 1, and prepares the infection solution according to the method in Example 1;

[0083] Germinating shoots from four different sugarcane main varieties (ROC22, GT42, LC05-136, LC1541) were selected as injection materials, with 20-30 replicates for each variety treatment.

[0084] Following the method described in Example 1, the inoculated materials of the four different sugarcane varieties were infected using an inoculating bacterial solution, with buds injected into sterile culture medium serving as a negative control. After injection, the materials were cultured and induced for 15 days as described in Example 1. Approximately 15 days after injection, the induction of hairy roots was observed and statistically analyzed. The induction rate was calculated as the percentage of segments with roots generated at the injection site out of the total number of injected segments. The results are as follows: Figure 3As shown in Figure c, this method successfully induced hairy roots in all four tested sugarcane varieties, with no significant difference in induction rate. This indicates that the hairy root induction method established in this invention has good variety applicability.

[0085] The above three experimental results indicate that the base of sugarcane shoots, as explants, inherently suffers from regeneration barriers, making it difficult to efficiently induce hairy roots using only Ruby vectors. However, the WIND1 transcription factor, a key regulator of wound-induced dedifferentiation, overcomes the critical technical bottleneck of weak regeneration capacity at the base of sugarcane shoots by activating the cytokinin signaling pathway, promoting callus formation and root primordia development, and synergizing with the rooting action of Agrobacterium rhizogenes. This invention is the first to apply WIND1 to a sugarcane hairy root induction system, achieving significant technical results that exceed the expectations of those skilled in the art based on a single Ruby vector.

[0086] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. Those skilled in the art can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A highly efficient method for inducing hairy roots in sugarcane based on WIND1-Ruby, characterized in that, The method involves infecting the bud base of sugarcane stem segments with budding shoots using Agrobacterium rhizogenes containing co-expressed WIND1 and Ruby reporter genes. After cultivation and induction, positive sugarcane hairy roots are obtained. The OD of the infected bacterial solution... 600 It is 0.6~0.8; Agrobacterium rhizogenes containing co-expression of the WIND1 gene and the Ruby reporter gene was obtained by introducing a vector containing the WIND1 gene and the Ruby reporter gene into Agrobacterium rhizogenes. The vector containing the WIND1 gene and the Ruby reporter gene is a plant binary expression vector with a pCAMBIA1302 backbone, the T-DNA region containing only the Ruby reporter gene expression cassette driven by the MAS promoter, and the coding sequence of the WIND1 gene driven by another CaMV 35S promoter. The coding region sequence of the Ruby reporter gene is shown in SEQ ID NO: 1; The coding region sequence of the WIND1 gene is shown in SEQ ID NO:

2.

2. The efficient sugarcane hairy root induction method based on WIND1-Ruby according to claim 1, characterized in that, The method includes the following specific steps: Agrobacterium rhizogenes containing co-expression of the WIND1 gene and the Ruby reporter gene was activated and cultured to obtain an infected bacterial solution; Select sugarcane stem segments with sprouting buds; The infecting bacterial solution was inoculated at the base of the buds on sugarcane stem segments; The inoculated sugarcane stem segments were cultured to induce the production of hairy roots from the inoculation site.

3. The efficient sugarcane hairy root induction method based on WIND1-Ruby according to any one of claims 1 or 2, characterized in that, The specific preparation process of the infecting bacterial solution is as follows: Strain activation: Agrobacterium rhizogenes containing co-expression of the WIND1 gene and the Ruby reporter gene was streaked on a solid plate and incubated upside down; Liquid culture: Pick a single colony and inoculate it into liquid culture medium, then incubate overnight with shaking; Expanded culture and collection: Transfer the overnight culture to liquid culture medium and continue culturing. Centrifuge the resulting bacterial solution and discard the supernatant. Resuspension: Resuspend the bacterial pellet with infection buffer and adjust the OD values ​​accordingly. 600 After standing and activating, the infected bacterial solution is obtained.

4. The efficient sugarcane hairy root induction method based on WIND1-Ruby according to claim 3, characterized in that, During the expansion and collection process, overnight cultures were continued to be cultured in liquid medium until OD. 600 The value reaches 0.4~1.

0.

5. The efficient sugarcane hairy root induction method based on WIND1-Ruby according to any one of claims 1, 2, and 4, characterized in that, The specific process for obtaining the vector containing the WIND1 gene and the Ruby reporter gene is as follows: Using a plasmid containing the Ruby reporter gene as a template, the coding region of the Ruby reporter gene is amplified. After double digestion with NcoI and BstEII, the amplified product is inserted between the MAS promoter and NOS terminator of the pCAMBIA1302 backbone using seamless cloning technology to construct the p1302-Ruby vector. Then, the p1302-Ruby vector is digested with XhoI restriction endonuclease to remove the original HygR selection marker gene. Next, using a plasmid containing the coding sequence of the Arabidopsis thaliana AtWIND1 gene as a template, the coding region of the WIND1 gene is amplified. The linearized vector is seamlessly cloned and ligated with the WIND1 amplification product, so that the WIND1 gene replaces the original HygR selection marker. Under the drive of the CaMV 35S promoter, the p1302-WIND1-Ruby vector is obtained.

6. The efficient sugarcane hairy root induction method based on WIND1-Ruby according to any one of claims 1, 2, and 4, characterized in that, Agrobacterium rhizogenes strain K599.

7. The efficient sugarcane hairy root induction method based on WIND1-Ruby according to any one of claims 1, 2, and 4, characterized in that, The cultivation conditions are: temperature 25~28℃, relative humidity 70~80%, and photoperiod of 16h light / 8h darkness.

Citation Information

Patent Citations

  • Method for Agrobacterium-mediated genetic transformation of sugarcane growth points

    CN111893138A

  • Agrobacterium rhizogenes-mediated brassica crop efficient genetic transformation and gene editing method

    CN118272428A