Method for realizing wheat whole genome large-scale mutation and germplasm creation by editing repetitive sequence

Abstract

The invention discloses a method for realizing wheat whole genome large-scale mutation and germplasm creation by editing repetitive sequences. CRISPR / Cas9 target sites with the copy number higher than 20,000 in wheat genomes are screened, tandem repeat sequences and dispersed repeat sequences are edited in a targeted mode, and heritable large-scale variation, chromosome structure variation and agronomic character variation of the whole genome scale are induced and generated in progeny plants. By editing repetitive sequences, large-scale mutation with chromosome and subgenome specificity can be realized, the created mutant library not only provides heritable variation mutant types different from those of traditional physical and chemical mutagenesis methods, but also generates materials such as chromosome aneuploidy (such as monosome, tetrasome and whole-arm deletion) and the like. And a unique genetic resource is provided for wheat functional genomics research and germplasm improvement.

Description

Technical Field

[0001] This invention belongs to the field of crop molecular genetics breeding, specifically involving a method for creating new germplasm by large-scale editing of repetitive sequences in the whole wheat genome using CRISPR / Cas9 gene editing technology, and the application of the resulting heritable agronomic trait variations and chromosomal structural variations in wheat breeding. Background Technology

[0002] Gene editing, also known as genome editing, is a technology that allows for precise, targeted editing of specific targets within an organism's genome. [1] CRISPR / Cas9 is currently the most widely used gene editing system. Its working principle is mainly as follows: The Cas9 protein has a binding domain and two cleavage domains (HNH and RuvC nuclease domains, which cleave the two strands of DNA respectively). [3] After the guide RNA (sgRNA) and the exogenous nucleic acid specifically complement each other... [4] Cas9 can recognize PAM sequences (NGG). [5] It also exhibits precise cleavage activity at the positions of the three upstream nucleotides. [6,7] This process generates double-strand breaks, inducing the genome's self-repair mechanism. During this repair process, misrepair can occur, resulting in DNA fragment deletions, insertions, substitutions, or chromosomal rearrangements. [2] Finally, gene editing was completed. [8] .

[0003] Wheat breeding programs require a continuous input of genetic diversity to improve yield potential and stress resistance. While traditional mutagenesis methods such as EMS or radiation treatment can produce widespread genomic variation, the type and location of mutations are unpredictable. Although CRISPR / Cas9 technology enables precise gene editing, most studies focus on a few target sites, and its potential for genome-wide mutagenesis remains largely untapped. Repetitive elements (REs) constitute approximately 90% of the wheat genome, including tandemly arranged satellite DNA and scattered transposons, playing a crucial role in gene expression regulation and genome structure maintenance. However, editing repetitive sequences can lead to numerous double-stranded DNA breaks (DSBs) and lethal effects, limiting its application. Current technologies lack methods for safely and effectively editing repetitive sequences in crops to create breeding-ready variants. Virus-induced gene editing technology (reference) achieves gene editing in a way that does not rely on genetic transformation, avoiding the plant regeneration difficulties caused by numerous DSBs, and offers the potential to create genome-wide mutants in wheat through RE editing.

[0004] Long terminal repeats (LTRs) are a structural feature of an important class of retrotransposons in eukaryotic genomes. They are located at both ends of the transposon, repeating in the same direction, and enclosing the gene encoding the protein required for reverse transcription and transposition. In large-genome plants like wheat, LTRs are one of the main drivers of genome expansion and evolution, with extremely high copy numbers, occupying a large proportion of the genome volume. These sequences are not only key factors in genome structural variation (such as amplification and rearrangement), but their promoter activity can also regulate the expression of neighboring genes, affecting agronomic traits. [9] Tandem repeat sequences are a unique type of DNA sequence, composed of repeated identical core units. These sequences are an important component of eukaryotic genomes; in common wheat, the total amount of all types of repeat sequences exceeds 80% of the genome. Tandem repeat sequences (such as specific oligonucleotide probe sequences) are chromosome location specific and can be directly observed on chromosomes using fluorescence in situ hybridization (FISH) technology, thus becoming effective cytological markers for identifying chromosomes, tracing their structure, and detecting rearrangements (such as translocations and inversions). [10,11] These two types of repetitive sequences contain 23bp sequences starting with CCN and ending with NGG, which can serve as targets for gene editing. This allows Cas9 to target a large number of chromosomal locations with a single target for disruption and repair, enabling the creation of chromosomal insertion / deletion mutants. This provides a foundation for using VIGE technology to create wheat germplasm with mutations on a genome-wide scale and to screen for agronomical trait improvement. Summary of the Invention

[0005] The purpose of this invention is to provide a method for creating new germplasm by editing repetitive sequences in the whole wheat genome, overcoming the shortcomings of poor targeting of traditional mutagenesis and the limited number of editing sites in CRISPR / Cas9, achieving large-scale mutations with subgenomic and chromosome-specific control, and obtaining a mutant library with heritable agronomic trait variations and chromosomal structural variations, thus providing new genetic resources for wheat breeding.

[0006] The objective of this invention can be achieved through the following technical solutions:

[0007] A method for creating wheat germplasm by editing repetitive sequences includes the following steps:

[0008] (1) Screening for CRISPR / Cas9 target sequences with a copy number higher than 20,000 in the wheat genome, wherein the target sequences target tandem repeat sequences or dispersed repeat sequences;

[0009] (2) Construct a virus-induced gene editing vector, wherein the vector contains a DNA sequence encoding the sgRNA corresponding to the target sequence in step (1);

[0010] (3) The vector described in step (2) is introduced into transgenic wheat expressing Cas9 protein through a virus delivery system to obtain double-stranded DNA breaks across the entire genome;

[0011] (4) Screening mutants with agronomic trait variation and / or chromosomal structural variation from the offspring of edited plants.

[0012] Preferably, the method includes the following steps:

[0013] (1) Target screening: Develop computer scripts to scan the wheat Fielder reference genome, screen for 23-mer sequences ending in NGG or starting with CCN, retain sites with copy number >20,000, and finally obtain several whole-genome repetitive sequence targets;

[0014] (2) Construct a virus-induced gene editing vector, wherein the vector contains a DNA sequence encoding the sgRNA corresponding to the target sequence in step (1).

[0015] (3) Using barley stripe mosaic virus (BSMV) to deliver sgRNA to transgenic wheat Fielder-Cas9 expressing Cas9, genome-wide repetitive sequence editing was achieved in the M0 generation;

[0016] (4) Mutant screening and identification: M1 mutants with favorable agronomic traits were selected in the field and the variation of the whole genome and chromosomal structural mutations were identified by fluorescence in situ hybridization, PCR labeling and whole genome resequencing.

[0017] Preferred gene editing strategy: using the target REt14 (SEQ ID NO.1) to target tandem repeat sequences (satellite DNA, SEQ ID NO.10) Figure 1 B); REt5 (SEQ ID NO.2) and REt8 (SEQ ID NO.3) target the same dispersed repeat sequence (retrotransposon, SEQ ID NO.11) Figure 1 C) REt20 (SEQ ID NO.4) targets another dispersed repetitive sequence (retrotransposon, SEQ ID NO.12) to induce heritable chromosomal insertion / deletion mutations and variations in favorable agronomic traits.

[0018] Preferably, the chromosomal structural variation is selected from one or more of the following: heterozygous long segment deletion of the short arm of chromosome 5B; monosomy-4B formed by the elimination of a single chromosome 4B / monosomy-1A formed by the elimination of a single chromosome 1A; tetrasomy-5A formed by tetrasomy of chromosome 5A; and deletion of the long arm of chromosome 6A.

[0019] A virus-induced gene editing vector contains an sgRNA expression cassette corresponding to the target sequence, wherein the sgRNA expression cassette is driven by a T7 promoter and can be transcribed in vitro to produce functional sgRNA.

[0020] The application of the gene editing vector in creating wheat germplasm and / or inducing heritable agronomic trait variation in wheat, wherein the wheat germplasm includes chromosome monosomy, tetrasomy, and whole arm deletion materials, and the agronomic traits include spike type, plant height, and tillering.

[0021] The beneficial effects of this invention are:

[0022] (1) It achieves targeted mutagenesis at the whole genome scale, and a single editing session can theoretically generate about 100,000 DSBs, which is significantly different from traditional gene editing that only targets a single site;

[0023] (2) By using targeted tandem / dispersed repeat sequence editing, the editing site can be clearly identified, and more diverse types of heritable genomic and agronomic trait variations can be generated;

[0024] (3) The created compact square-ear mutant (REt14-82-3) can improve wheat ear type ( Figure 3 A) significantly increased yield per plant ( Figure 4 );

[0025] (4) Valuable aneuploid materials (such as monosomy-4B, monosomy-1A, tetrasomy-5A), whole-arm deletion materials, and multiple large-segment deletion / insertion materials of chromosomes were obtained, providing new tools for modern wheat variety genetic research. Figure 5 B. Figure 3 BI).

[0026] (5) Unlike traditional chemical and physical mutagenesis, this invention can obtain large-scale mutations that are specific to subgenomes and chromosomes, providing unprecedented genetic material for the study of crop polyploidization mechanisms and the creation of new wheat germplasm. Figure 6 BE, Figure 7 ). Attached Figure Description

[0027] Figure 1Design CRISPR / Cas9 targets for whole-genome tandem and dispersed repeat sequences in wheat. (A) Copy number distribution of targets with copy number >20,000 in the Fielder genome; (B) Genome distribution of target REt14, a tandem repeat sequence; (C) Genome distribution of target REt5, a dispersed repeat sequence.

[0028] Figure 2 M0 generation plant phenotype. (AC) Dispersed repeat target editing plant M0 representative type; (DE) Tandem repeat target editing plant M0 representative type;

[0029] Figure 3 Editing mutant offspring can produce chromosomal structural variations. (A) Representative types of M1 plants edited with different types of targets; (BD) Whole-genome resequencing results showing mutants with large fragment deletions; (E) Whole-genome resequencing results showing mutants with large fragment insertions; (F) Whole-genome resequencing results showing mutants with a single deletion of chromosome 1A; (G) Whole-genome resequencing results showing mutants with the addition of two chromosomes 5A; (H) Whole-genome resequencing results showing mutants with a single deletion of chromosome 4B; (I) Whole-genome resequencing results showing mutants with a deletion of the long arm of chromosome 6A.

[0030] Figure 4 1. Statistical analysis of agronomic traits in the offspring of mutants. (A) Number of panicles per plant; (B) Number of spikelets per panicle; (C) Grain length; (D) Grain width; (E) Yield per plant; (F) Weight per 100 grains;

[0031] Figure 5 FISH and marker identification of mutants. (A) FISH identification of M1 revealed a deletion of the short arm segment of chromosome 5B; (B) FISH identification of M2 revealed a deletion of the short arm segment of chromosome 5B and a deletion of a single chromosome 4B; (C) 5BS deletion marker identification results;

[0032] Figure 6 Correlation between targets and mutations. (A) Comparison of the number of mutations in target and non-target regions between wild-type and mutant strains; (BE) Correlation between the number of targets and the mutations produced at the chromosomal level.

[0033] Figure 7 The ratio of the number of targets to the number of mutations at different subgenomic levels Detailed Implementation

[0034] Example 1: CRISPR / Cas9 target design and vector construction

[0035] (1) Target screening

[0036] Based on the Fielder_v1 reference genome, the entire gene was cut into 23 bp lengths using Jellyfish software and a developed Python script. Then, all 23-mer sequences were scanned to identify sequences ending in NGG or starting with CCN. Sites with copy numbers >20,000 were retained. After reverse complementation filtering, 1,951 unique targets were obtained. Figure 1 A). The tandem repeat target REt14 (SEQ ID NO.1, 96,433 copies) with the highest copy number and three discrete repeat targets REt5 (SEQ ID NO.2, 115,871 copies), REt8 (SEQ ID NO.3, 110,714 copies), and REt20 (SEQ ID NO.4, 102,883 copies) were selected for subsequent experiments. Figure 1 B, C).

[0037] (2) Construction of sgRNA vector

[0038] Based on the target sequence, primers for constructing the sgRNA vector were designed and synthesized. High-fidelity PCR was used to amplify the sgRNA backbone (sequence as shown in SEQ ID NO. 16). The forward primers were SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, and SEQ ID NO. 8, and the reverse primer was the universal primer SEQ ID NO. 9. The pBSMVγ-EB vector (SEQ ID NO. 15) was digested with EcoRI and then purified using a gel extraction method. The purified PCR product was ligated to the digested and purified pBSMVγ-EB vector using a homologous recombinase. The vector was then transformed into DH5α *E. coli*: 1) 10 μL of the ligation product was added to 100 μL of competent cells and incubated on ice for 30 minutes; 2) The cells were heat-shocked in a 42°C water bath for 45 seconds; 3) The cells were incubated on ice for 5 minutes; 4) 500 μL of LB medium was added and the cells were incubated on a shaker at 37°C for 1 hour; 5) An appropriate amount of the bacterial culture was spread onto Kana-resistant LB solid medium. After culturing at 37°C for 12 hours, three single clones were randomly selected. Two sequencing primers were used to sequence the two target sites to confirm the correctness of the vector sequence. The sequencing primers were: BSMVseqL: GGAGCTGAAACTTTCTCATATCG; BSMVseqR: cttccggctcgtatgttgtg. After screening for positive single clones with antibiotics, plasmids were extracted and verified by Sanger sequencing.

[0039] Example 2: Virus-Induced Gene Editing (VIGE)

[0040] (1) BSMV in vitro transcription

[0041] The plasmids pBSMVα (SEQ ID NO.13), pBSMVβ (SEQ ID NO.14), and pBSMVγ-EB (SEQ ID NO.15) were linearized using MluI-HF, SpeI-HF, and BamHI-HF, respectively. Capped RNA transcription was performed using the T7 RiboMAX™ Express LargeScale RNA Production System kit, with the following system composition: 10 μL RiboMAX... TM T7 Express T7 2X Buffer, 1–8 μL linear DNA template (1 µg total), 0–7 μL Nuclease-Free Water, 2 μL Enzyme Mix, T7 Express. Transcription was performed at 37°C for 2–3 h under PCR conditions. Afterward, 0.5 µL of the transcription product was mixed with 1 µL of pre-prepared Loading Buffer and 5 µL of sterile ddH2O, and the quality was assessed by agarose gel electrophoresis (concentration 2–2.5 μg / μL).

[0042] (2) Friction inoculation of Fielder-Cas9 strain

[0043] The Cas9 expression vector pBUE411 (derived from Addgene, Plasmid #62200) was transformed into the wheat variety Fielder via Agrobacterium-mediated genetic transformation to obtain the Fielder-Cas9 line. Fielder-Cas9 T2 generation seeds were germinated at 8℃ for 3 days and then transferred to 8×8×8 cm square pots. Greenhouse conditions were set up (16 / 8 h photoperiod, daytime temperature 23℃ / nighttime temperature 18℃, humidity 70%, light intensity 3500 lux). At the two-leaf stage, mix 300 μL of FES buffer (7.51 g / L glycine, 10.45 g / L K2HPO4, 10 g / L sodium pyrophosphate, 10 g / L bentonite, 10 g / L diatomaceous earth) with 2.5 μL each of the successfully transcribed α, β, and γ transcripts from the previous step. Add 20 μL of this mixture to the surface of the second leaf. Wearing nitrile gloves, rub the leaf from the base to the tip to ensure surface abrasion; visible green wheat leaf sap should be visible on the fingertip. Repeat three times per plant, inoculating 10-20 single plants per target. Immediately after inoculation, cover with a transparent bag to maintain warmth and moisture; remove the bag after 2-3 days. Set up an FES buffer negative control and a BSMV-PDS positive control.

[0044] Example 3: Screening of Mutants Targeting Repetitive Sequence Editing

[0045] (1) M0 representative observation

[0046] The M0 plants edited by REt14 are growing normally, with only the panicles being slightly shorter and wider. Figure 2 DE); REt5 / 8 / 20 Edited: Plants showed severe stunting, inhibited leaf and heading, and decreased seed setting rate ( Figure 2 AC).

[0047] (2) M1 representative observation

[0048] All seeds harvested from M0 were planted in greenhouse 15-1 at the Baima Base of Nanjing Agricultural University. During the heading stage, ear type was observed, and mutants were selected. Among them, REt14-82 and REt14-81 mutated from the WT pointed-long ear type to a compact square ear type, and REt5-42 mutated to a short-dense ear type, etc. Figure 3 ).

[0049] (3) Statistics on agronomic traits of the M1 generation

[0050] The number of panicles per plant and the number of spikelets per panicle were counted for 10 selected panicle mutant plants in the field. Grain length, grain width, yield per plant, and 100-grain weight were measured using a seed testing instrument (Top Cloud Agriculture TPKZ-3). It was found that compared to the wild type, REt14-82 showed an increase in the number of panicles per plant; REt14-81 / -82 / -91 and REt5-42 showed an increase in the number of spikelets per panicle; REt14-82, REt20-61 / -172, and REt8-21 showed an increase in grain length; REt14-11 / -81, REt20-172, and REt5-42 / -61 showed an increase in grain width; REt14-82 showed an increase in yield per plant; and REt14-81, REt20-172, and REt5-61 showed an increase in 100-grain weight. Figure 4 ).

[0051] Example 4: Genotype Analysis

[0052] (1) FISH karyotype identification

[0053] Fluorescence in situ hybridization (FISH) was used to identify chromosomal variations in the mutants. First, root tip cells from germinating seeds of the edited line were synchronized to metaphase of mitosis using 2 μmol / Lamiprophos-methyl. Subsequently, root tips were collected, treated with nitrous oxide, digested enzymatically, and then slides were observed for chromosome morphology.

[0054] The oligonucleotide probe oligo-pSc119.2-1, with its 5' end labeled with 6-carboxyfluorescein, was used to generate a green fluorescent signal for identifying each chromosome. Simultaneously, a 23 nt probe targeting the repetitive sequence REt14 and its PAM sequence was synthesized. This probe, labeled with 6-carboxytetramethylrhodamine (TAMRA) at its 5' end, generated a red fluorescent signal for detecting CRISPR / Cas9-mediated editing-induced structural variations. Ultimately, deletions of the 5BS fragment and a single 4B chromosome deletion were detected. Figure 5 A, B)

[0055] (2) Marker identification

[0056] Markers were designed based on the location of the target in the deleted fragment region: 5BdelF: CTGACCCGTAGTAATCCGCT; 5BdelR: ATGCCTCCTCTCATATCCGC, to identify mutants with deletions in the 5BS region in the progeny of mutants. Figure 5 C).

[0057] (3) PacBio HiFi sequencing and DNBSEQ-T7 platform sequencing

[0058] The REt14-edited M3 mutant REt14-82-3-3 was sequenced using PacBio HiFi sequencing. Figure 6 The sequencing was performed by BGI Genomics (Shenzhen, China). HiFi data were obtained from intact cells. Two progeny samples from each selected M1 or M2 plant were sequenced using the DNBSEQ-T7 platform operated by BGI Genomics (Shenzhen, China). DNBSEQ uses paired-end sequencing with a read length of 150 bp, generating approximately 100 Gb of data per plant. The HiFi data of REt14-82-3-3 were aligned to the reference genome of the cultivated variety "Fielder" using Minimap2. Sniffles2 was used to identify deletion mutations in targeted and non-targeted regions. DNBSEQ data were aligned to the same reference genome using BWA.

[0059] Example 5: Creation of Aneuploid Materials

[0060] Monosomy-4B, monosomy-1A, tetrasomy-5A materials, as well as multiple large chromosome deletion / insertion materials, were isolated from progeny of repetitive sequence target editing. Figure 3 This provides a new tool for modern wheat variety genetic manipulation.

[0061] References

[0062] [1]Chen K, Wang Y, Zhang R, et al. CRISPR / cas genome editing and precision plant breeding in agriculture[J]. Annual Review of Plant Biology, 2019, 70(1): 667-697.

[0063] [2] Shan Qiwei, Gao Caixia. Latest research progress in plant genome editing and derivative technologies [Z] / / Genetics: Vol. 37. 2015: 953-973.

[0064] [3]Shan Q, Wang Y, Li J, et al. Genome editing in rice and wheat using the CRISPR / cas system[J]. Nature Protocols, 2014, 9(10): 2395-2410.

[0065] [4]Mikami M, Toki S, Endo M. Precision targeted mutagenesis via cas9paired nickases in rice[J]. Plant and Cell Physiology, 2016, 57(5): 1058-1068.

[0066] [5]Demirci Y, Zhang B, Unver T. CRISPR / cas9: an RNA-guided highlyprecise synthetic tool for plant genome editing[J]. Journal of CellularPhysiology, 2018, 233(3): 1844-1859.

[0067] [6]Ma X. CRISPR / cas9 platforms for genome editing in plants:developments and applications[J]. Molecular Plant.

[0068] [7]Geisinger JM, Turan S, Hernandez S, et al. in vivo blunt-endcloning through CRISPR / cas9-facilitated non-homologous end-joining[J]. Nucleic Acids Research, 2016, 44(8): e76-e76.

[0069] [8] Shu Xinyuan, Yan Xu, Pu Yehong, et al. Mechanism of action of CRISPR / Cas system and its application in crop genetic improvement [J]. Journal of Zhejiang University (Agricultural and Life Sciences), 2018, 44(3): 259-268+381.

[0070] [9]Wicker T, et al. A unified classification system for eukaryotic transposable elements. Nature Reviews Genetics. 2007.

[0071]

[10] Zhang Xueyong, Li Dayong. Research progress on DNA repetitive sequences in the genome of wheat and its close relatives [J]. Chinese Agricultural Science, 2000, 33(5): 14-24+111.

[0072]

[11] Zhang S, et al. Recent duplications and rare structural variations revealed by comparative sequence analysis of low molecular weightglutenin subunits (LMW-GS) genes re-identified using LMWgsFinder in 26genomes of the grass family[J]. Theoretical and Applied Genetics, 2025.

Claims

1. A method for creating wheat germplasm by editing repetitive sequences, characterized in that, Includes the following steps: (1) Screening for CRISPR / Cas9 target sequences with a copy number higher than 20,000 in the wheat genome, wherein the target sequences target tandem repeat sequences or dispersed repeat sequences; (2) Construct a virus-induced gene editing vector, wherein the vector contains a DNA sequence encoding the sgRNA corresponding to the target sequence in step (1); (3) The vector described in step (2) is introduced into transgenic wheat expressing Cas9 protein through a virus delivery system to obtain double-stranded DNA breaks across the entire genome; (4) Screening mutants with agronomic trait variation and / or chromosomal structural variation from the offspring of edited plants.

2. The method according to claim 1, characterized in that, Includes the following steps: (1) Target screening: Develop computer scripts to scan the wheat Fielder reference genome, screen for 23-mer sequences ending in NGG or starting with CCN, retain sites with copy number >20,000, and finally obtain several whole-genome repetitive sequence targets; (2) Construct a virus-induced gene editing vector, wherein the vector contains a DNA sequence encoding the sgRNA corresponding to the target sequence in step (1). (3) Using barley stripe mosaic virus (BSMV) to deliver sgRNA to transgenic wheat Fielder-Cas9 expressing Cas9, genome-wide repetitive sequence editing was achieved in the M0 generation; (4) Mutant screening and identification: M1 mutants with favorable agronomic traits were selected in the field and the variation of the whole genome and chromosomal structural mutations were identified by fluorescence in situ hybridization, PCR labeling and whole genome resequencing.

3. The method according to claim 1 or 2, characterized in that, The target sequence in step (1) is selected from the tandem repeat sequence target REt14 shown in SEQ ID NO.1, or the dispersed repeat sequence targets REt5, REt8 and REt20 shown in SEQ ID NO.2-4.

4. The method according to claim 3, characterized in that, The target REt14 has a copy number higher than 96,000 in the genome and targets the tandem repeat sequence shown in SEQ ID NO.

10.

5. The method according to claim 3, characterized in that, The of Targets REt5 and REt8 target the dispersed repetitive sequence shown in SEQ ID NO.11; target REt20 targets the dispersed repetitive sequence shown in SEQ ID NO.12; the copy number of targets REt5, REt8, and REt20 in the genome is higher than 100,000.

6. The method according to claim 2, characterized in that, The chromosomal structural variations are selected from one or more of the following: heterozygous long segment deletion of the short arm of chromosome 5B; monosomy-4B formed by the elimination of a single chromosome 4B / monosomy-1A formed by the elimination of a single chromosome 1A; tetrasomy-5A formed by tetrasomy of chromosome 5A; and deletion of the long arm of chromosome 6A.

7. A virus-induced gene editing vector, characterized in that, The sgRNA expression cassette contains the target sequence described in claim 3, wherein the sgRNA expression cassette is driven by the T7 promoter and can be transcribed in vitro to produce functional sgRNA.

8. The application of the gene editing vector of claim 7 in the creation of wheat germplasm and / or the induction of heritable agronomic trait variation in wheat, wherein the wheat germplasm includes chromosome monosomy, tetrasomy, and whole arm deletion materials, and the agronomic traits include spike type, plant height, and tillering.

Images