Method for detecting mycotoxin by using carbon nanotube field effect transistor biosensor based on nucleic acid conformational change
By anchoring modified nucleic acid aptamers to the gold film layer of a carbon nanotube field-effect transistor biosensor, the detection signal response to low-charge or electrically neutral fungal toxins was enhanced, solving the problem of insufficient detection sensitivity in existing technologies and achieving high sensitivity and rapid detection results.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- XIANGTAN UNIV
- Filing Date
- 2026-02-09
- Publication Date
- 2026-05-05
AI Technical Summary
Existing biosensor technologies are insufficient for the high-sensitivity detection of small molecules such as low-charge or electrically neutral fungal toxins, especially mycotoxins, resulting in weak detection signals that fail to meet the rapid and accurate requirements for food safety and environmental monitoring.
By anchoring modified nucleic acid aptamers on the surface of the gold film layer of a carbon nanotube field-effect transistor biosensor, oligothymidine deoxynucleotide fragments are used to form a preset conformation in a target-free state, and combined with the ion shielding effect of the gold film layer, the sensing signal response is enhanced.
It achieves extremely high sensitivity detection of small molecules of fungal toxins with low charge or electroneutrality, with a detection limit as low as 3.9 fg/mL. It has rapid response and excellent selectivity, and is suitable for point-of-care detection in food safety and environmental monitoring.
Smart Images

Figure CN121978322A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biosensor technology, and more specifically to a method for detecting fungal toxins using a carbon nanotube field-effect transistor biosensor based on nucleic acid conformational changes. Background Technology
[0002] Biotoxins are naturally occurring chemical substances produced by microorganisms, plants, or animals that possess toxicity or pathogenicity. They are mostly secondary metabolites of organisms, characterized by high toxicity, trace amounts, and wide distribution. Unlike synthetic chemical toxins, these toxins originate from natural biological processes and are easily transmitted through the food chain or contaminate food and the environment under specific conditions, posing potential threats to food safety and the ecological environment. Among them, low-charge or electrically neutral fungal toxins are a particularly harmful class of biotoxins. The inherent charge of these molecules makes trace detection difficult. Corydalis, a highly toxic metabolite produced by Aspergillus fumigatus, is a typical example of this type of fungal toxin, capable of invading the human body and causing harm through various routes, including food contact and environmental exposure. Therefore, establishing highly sensitive detection methods for low-charge or electrically neutral fungal toxins to achieve efficient screening of these toxins in food testing and early identification and intervention of trace target toxins in the environment is of significant practical importance for controlling the toxic effects of these fungal toxins and ensuring food safety and human health.
[0003] Currently, the main methods for detecting mycotoxins include high-performance liquid chromatography (HPLC), colorimetry, and enzyme-linked immunosorbent assay (ELISA). However, all existing methods have significant technical limitations: HPLC has a detection limit of only micrograms per milliliter, and its sample pretreatment is cumbersome, the detection process is complex, and it is highly dependent on professional operators and sophisticated instruments; while colorimetry based on biological probes can improve the detection limit to the nanogram per milliliter level, it suffers from a narrow linear detection range and long detection time; ELISA also suffers from high antibody preparation costs and susceptibility to interference with detection specificity. Furthermore, these methods are insufficient to meet the timeliness requirements of practical applications such as toxin enrichment detection in the field and rapid emergency detection in the food safety field. Moreover, due to high operational barriers and stringent detection conditions, they cannot be widely adopted in grassroots testing scenarios.
[0004] To address the aforementioned technical shortcomings, biosensors based on field-effect transistors (FETs) have become a research hotspot in the field of biosensing due to their unique electrical detection mechanism. Among them, carbon nanotube field-effect transistor (CNT-FET) biosensors stand out. CNT-FETs are field-effect transistors using carbon nanotubes as the channel material, combining faster response speeds, superior electrical performance, and higher detection sensitivity. Their detection principle is based on changes in the electrical properties of semiconductor materials to detect biomarkers. They can perform trace detection of extremely low concentrations of target molecules, with short response times, typically in the range of seconds to minutes, far superior to traditional immunoassay or chromatographic analysis methods, making them suitable for point-of-care testing. Furthermore, this sensor has excellent integration capabilities, allowing it to be combined with microfluidic technology, wearable devices, etc., to achieve in-situ real-time detection of target molecules, showing promising application prospects in the detection of food and environmental biotoxins.
[0005] As the core recognition element of biosensors, biological probes are crucial for the accurate identification of substances. Common biological probes include antigen-antibody systems, enzymes, molecularly imprinted polymers, and nucleic acid aptamers. The choice of biological probe type and structural design directly determines the core performance of biosensors, such as detection sensitivity and signal-to-noise ratio. For the identification of small molecule targets like biotoxins, nucleic acid aptamers are more suitable for constructing biosensors than other biological probes due to their advantages such as high binding sensitivity, fast response speed, and suitability for small molecule target recognition. They have become the preferred recognition element in the field of detecting low-charge or electroneutrally neutral fungal toxins.
[0006] However, in practical applications, it has been found that small molecules such as mycotoxins, which are low in charge or electrically neutral, are difficult to elicit a significant electrical response when combined with CNT-FET biosensors for detection using only conventional nucleic acid aptamers. This results in weak sensing signals and significantly reduces the detection sensitivity of CNT-FET biosensors for these small molecules. This has become the core technical bottleneck restricting the practical application of CNT-FET biosensors in the detection of low / electrically neutral mycotoxins such as mycotoxins. Summary of the Invention
[0007] The purpose of this invention is to provide a method for detecting fungal toxins using a carbon nanotube field-effect transistor biosensor based on nucleic acid conformational changes. By directional structural design and modification of nucleic acid aptamers, the electrical signal response of low-charge or electrically neutral fungal toxins such as mycotoxins after binding with the CNT-FET biosensor is enhanced, thereby improving detection sensitivity.
[0008] According to the present invention, a method for detecting fungal toxins using a carbon nanotube field-effect transistor biosensor based on nucleic acid conformational changes is provided, comprising the following steps:
[0009] A carbon nanotube field-effect transistor (CNT-FET) biosensor is employed, wherein a gold film layer with a shielding effect is disposed above the channel of the CNT-FET biosensor, and a modified nucleic acid aptamer is anchored on the surface of the gold film layer via gold-sulfur bonds to construct a sensing interface; wherein, the modified nucleic acid aptamer includes the original nucleic acid aptamer sequence of the target fungal toxin, and an oligothymidine deoxynucleotide fragment orientedly inserted into the 5' end of the original nucleic acid aptamer sequence; the oligothymidine deoxynucleotide fragment enables the modified nucleic acid aptamer to form a predetermined spatial conformation in a target-free state;
[0010] A buffer solution is added to the sensing interface to eliminate the interference of ions in the buffer solution on the sensing signal by utilizing the ion shielding effect of the gold film layer. At the same time, the initial electrical transfer characteristic curve is measured by the CNT-FET biosensor as the detection baseline.
[0011] The sample to be tested is dropped onto the sensing interface, so that the fungal toxin in the sample specifically binds to the modified nucleic acid aptamer. The binding triggers a secondary conformational change in the modified nucleic acid aptamer, which moves closer to the surface of the gold film.
[0012] The CNT-FET biosensor measures the change in transfer characteristic curve after specific binding, converting the electric field effect caused by the conformational shift of the modified nucleic acid aptamer into a signal of change in carrier concentration within the CNT-FET biosensor channel. Based on the linear proportional relationship between the change signal and the mycotoxin concentration, quantitative detection of mycotoxins in the sample to be tested is achieved.
[0013] As an optional implementation, the length of the oligothymidine deoxynucleotide fragment is 5 nt to 20 nt.
[0014] As an optional implementation, the preset spatial conformation is that the modified nucleic acid aptamer is positioned away from or parallel to the gold film surface in a target-free state.
[0015] As an optional implementation, the free end of the oligothymidine deoxynucleotide fragment forms a gold-sulfur bond with the gold film layer via a thiol group.
[0016] As an optional implementation, the 3' end of the modified nucleic acid aptamer probe is in a free state. When not bound to the target fungal toxin, the flexible support of the oligo-thymidine deoxynucleotide fragment allows the modified nucleic acid aptamer to be in an extended state away from the gold membrane surface.
[0017] As an optional implementation, the thickness of the gold film layer is 15 nm to 30 nm.
[0018] As an optional implementation, the CNT-FET biosensor comprises, from bottom to top:
[0019] The substrate layer is a silicon wafer pre-deposited with a carbon nanotube layer;
[0020] The source and drain electrodes are symmetrically arranged above the carbon nanotube layer, and the carbon nanotubes between the source and drain electrodes form a channel.
[0021] The gate dielectric layer covers the channel, source, and drain.
[0022] A gold film layer is applied over the gate dielectric layer above the channel;
[0023] A passivation layer is applied over the gate dielectric layer above the source and drain electrodes, and a sensing window is defined to expose the gold film layer.
[0024] The biosensitive layer is composed of modified nucleic acid aptamers. The modified nucleic acid aptamers form gold-sulfur bonds with the gold film layer exposed by the sensing window, thereby anchoring the modified nucleic acid aptamers.
[0025] As an optional implementation, the fungal toxin includes glucosinolates.
[0026] As an optional implementation, the sequence of the modified nucleic acid aptamer is HS-TTTTTTTTCATGCGTCAGCATGGAGGGGACCT.
[0027] As an optional implementation, the method has a detection limit of 3.9 fg / mL for mycotoxins.
[0028] As can be seen from the above technical solutions of the present invention, the method for detecting fungal toxins using a carbon nanotube field-effect transistor biosensor based on nucleic acid conformational changes proposed in this invention has the following significant advantages:
[0029] (1) Extremely high detection sensitivity and ultra-low detection limit: This invention optimizes the spatial conformation of nucleic acid aptamers and designs an immobilized modified probe to maximize the conformational shift induced by target binding, which significantly improves the electrical signal response. Experimental results show that the method of this invention has extremely high sensitivity to low-charge or uncharged mycotoxin small molecules, with a detection limit as low as 3.9 fg / mL, which is far superior to traditional high performance liquid chromatography (microgram level) and colorimetric method (nanogram level).
[0030] (2) Excellent stability and anti-interference capability of liquid gate detection: By introducing a gold film shielding layer of a specific thickness (15nm~30nm) into the gate dielectric layer, the problem of the hafnium oxide / yttrium oxide dielectric layer being sensitive to ions in the buffer solution is effectively solved; the dense gold film layer can shield the adsorption of ions to the oxide layer below, eliminate false positive interference caused by background baseline drift, and significantly improve the signal-to-noise ratio.
[0031] (3) Excellent specific recognition and selective detection capabilities: This invention utilizes the high affinity of nucleic acid aptamers to specifically bind to target toxins, enabling accurate identification of mycotoxins; experimental data show that even in the presence of multiple biological toxins such as aflatoxin B1, ochratoxin A, zearalenone and ricin, the chip did not show any electrical signal response, demonstrating excellent selectivity.
[0032] (4) Potential for rapid response and instant detection: Compared with the cumbersome processing procedures of traditional detection methods, the CNT-FET biosensor constructed in this invention has an extremely fast response speed and can complete the detection within ten minutes. At the same time, the sensor is prepared using mature micro-nano fabrication technology and has good integration potential. It does not require professional personnel or large and complex equipment and is suitable for rapid early warning of food safety on-site screening and environmental monitoring.
[0033] (5) Universal nucleic acid aptamer conformation design criteria: By comparing aptamer configurations of different lengths and different fixation methods, this invention establishes the advantage of unfixed conformations in improving small molecule detection response, providing important design reference for the development of other low-charge small molecule biosensors. Attached Figure Description
[0034] Figure 1 This is a schematic diagram of the structure of an exemplary CNT-FET biosensor of the present invention.
[0035] Figure 2 This is a flowchart illustrating the fabrication process of an exemplary CNT-FET biosensor of the present invention.
[0036] Figure 3 These are the transfer characteristic curves of CNT-FETs with gold film layers of different thicknesses in the examples of this invention; wherein, Figure 3 Part a in the figure is a 10 nm gold film. Figure 3 Part b in the figure is a 15 nm gold film layer. Figure 3 The c part is a 30 nm gold film layer.
[0037] Figure 4 These are simulated configuration diagrams of four different nucleic acid aptamers in the examples of this invention; wherein, Figure 4 The 'a' part is APT1. Figure 4 Part b in the text is APT2. Figure 4 The c part is APT3. Figure 4 The d part in the equation is APT4.
[0038] Figure 5 This is a graph showing the response of four different configurations of nucleic acid aptamers to the detection of mycotoxins in this invention; wherein, Figure 5 The 'a' part is APT1. Figure 5 Part b in the text is APT2. Figure 5 The c part is APT3. Figure 5 The d part in the equation is APT4.
[0039] Figure 6 This invention example demonstrates a selective test for detecting mycotoxins using an APT1-functionalized CNT-FET biosensor; wherein, Figure 6 Part a in the diagram represents the selectivity for detecting other toxins and mycotoxins. Figure 6 Part b in the diagram represents the correlation of mycotoxin detection. Detailed Implementation
[0040] To better understand the technical content of the present invention, specific embodiments are described below in conjunction with the accompanying drawings.
[0041] Various aspects of the invention are described in this disclosure with reference to the accompanying drawings, in which numerous illustrative embodiments are shown. The embodiments of this disclosure are not necessarily intended to encompass all aspects of the invention. It should be understood that the various concepts and embodiments described above, as well as those described below in more detail, can be implemented in any of a number of ways.
[0042] Carbon nanotube field-effect transistors (CNT-FETs) are used as biosensors, combined with nucleic acid aptamers as biological probes. The structure of the nucleic acid aptamers is modified, and the modified nucleic acid aptamers have an unfixed conformation. They specifically recognize target fungal toxins and produce conformational changes, generating highly sensitive electrical signal responses. This enables rapid detection of small molecules such as low-charge or electrically neutral fungal toxins with high sensitivity and selectivity.
[0043] In this invention, the unfixed conformation refers to the directional insertion of an oligothymidine deoxynucleotide fragment into the 5' end of the original nucleic acid aptamer sequence of the target fungal toxin. Since the inserted oligothymidine deoxynucleotide fragment is not restricted by base complementarity pairing, it is defined as the unfixed conformation.
[0044] Carbon nanotube field-effect transistor (CNT-FET) biosensor
[0045] Combination Figure 1As shown, in one embodiment of the present invention, the CNT-FET biosensor used comprises, from bottom to top: a substrate layer, a source and a drain, a gate dielectric layer, a gold film layer, a passivation layer, and a biosensitive layer.
[0046] The substrate is a silicon wafer 10 with a pre-deposited carbon nanotube layer 20.
[0047] In some embodiments, the silicon wafer 10 includes a Si layer and a SiO2 layer bonded together, and a carbon nanotube layer 20 is deposited on the SiO2 layer.
[0048] The source electrode 30 and the drain electrode 40 are symmetrically disposed above the carbon nanotube layer 20, and the carbon nanotubes between the source electrode 30 and the drain electrode 40 form a channel;
[0049] In some embodiments, the source 30 and the drain 40 are Ti / Pd / Au deposited sequentially.
[0050] A gate dielectric layer 50 covers the channel, source 30, and drain 40; the gate dielectric layer 50 can be made of a high-k dielectric material with a high dielectric constant.
[0051] In some embodiments, the gate dielectric layer 50 is composed of yttrium oxide and hafnium oxide deposited sequentially.
[0052] A gold film layer 60 covers the gate dielectric layer 50 above the channel;
[0053] In some embodiments, the thickness of the gold film layer 60 is 15 nm to 30 nm.
[0054] A passivation layer 70 covers the gate dielectric layer 50 above the source 30 and drain 40, and defines a sensing window that exposes the gold film layer 60.
[0055] In some embodiments, the passivation layer 70 is S1813 photoresist.
[0056] The biosensitive layer 80 is composed of modified nucleic acid aptamers. The modified nucleic acid aptamers form gold-sulfur bonds with the gold film layer exposed by the sensing window, thereby anchoring the modified nucleic acid aptamers and constructing a sensing interface.
[0057] In some embodiments, the modified nucleic acid aptamer includes the original nucleic acid aptamer of the target mycotoxin and an oligothymidine deoxynucleotide fragment directionally inserted into the 5' end of the original nucleic acid aptamer sequence of the target mycotoxin, the oligothymidine deoxynucleotide fragment causing the modified nucleic acid aptamer to form a predetermined spatial conformation in a target-free state.
[0058] Fabrication of CNT-FET Biosensors
[0059] The fabrication process of CNT-FET biosensors can be carried out using existing technologies. Below, we provide a specific example, combined with... Figure 2 As shown, the aforementioned CNT-FET biosensor was fabricated using micro / nano fabrication methods. The fabrication process is as follows:
[0060] (1) Cutting and cleaning: Cut the silicon wafer (substrate) with pre-deposited carbon nanotube layer according to the required size and layout, and dry it with nitrogen gun → rinse with acetone (AR grade) → dry it with nitrogen gun → rinse with ethanol (AR grade) → blow it with nitrogen gun → rinse with ultrapure water → dry it with nitrogen gun. Figure 2 Part a in the text.
[0061] (2) Spin coating and photolithography: Place the cleaned and dried substrate on a spin coater and spin coat it with two types of photoresist, LOR and S1813. Use a MICROWriter ML3 maskless photolithography machine to perform photolithography on the chip and immerse it in developer (MF-319) for development.
[0062] (3) The contact electrode metal was deposited in an electron beam coating machine (DE400DHLL), and the resist was removed using a remover (RemovePG) to obtain a patterned metal contact electrode, such as... Figure 2 Part b in the text.
[0063] (4) After homogenization and photolithography using the same method as in step 2, use an LCCP reactive ion etching machine to etch away the carbon nanotubes except for the channel region, and remove the resist, as shown below. Figure 2 Part c in the text.
[0064] (5) In an electron beam deposition apparatus (DE400DHLL), the gate dielectric layer (Y2O3 and HfO2 in sequence) and the gold film are deposited again in sequence, as follows: Figure 2 The d and e parts in the text.
[0065] (6) Use a spin coater to spin-coat S1813 photoresist for passivation, such as Figure 2 Part f in the middle.
[0066] (7) A buffer solution containing the modified nucleic acid aptamer was dropped onto the surface of the gold film and incubated to allow the modified nucleic acid aptamer to attach to the gold film of the CNT-FET biosensor, such as... Figure 2 Part g.
[0067] Understandably, the materials and dimensions of the components of a CNT-FET biosensor can be designed according to actual needs.
[0068] A method for detecting fungal toxins using carbon nanotube field-effect transistor biosensors based on nucleic acid conformational changes.
[0069] In another embodiment of the present invention, using the aforementioned CNT-FET biosensor, a method for detecting fungal toxins based on a carbon nanotube field-effect transistor biosensor with nucleic acid conformational changes is provided, comprising the following steps:
[0070] Buffer solution was added to the sensing interface of the CNT-FET biosensor. The ion shielding effect of the gold film layer was used to eliminate the interference of ions in the buffer solution on the sensing signal. At the same time, the initial electrical transfer characteristic curve was measured by the CNT-FET biosensor as the detection baseline.
[0071] The sample to be tested is dropped onto the sensing interface, so that the fungal toxin in the sample specifically binds to the modified nucleic acid aptamer. This binding triggers a secondary conformational change in the modified nucleic acid aptamer, which moves closer to the surface of the gold film.
[0072] The CNT-FET biosensor measures the change in transfer characteristic curves after specific binding, converting the electric field effect caused by the conformational shift of the modified nucleic acid aptamer into a signal of change in carrier concentration within the CNT-FET biosensor channel. Based on the linear proportional relationship between the change signal and the mycotoxin concentration, quantitative detection of mycotoxins in the test sample is achieved.
[0073] In some embodiments, the length of the oligothymidine deoxynucleotide fragment is 5 nt to 20 nt.
[0074] In some embodiments, the preset spatial conformation is that the modified nucleic acid aptamer is either far from or parallel to the gold film surface in a target-free state; these two relatively stable states have a stable overall potential and will not produce signal changes after anchoring.
[0075] In some embodiments, the free end of the oligothymidine deoxynucleotide fragment forms a gold-sulfur bond with the gold film layer via a thiol group.
[0076] In some embodiments, the 3' end of the modified nucleic acid aptamer probe is in a free state. When not bound to the target fungal toxin, the flexible support of the oligo-thymidine deoxynucleotide fragment allows the modified nucleic acid aptamer to be in an extended state away from the gold membrane surface.
[0077] In some embodiments, the fungal toxins include glucosinolates.
[0078] In some embodiments, the sequence of the modified nucleic acid aptamer is HS-TTTTTTTTCATGCGTCAGCATGGAGGGGACCT.
[0079] In some embodiments, the detection limit of this method for mycotoxins is not higher than 3.9 fg / mL.
[0080] To facilitate better understanding, the present invention will be further illustrated below with several specific examples. However, the preparation process is not limited to these examples, and the content of the present invention is not limited to these examples.
[0081] Unless otherwise specified, the following embodiments are all conventional methods.
[0082] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0083] Example 1
[0084] [Device Fabrication and Optimization]
[0085] The device is fabricated according to the aforementioned steps (1) to (6), and the specific dimensions of the device are as follows:
[0086] The silicon wafer with pre-deposited carbon nanotube layers was purchased from Encrystal Semiconductor (model: XJ-NF-240926.001). The total thickness of the silicon and silicon dioxide layers was 500 μm; the channel size was 20 μm × 50 μm; the source and drain electrodes were sequentially deposited with Ti / Pd / Au, with thicknesses of 0.6 nm / 20 nm / 40 nm, respectively; the dielectric layers were yttrium oxide 3 nm and hafnium oxide 5 nm, respectively; the gold film thickness was 15 nm-30 nm, and the gold film size was 17 μm × 40 μm; the passivation layer S1813 photoresist exposure window size was 20 μm × 70 μm.
[0087] The device with a gold film thickness of 10 nm was named Device 1, the device with a gold film thickness of 15 nm was named Device 2, and the device with a gold film thickness of 30 nm was named Device 3.
[0088] The effects of gold films of different thicknesses on the stability of liquid grating detection were investigated. The experimental procedure is as follows:
[0089] First, the transfer characteristic curves of CNT-FETs with three different gold film thicknesses (10 nm, 15 nm, and 30 nm) were tested using a Keithley 4200A-SCS (VL). ds =-0.2 V,V g =-1.6 V to 0 V) Using the first test result as the baseline (BLANK), the liquid gate ion environment uses 0.1×PBS, and the results are taken at 1 minute intervals to obtain 6 test data.
[0090] like Figure 3 As shown, when the gold film thickness is 10 nm ( Figure 3As shown in part a), due to its thin deposition thickness and some defects, some ions are still adsorbed by the underlying oxide layer, causing the signal response curve to shift to the right. This result is not conducive to the reading of real biological signals in subsequent biological tests; when the gold film thickness increases (as shown in part a), Figure 3 As shown in parts b and c), the results were taken at 1-minute intervals to obtain 6 test data. Almost no signal response was generated, which effectively improved the stability of liquid grid detection in actual detection and helped to improve the signal-to-noise ratio of the detection.
[0091] The results demonstrate that when the liquid gate of a CNT-FET using yttrium oxide and hafnium oxide as dielectric layers is sensitive to ions in PBS buffer, using a gold film with better deposition quality can effectively reduce false positive interference in subsequent biological detection.
[0092] The following example uses device 2 as the sensor for testing.
[0093] Example 2
[0094] [Structural design of nucleic acid aptamers]
[0095] Biosensors that use nucleic acid aptamers as biological probes rely on the fact that the original nucleic acid aptamer is a nucleotide fragment, and its conformational changes are insufficient to produce effective displacement. The resulting electric field effect is weak. Furthermore, small molecules such as mycotoxins, which are low-charge or electrically neutral fungal toxins, do not carry enough charge themselves. Therefore, it is difficult to generate a significant response that can be recognized in the channel of a CNT-FET biosensor, thus reducing the sensitivity of the biosensor.
[0096] Therefore, using gliotoxin as the target analyte, a structural design was carried out based on the existing gliotoxin nucleic acid aptamer (Development of a Fluorescently Labeled Aptamer Structure Switching Assay for Sensitive and Rapid Detection of Gliotoxin. Anal. Chem. 2019, 91, 1610−1618).
[0097] The aforementioned existing mycotoxin nucleic acid aptamers are hereinafter referred to as mycotoxin primitive nucleic acid aptamers, with the sequence CATGCGTCAGCATGGAGGGGACCT (5'-3').
[0098] Four different conformations of nucleic acid aptamers were designed, and their sequences are shown in Table 1.
[0099] Table 1
[0100] name DNA probe sequence (5'-3') APT1 HS-TTTTTTTTCATGCGTCAGCATGGAGGGGACCT APT2 HS-TTTTTTTTCATGCGTCAGCATGGAGGGGACCTAAAA APT3 HS-TTTTTTTTCATGCGTCAGCATGGAGGGGACCTAAAAAAA APT4 HS-TTTTCATGCGTCAGCATGGAGGGGACCTAAAA
[0101] Combining Table 1 and Figure 4 A schematic diagram, Figure 4 The circled area in the image represents the original nucleic acid aptamer of mycotoxin, meaning that this part is the region that can specifically recognize mycotoxin.
[0102] Figure 4 The 'a' part corresponds to APT1, which is an oligo-thymidine deoxynucleotide fragment consisting of 8 thymidine deoxynucleotides inserted into the 5' end of the mycotoxin primitive nucleic acid aptamer, while the 3' end of the mycotoxin primitive nucleic acid aptamer is in a free state.
[0103] Figure 4 Part b corresponds to APT2, which involves inserting an oligo-thymidine deoxynucleotide fragment consisting of 8 thymidine deoxynucleotides at the 5' end of the original mycotoxin nucleic acid aptamer and an oligo-adenine deoxynucleotide fragment consisting of 4 adenine deoxynucleotides at the 3' end of the original mycotoxin nucleic acid aptamer. The 4 adenine deoxynucleotides are paired with the 4 thymidine deoxynucleotides, thus restricting a portion of the region to complementary base pairing.
[0104] Figure 4 The c part corresponds to APT3, which involves inserting an oligo-thymidine deoxynucleotide fragment consisting of 8 thymidine deoxynucleotides at the 5' end of the original mycotoxin nucleic acid aptamer and an oligo-adenine deoxynucleotide fragment consisting of 8 adenine deoxynucleotides at the 3' end of the original mycotoxin nucleic acid aptamer. The 8 adenine deoxynucleotides and 8 thymidine deoxynucleotides are completely complementary and paired, forming a relatively long complementary base pairing chain.
[0105] Figure 4 The d part corresponds to APT4, which involves inserting an oligo-thymidine deoxynucleotide fragment consisting of four thymidine deoxynucleotides at the 5' end of the original mycotoxin nucleic acid aptamer and an oligo-adenine deoxynucleotide fragment consisting of four adenine deoxynucleotides at the 3' end of the original mycotoxin nucleic acid aptamer. The four adenine deoxynucleotides and four thymidine deoxynucleotides are completely complementary and paired, forming a shorter complementary base pairing chain.
[0106] A thiol group was modified at the end of the oligothymidine deoxynucleotide fragment away from the original mycotoxin nucleic acid aptamer for subsequent anchoring with the CNT-FET biosensor.
[0107] The four different conformations of nucleic acid aptamers designed above were all synthesized and purified by Sangon Biotech (Shanghai) Co., Ltd., and their product numbers are: APT1 (1936894255), APT2 (1936894256), APT3 (1946055743), and APT4 (1946055744).
[0108] Example 3
[0109] [Screening for the required nucleic acid aptamers]
[0110] The process for testing the above four different conformations of nucleic acid aptamers to detect mycotoxins is as follows:
[0111] (1) Functionalization of nucleic acid aptamers: A solution containing nucleic acid aptamers (10 μmol / mL, diluted with 0.1×PBS) was dropped onto the gold film surface of each of the four devices 2 and incubated for 8 h to allow the nucleic acid aptamers to attach to the gold film of device 1.
[0112] (2) Baseline determination: The nucleic acid aptamer solution on the surface of the nucleic acid aptamer-functionalized device 1 after step (1) was then rinsed with ultrapure water, and 0.1×PBS buffer was added. The transfer characteristic curve of the nucleic acid aptamer-functionalized device 1 was tested using a Keithley 4200A-SCS (V ds =-0.2 V,V g =-1.6 V to 0 V) to obtain the baseline BLANK.
[0113] (3) Mycotoxin test: Subsequently, different concentrations of mycotoxin (diluted with 0.1×PBS buffer) were sequentially incubated at the sensing interface of the nucleic acid aptamer-functionalized device 1 from low to high for 5 min. The transfer characteristic curve of the nucleic acid aptamer-functionalized device 1 was tested using a Keithley 4200A-SCS (V ds =-0.2 V,V g =-1.6 V to 0 V).
[0114] The solutions containing nucleic acid aptamers were solutions containing APT1, APT2, APT3, and APT4. All four solutions were tested according to the above steps, and the results are as follows: Figure 5 As shown.
[0115] The results showed that, when the head could recognize mycotoxins, increasing the number of base pairs and the length of the nucleic acid aptamer (APT3) resulted in higher levels of mycotoxin recognition. Figure 5 (part c in the text), or reduce the number of base pairs, shorten the nucleic acid aptamer (APT4, Figure 5 The d part), and the partial changes restricted by base complementary pairing (APT2, Figure 5 Part b of the text is more complex than completely immature nucleic acid aptamers (APT1). Figure 5 The effect of part a in the text is poor.
[0116] Therefore, in the detection of mycotoxins, using a CNT-FET biosensor functionalized with nucleic acid aptamers, and designing immobilized nucleic acid aptamers, can improve the detection sensitivity for small molecules like mycotoxins by increasing the conformational changes of the nucleic acid aptamers during the detection process, resulting in better detection performance and a detection limit (LOD) of 3.9 fg / mL. Figure 6 (as shown in part b).
[0117] Therefore, the nucleic acid aptamers used in this invention must include the original nucleic acid aptamer of the target mycotoxin, and an oligo-thymidine deoxynucleotide fragment directionally inserted into the 5' end of the original nucleic acid aptamer sequence of the target mycotoxin, which is the modified nucleic acid aptamer as defined above.
[0118] Example 4
[0119] [Selective Test]
[0120] For ease of description, the APT1-functionalized device 2 will be abbreviated as APT1-CNT-FET. The selective testing of mycotoxins and other toxins using APT1-CNT-FET is performed as follows:
[0121] (1) Baseline determination: The surface of APT1-CNT-FET was rinsed with ultrapure water and 0.1×PBS buffer was added. The transfer characteristics of APT1-CNT-FET were measured using a Keithley 4200A-SCS instrument (V ds =-0.2 V,V g =-1.6 V to 0 V) to obtain the baseline BLANK.
[0122] (2) Selectivity test: Subsequently, different biotoxins (aflatoxin B1, ochratoxin A, zearalenone, ricin) and mycotoxins (0.1×PBS dilution) at the same concentration (10 pg / mL, 0.1×PBS dilution) were sequentially incubated on the APT1-CNT-FET sensing interface for 5 min. The transfer characteristic curve of APT1-CNT-FET was tested using a Keithley 4200A-SCS (V ds =-0.2 V,V g The curve is obtained by dividing the voltage from -1.6 V to 0 V, and its response (Response=(I-I0) / I0,V) is calculated. gs =-0.8 V) The result is as follows Figure 6 As shown in part a of the diagram.
[0123] As a result, the method of the present invention has achieved the detection of mycotoxins. At the same time, the method of the present invention can also effectively distinguish mycotoxins from other biological toxins, showing excellent selectivity. For other biological toxin groups (aflatoxin B1, ochratoxin A, zearalenone, ricin), the chip electrical performance is almost unchanged, which is significantly different from the mycotoxin group (GT), and can achieve accurate detection of mycotoxins.
[0124] As can be seen from the above, the method of the present invention can achieve rapid detection of mycotoxins with high sensitivity within ten minutes, with a detection limit as low as fg / mL. It can effectively detect small molecules of low-charge or electrically neutral fungal toxins such as mycotoxins in environmental and food testing, preventing the accumulation of such biological toxins in the environment or products and causing harm to human activities. At the same time, its detection process is simple to operate and does not require professional personnel or complex equipment, making it a highly efficient alternative for biological toxin detection.
[0125] While the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the invention. Those skilled in the art can make various modifications and refinements without departing from the spirit and scope of the invention. Therefore, the scope of protection of the present invention shall be determined by the claims.
Claims
1. A method for detecting fungal toxins using a carbon nanotube field-effect transistor biosensor based on nucleic acid conformational changes, characterized in that, Includes the following steps: A carbon nanotube field-effect transistor (CNT-FET) biosensor is employed, wherein a gold film layer with a shielding effect is disposed above the channel of the CNT-FET biosensor, and a modified nucleic acid aptamer is anchored on the surface of the gold film layer via gold-sulfur bonds to construct a sensing interface; wherein, the modified nucleic acid aptamer includes the original nucleic acid aptamer sequence of the target fungal toxin, and an oligothymidine deoxynucleotide fragment orientedly inserted into the 5' end of the original nucleic acid aptamer sequence; the oligothymidine deoxynucleotide fragment enables the modified nucleic acid aptamer to form a predetermined spatial conformation in a target-free state; A buffer solution is added to the sensing interface to eliminate the interference of ions in the buffer solution on the sensing signal by utilizing the ion shielding effect of the gold film layer. At the same time, the initial electrical transfer characteristic curve is measured by the CNT-FET biosensor as the detection baseline. The sample to be tested is dropped onto the sensing interface, so that the fungal toxin in the sample specifically binds to the modified nucleic acid aptamer. The binding triggers a secondary conformational change in the modified nucleic acid aptamer, which moves closer to the surface of the gold film. The CNT-FET biosensor measures the change in transfer characteristic curve after specific binding, converting the electric field effect caused by the conformational shift of the modified nucleic acid aptamer into a signal of change in carrier concentration within the CNT-FET biosensor channel. Based on the linear proportional relationship between the change signal and the mycotoxin concentration, quantitative detection of mycotoxins in the sample to be tested is achieved.
2. The method for detecting fungal toxins using a carbon nanotube field-effect transistor biosensor based on nucleic acid conformational changes according to claim 1, characterized in that, The length of the oligothymidine deoxynucleotide fragment is 5 nt to 20 nt.
3. The method for detecting fungal toxins using a carbon nanotube field-effect transistor biosensor based on nucleic acid conformational changes according to claim 1, characterized in that, The preset spatial conformation is that the modified nucleic acid aptamer appears to be far away from or parallel to the gold membrane surface in the absence of a target.
4. The method for detecting fungal toxins using a carbon nanotube field-effect transistor biosensor based on nucleic acid conformational changes according to claim 1, characterized in that, The free end of the oligothymidine deoxynucleotide fragment forms a gold-sulfur bond with the gold film layer via a thiol group.
5. The method for detecting fungal toxins using a carbon nanotube field-effect transistor biosensor based on nucleic acid conformational changes according to claim 1, characterized in that, The 3' end of the modified nucleic acid aptamer probe is in a free state. When not bound to the target fungal toxin, the flexible support of the oligo-thymidine deoxynucleotide fragment keeps the modified nucleic acid aptamer in an extended state away from the gold membrane surface.
6. The method for detecting fungal toxins using a carbon nanotube field-effect transistor biosensor based on nucleic acid conformational changes according to claim 1, characterized in that, The thickness of the gold film layer is 15 nm to 30 nm.
7. The method for detecting fungal toxins using a carbon nanotube field-effect transistor biosensor based on nucleic acid conformational changes according to claim 1, characterized in that, The CNT-FET biosensor comprises, from bottom to top: The substrate layer is a silicon wafer pre-deposited with a carbon nanotube layer; The source and drain electrodes are symmetrically arranged above the carbon nanotube layer, and the carbon nanotubes between the source and drain electrodes form a channel. The gate dielectric layer covers the channel, source, and drain. A gold film layer is applied over the gate dielectric layer above the channel; A passivation layer is applied over the gate dielectric layer above the source and drain electrodes, and a sensing window is defined to expose the gold film layer. The biosensitive layer is composed of modified nucleic acid aptamers. The modified nucleic acid aptamers form gold-sulfur bonds with the gold film layer exposed by the sensing window, thereby anchoring the modified nucleic acid aptamers.
8. The method for detecting fungal toxins using a carbon nanotube field-effect transistor biosensor based on nucleic acid conformational changes according to any one of claims 1-6, characterized in that, The fungal toxins include glucosinolates.
9. The method for detecting fungal toxins using a carbon nanotube field-effect transistor biosensor based on nucleic acid conformational changes according to claim 8, characterized in that, The sequence of the modified nucleic acid aptamer is HS-TTTTTTTTCATGCGTCAGCATGGAGGGGACCT.
10. The method for detecting fungal toxins using a carbon nanotube field-effect transistor biosensor based on nucleic acid conformational changes according to claim 1, characterized in that, The detection limit of the method for mycotoxins is 3.9 fg / mL.