Construction method of aeromonas veronii overexpression micC attenuated strain, strain and application thereof
By overexpressing the micC gene in Aeromonas verrucosa using genetic engineering techniques, an attenuated strain was constructed, which solved the problems of drug resistance and limitations of traditional control methods for Aeromonas verrucosa, and achieved attenuation effect and enhanced immune response.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- HAINAN UNIV
- Filing Date
- 2025-12-31
- Publication Date
- 2026-05-08
AI Technical Summary
In the existing technology, Aeromonas versicolor poses a serious threat to aquaculture and public health. Antibiotic abuse leads to drug resistance problems, traditional prevention and control methods have limitations, and live vaccines have limited immunization protection rates.
By overexpressing the micC gene in Aeromonas verrucosa using genetic engineering techniques, an attenuated strain was constructed. Homologous recombination technology was then used to process the strain, resulting in the preparation of attenuated vaccines and biological additives.
Significantly reducing the virulence of Aeromonas verrucosa provides the possibility of preparing attenuated live vaccines, enhances the immune response of organisms, reduces cytotoxicity and adhesion to the host, and strengthens the host's immune response.
Smart Images

Figure CN121991868A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering, and particularly to an overexpression of Aeromonas verrucosa. micC Methods for constructing attenuated strains, strains, and their applications. Background Technology
[0002] Aquaculture accounts for nearly half of global fish production and is also a vital economic source for coastal regions worldwide. Aeromonas verrucosa (… Aeromonas veronii C 4 or A. veronii C 4) As a Gram-negative bacterium that is widely present in aquatic environments, it has become a serious zoonotic pathogen in aquaculture.
[0003] Aeromonas verrucosa has a wide host range, infecting various freshwater and marine economic animals. Studies have found that this bacterium can cause ulcers on the body surface of largemouth bass, gill congestion and hemorrhage, and enlargement of the liver, spleen, and kidneys. Histopathological observation shows significant degeneration, necrosis, and inflammatory cell infiltration in these tissues. In spotted bass, Aeromonas verrucosa infection can cause acute death, accompanied by abdominal hemorrhage, anal swelling, hemorrhage and congestion in the kidneys and liver, and spleen swelling. Furthermore, this bacterium also has a significant infectious capacity for giant freshwater prawns. The Aeromonas verrucosa WSQ-1 strain isolated from diseased giant freshwater prawns exhibits strong pathogenicity in the shrimp, with a 72-hour median lethal concentration (LD50) of 2.51 × 10⁻⁶. 6 CFU / mL. Aeromonas vera has been identified as one of the main pathogens in Chinese soft-shelled turtle farming.
[0004] Aeromonas verrucosa is a significant pathogen in fish, posing a persistent threat to aquaculture and public health. On one hand, antibiotic overuse has led to increasingly serious drug resistance problems. Studies have found that Aeromonas verrucosa isolated from different aquatic animals exhibit varying degrees of resistance to commonly used veterinary drugs. For example, strains from largemouth bass are resistant to doxycycline, tetracycline, and amoxicillin, while strains from giant freshwater prawns are resistant to 10 drugs, including clarithromycin, showing only moderate sensitivity to kanamycin. Aeromonas verrucosa from Nile tilapia is even completely resistant to ampicillin and tigecycline, exhibiting a multidrug resistance phenotype. On the other hand, traditional control methods have limitations. The residue problems and environmental pollution caused by the use of chemical drugs, as well as the limited immunoprotective rate of inactivated vaccines, have prompted researchers to seek safer and more effective alternatives.
[0005] The development of live vaccines is an effective strategy for preventing infection by this bacterium, and there is an urgent need for production and broad application prospects. Summary of the Invention
[0006] In view of the technical problems existing in the prior art, the present invention proposes an attenuated Aeromonas veronii, which was deposited at the Guangdong Provincial Center for Microbial Culture Collection on December 26, 2025, with the accession number GDMCC NO. 67551 and the Latin name Aeromonas veronii.
[0007] A method for constructing an attenuated strain of Aeromonas vesiculosus includes: treating Aeromonas vesiculosus with genetic engineering techniques to overexpress the micC gene in the Aeromonas vesiculosus.
[0008] The construction method described above, wherein the nucleotide sequence of the micC gene is shown in SEQ ID NO.1.
[0009] As described above, the Aeromonas vegetans species belongs to the Aeromonas genus.
[0010] In the construction method described above, the genetic engineering technique is homologous recombination technology.
[0011] An attenuated Aeromonas verrucosa constructed using the construction method described in any one of claims 2-5.
[0012] The application of attenuated Aeromonas versicolor or its secretions as described above in the preparation of attenuated Aeromonas versicolor vaccines.
[0013] As described above, the vaccine is used to prevent Aeromonas versicolor infection in organisms; preferably, the organisms are fish, livestock, poultry, or pets.
[0014] The application of attenuated Aeromonas verrucosa or its secretions in enhancing the immune response of organisms, as described above.
[0015] A fish feed additive comprising, as described above, attenuated Aeromonas verrucosa or its secretions.
[0016] The virulence of the mutant strain of Aeromonas verrucosa in this application is significantly reduced, achieving a good attenuation effect, which provides a possibility for the preparation of an attenuated live vaccine of Aeromonas verrucosa. Attached Figure Description
[0017] The preferred embodiments of the present invention will now be described in further detail with reference to the accompanying drawings, wherein: Figure 1 pBBR- is an embodiment of the present invention. micC Electrophoresis gel image for recombinant plasmid verification; where highlighted areas represent pBBR- micC Recombinant plasmids; Figure 2 This is an overexpression according to an embodiment of the present invention. micC Strain construction and validation; Figure 3 This is an overexpression according to an embodiment of the present invention. micC qPCR validation of genes; Figure 4 This is an embodiment of Aeromonas vesiculosus C4 wild-type and overexpression strain according to one of the present invention. micC Growth curve of Aeromonas versicolor; Figure 5 This invention relates to an embodiment of RT-qPCR analysis of WT and WT-p. micC Transcriptional levels of T3SS-related genes in strains overexpressing Aeromonas verrucosa; Figure 6 This is a Western blot analysis of WT and p according to an embodiment of the present invention. micC Differential expression of ExsA translation level in Aeromonas vernix casei strains; Figure 7 This is a measurement of swimming ability according to an embodiment of the present invention; Figure 8 This is a biofilm formation capacity test according to an embodiment of the present invention; Figure 9 According to an embodiment of the present invention, LDH release detection is used to assess the cytotoxicity of bacterial cells and culture supernatant; wherein, Figure 9 A shows WT and overexpression micC cytotoxicity verification results of Aeromonas versicolor cells; Figure 9 B shows WT and overexpression micC Cytotoxicity verification results of Aeromonas versicolor culture supernatant; Figure 10 This is a determination of the adhesion ability of bacteria to Caco-2 cells according to an embodiment of the present invention; Figure 11 According to an embodiment of the present invention, WT- pmic Determination of the toxicity and colonization ability of strain C in zebrafish; Figure 12 According to an embodiment of the present invention, WT-p micC The strain elicited a significant immune response in zebrafish. Detailed Implementation
[0018] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0019] In the following detailed description, reference can be made to the accompanying drawings, which form part of this application and illustrate specific embodiments of the present application. In the drawings, similar reference numerals describe substantially similar components in different figures. Specific embodiments of the present application are described in sufficient detail below to enable those skilled in the art to implement the technical solutions of the present application. It should be understood that other embodiments or modifications to the embodiments of the present application may also be utilized.
[0020] The "Aeromonas vesiculosus" mentioned in this article belongs to the genus Aeromonas in the family Vibrioceae. It is a Gram-negative short rod-shaped bacterium, a non-spore-forming facultative anaerobe, and possesses flagella, making it motile. Aeromonas vesiculosus has a type 3 secretion system (T3SS), and its main virulence factors include outer membrane proteins, aerolysins, T3SS-related effector proteins, and flagellin.
[0021] The pathogenic mechanism of Aeromonas vesiculosus is closely related to the various virulence factors it carries. Aeromonas vesiculosus can induce host disease through the type 3 secretion system (T3SS), a needle-like substance that injects effector proteins into the host cell cytoplasm. T3SS is controlled by the master transcriptional regulator exsA, which responds to numerous effector proteins and environmental signals, and many of these regulators play a role in the translation and stability of T3SS factors, including the regulation of many sRNAs.
[0022] The "T3SS" mentioned in this article refers to the type III secretion system, a highly specialized needle-like nanosyringe structure found in many Gram-negative pathogens. Its core function is to cross three bacterial cell membranes and the host cell membrane, directly injecting bacterial effector proteins into the host cell's cytoplasm. Aeromonas vera utilizes its T3SS as its core virulence weapon, directly injecting a series of effector proteins into the host cytoplasm upon contact with the host cell. These proteins disrupt the host's cytoskeleton, suppress immune defenses, and induce cell damage, thereby establishing infection.
[0023] The "sRNA" mentioned in this article refers to small RNAs, an important class of non-coding RNA molecules in bacteria, typically between 50 and 500 nucleotides in length. They regulate gene expression through base pairing and are important post-transcriptional regulatory factors. sRNAs can bind to target mRNAs (messenger RNAs), affecting their stability or translation efficiency, thus enabling rapid responses to environmental changes.
[0024] The “This article refers to” micC "OmpC" refers to a small RNA used for fine-tuning the expression of the outer membrane protein OmpC, a key regulator for bacterial adaptation to changes in osmotic pressure. In some embodiments, micCBy promoting the degradation of target mRNA through base pairing, the synthesis of outer membrane pore protein OmpC is precisely downregulated at the posttranscriptional level.
[0025] According to one embodiment of this application, Aeromonas versicolor... micC The DNA sequence of the gene is shown in SEQ ID NO.:1.
[0026] SEQ ID NO.: 1: GGCTTTATCCTGAGCCTGCTCGGCCCCATCCTGATCCTCGGGTTTCTGGCGCTCTAAGCCTGATTCCCACATTGCAGATAAAAAAGCCCGACCTTGTTGTCGGGCTTTGGCTGTTTGGAG.
[0027] According to one embodiment of this application, overexpression micC Aeromonas villus was deposited at the Guangdong Provincial Center for Microbial Culture Collection on December 26, 2025, with accession number GDMCC NO. 67551. The address of the depository is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. Here, represents the code of the Guangdong Provincial Center for Microbial Culture Collection.
[0028] The “This article refers to” micC strain Unless otherwise specified, all terms refer to micC Overexpressed Aeromonas verrucosa strains.
[0029] The term "Caco-2 cells" as used herein refers to a cell line isolated from human colon adenocarcinoma cells, which is widely used as an in vitro model to mimic the human intestinal barrier. This application does not limit the source of Caco-2 cells; any commercially available Caco-2 cells purchased may be used in this application.
[0030] Therefore, this application relates to an attenuated Aeromonas verrucosa, which was deposited at the Guangdong Provincial Center for Microbial Culture Collection on December 26, 2025, with accession number GDMCC NO. 67551.
[0031] The method for constructing the attenuated Aeromonas verrucosa strain includes: treating Aeromonas verrucosa with genetic engineering techniques to overexpress the micC gene in Aeromonas verrucosa.
[0032] In some embodiments, the nucleotide sequence of the micC gene is shown in SEQ ID NO.1.
[0033] SEQ ID NO.: 1: GGCTTTATCCTGAGCCTGCTCGGCCCCATCCTGATCCTCGGGTTTCTGGCGCTCTAAGCCTGATTCCCACATTGCAGATAAAAAAGCCCGACCTTGTTGTCGGGCTTTGGCTGTTTGGAG.
[0034] In some embodiments, Aeromonas vesiculosus belongs to the species Aeromonas vesiculosus within the genus Aeromonas.
[0035] In some embodiments, the genetic engineering technique is homologous recombination.
[0036] In some embodiments, attenuated Aeromonas versicolor or its secretions can be used to prepare attenuated Aeromonas versicolor vaccines and food additives for organisms, such as fish feed additives, poultry feed additives, livestock feed additives, pet food additives, etc.
[0037] In some embodiments, the vaccine is used to prevent Aeromonas versicolor infection in fish, livestock, poultry, pets, etc.
[0038] Furthermore, the attenuated Aeromonas verrucosa or its secretions of this application can be used to enhance the immune response of an organism.
[0039] The technical solution of this application will be described below through specific embodiments. Those skilled in the art should understand that the following embodiments are merely illustrative of the technical solution of this application and are not intended to limit the scope of protection of this application.
[0040] Example 1: Overexpression of Aeromonas vulgaris micC Construction of attenuated strains 1. Experimental strain The tested strain was Aeromonas versicolor ( Aeromonas veronii (This data was preserved by the Pathogenic Mechanism and Control Research Group of Pathogenic Microorganisms, School of Life and Health, Hainan University.)
[0041] 2. Construction of recombinant plasmids Using high-fidelity enzymes micC The DNA fragment was amplified, and the linearized fragment of the cloning vector pBBR was obtained by reverse PCR. This cloning vector is a commonly used vector in this field and is a commercially available product. micC The nucleotide sequence of the DNA fragment is shown in SEQ ID NO.:1.
[0042] The obtained fragments and linearized vectors were mixed at a molar ratio of 1:2 and ligated using a single-chain cloning enzyme.
[0043] The above ligation product was added to Escherichia coli DH5α competent cells, mixed and incubated on ice for 30 min, then incubated at 42°C for 1 min and then on ice for 3 min.
[0044] Add 1 ml of antibiotic-free LB medium to the tubes and incubate at 37°C in a shaker for 1 hour. Then, centrifuge at 6000 rpm for 3 minutes to collect the bacterial cells and spread them onto the corresponding antibiotic plates. After overnight incubation, screen for positive clones and sequence them.
[0045] 3. Thermal shock conversion Mix 50 μL of competent E. coli cells WM3064 with 5 μL of ligation product or plasmid and pipette until homogeneous, then incubate at 4°C for 30 min. In some embodiments, the ligation product may be DNA extracted from the positive clones of E. coli screened in step 2. The extraction method can be any method commonly used in the art, and will not be described in detail herein.
[0046] After treating with a 42℃ metal bath for 1 min, immediately place the tube in a 4℃ bath for 3 min. Then add 1 ml of LB liquid and 1 μL of DAP to the EP tube and incubate with shaking for 1-2 h.
[0047] Centrifuge the bacterial cells in the EP tube at 6000 rpm to obtain the precipitate, and spread the bacterial cells onto LB solid medium containing the corresponding antibiotics and nutrients. Invert the tube and incubate at 37°C until a single colony is formed.
[0048] Colony PCR and plasmid sequencing were performed using the recombinant vector validation primers to determine whether the recombinant vector was successfully constructed.
[0049] 4. Parental union Containing recombinant vectors E. coli WM3064 and A. veroni i C 4. Mix the mixtures in sterile 1.5 ml EP tubes at volume ratios of 1:1, 1:3, and 3:1 respectively to obtain three conjugation systems with a total volume of 800 μL.
[0050] Centrifuge at 6000 rpm for 3 min, then drop the bottom bacterial cells onto LB solid medium supplemented with DAP. Incubate at 30°C inverted for 24 h. Scrape off the bacterial cells with a sterile spreader and dilute them in 5 ml of liquid medium. Spread the diluted bacterial solution onto LB solid medium containing the corresponding antibiotic and incubate at 30°C inverted for 12-18 h.
[0051] The micC-overexpressing Aeromonas vegetans obtained in this embodiment was deposited at the Guangdong Provincial Center for Microbial Culture Collection on December 26, 2025, with accession number GDMCC NO. 67551.
[0052] 5. Overexpression micC Growth curve determination of strains Select strains and inoculate them into liquid culture medium, then incubate overnight at 30°C with shaking at 180 rpm.
[0053] Transfer to new LB liquid medium and continue shaking culture until the logarithmic phase.
[0054] Dilute the bacterial culture to OD 600 The value is approximately 0.02 (containing approximately 2 × 10⁻⁶). 7 CFU-containing bacteria were then spotted into 96-well or 48-well plates, with three technical replicates for each bacterium. Clean LB broth was used as a negative control. The plates were placed in a microplate reader and incubated at 30°C with continuous shaking for 24 hours. OD was measured every 1 hour. 600 value.
[0055] 6. Extraction of total bacterial RNA Reagent preparation: anhydrous ethanol, 75% ethanol, 400 μL / ml lysozyme, chloroform.
[0056] Take 1 ml of bacteria in the logarithmic growth phase, centrifuge at 8000 rpm for 1 min at 4°C. Discard the supernatant completely, add 100 μL of lysozyme, vortex to mix, and incubate at room temperature for 3-5 min.
[0057] Immediately add 900 μL of Buffer Rlysis-B, vortex to mix, and incubate at room temperature for 3 min. Add 200 μL of chloroform to the lysed sample, mix thoroughly, and centrifuge at 12,000 rpm for 5 min at 4 °C. After centrifugation, the sample will separate into upper and lower layers. Use a pipette tip to transfer the supernatant into a new enzyme-free EP tube.
[0058] Add 1 / 3 volume of anhydrous ethanol to the supernatant, mix well, let stand at room temperature for 3 minutes, centrifuge at 12000 rpm for 3 minutes at 4°C, and carefully discard the supernatant.
[0059] Wash the precipitate with 700 μL of 75% ethanol, centrifuge at 12,000 rpm for 3 min at 4 °C, and carefully discard the supernatant.
[0060] Repeat the washing step of the precipitate with 700 μL of 75% ethanol once.
[0061] Invert the centrifuge tube at room temperature for 10 minutes to allow the residual ethanol in the tube to evaporate completely. Add 30-50 μL of DEPC-treated ddH2O (double-distilled water) to dissolve the precipitate. Use immediately or store at -80°C for a long time.
[0062] 7. RNA is reverse transcribed into cDNA After determining the RNA concentration, follow the instructions for the HiScript ⑧ II Q RT SuperMix for qPCR kit. The reverse transcription system is shown in Table 1.
[0063] Table 1 Reverse transcription reaction system
[0064] Add each system to an enzyme-free PCR tube, then place it in a PCR instrument. The reverse transcription reaction program is shown in Table 2.
[0065] Table 2 Reverse transcription reaction procedure
[0066] The cDNA obtained after the reaction can be stored at -20℃ for a long time.
[0067] 8. Real-time quantitative PCR Based on the required template volume for the experiment, the cDNA obtained in the above experiment was diluted by a certain factor to ensure that the dilution factor was the same for different samples. Then, the 96-well fluorescence quantitative plate system was prepared, and the reaction system for each well is shown in Table 3.
[0068] Table 3 Real-time quantitative PCR reaction procedure
[0069] After the reaction is complete, the following steps are taken: The experimental results were analyzed using Graphpad, and a bar chart was created.
[0070] 9. Statistical Analysis Data were organized using Excel, statistical analysis was performed using SPSS 24.0, and data visualization was done using GraphPrism 9.0. Statistical analysis employed two-tailed t-tests, one- and two-way ANOVA, and Dunnett's test. p <0.05 is considered a significant difference. p <0.01 indicates a significant difference. p A value greater than 0.05 indicates no significant difference. The experiment was conducted independently three times.
[0071] The results showed that qPCR validated the overexpression micC strains (such as) Figure 1 and Figure 2 As shown), compared to the wild type, overexpression micC In strains micC Significant increase in expression (e.g.) Figure 3 (As shown). Analysis of its growth curve revealed that, compared to the wild type, overexpression... micC Subsequently, it did not promote or inhibit its growth. In summary, overexpression... micCThe strain was successfully constructed and its growth was not affected (e.g., Figure 4 (As shown).
[0072] Example 2: Overexpression micC The expression of T3SS-related genes in the strain was significantly reduced. Overexpression was extracted according to the method in Example 1. micC Total RNA from Aeromonas versicolor strains was extracted, reverse transcribed into cDNA, and then subjected to real-time quantitative PCR. The experimental methods will not be described in detail in this embodiment.
[0073] Select T3SS-related genes ascL , ascQ , ascF and exsA qPCR analysis revealed that overexpression micC The expression of T3SS-related genes in the strain was significantly reduced (e.g. Figure 5 (As shown). In overexpression micC back, exsA The expression was significantly reduced by 2.2 times (e.g. Figure 5 (as shown in A) ascQ The expression was reduced by 5.4 times (e.g. Figure 5 (as shown in B) ascL The expression was reduced by 4.9 times (e.g. Figure 5 As shown in C), ascF expression decreased by 2.6 times (e.g., Figure 5 (as shown in D).
[0074] To further verify the effect of micC overexpression on the translation of ExsA, the main regulator of T3SS in Aeromonas vulgaris, Western blot analysis was performed. The results showed that, compared with wild-type, overexpression of micC significantly improved the translation of ExsA. micC The translation of ExsA is greatly reduced (e.g.) Figure 6 As shown in the figure, this indicates overexpression. micC The strains were able to significantly inhibit the expression of Aeromonas verrucosa T3SS, thereby inhibiting the virulence expression of Aeromonas verrucosa.
[0075] Example 3: micC Significantly inhibits the motility of the strain The components of the Swimming motility-enhancing medium are shown in Table 4. Table 4 Swimming-type exercise culture medium
[0076] The test strain was cultured overnight and adjusted to OD. 600 The value is 0.3 1 μL of the culture was inoculated onto a movement agar plate containing 0.3% LB medium. The cells were incubated at 30°C for 8 hours. After incubation, images were taken using an imager, and the diameters of the motion zones were compared.
[0077] The motility diameter of the strain was measured on motility agar plates in 0.3% LB medium. The results showed that overexpression... micC Its kinetic diameter is significantly smaller than that of wild-type WT (e.g.) Figure 7 (As shown). micC Able to inhibit A.veronii C4 Its mobility.
[0078] Example 4: micC inhibition A.veronii C4 Formation of biofilms After overnight incubation, the bacterial culture was diluted to OD. 600 The value was approximately 0.02, and 400 μL was added to each well of a 48-well plate and incubated at 30°C for 48 hours.
[0079] Remove the bacterial culture, slowly rinse the 48-well plate twice with sterile PBS, and dry at room temperature for 10 minutes.
[0080] Add 1% sterile crystal violet to each well for staining and incubate at room temperature for 30 minutes.
[0081] Remove the crystal violet solution, wash twice slowly with sterile PBS, add 200 μL of 95% anhydrous ethanol to each well, let stand at room temperature for 5 min, and take pictures in the imaging system.
[0082] The absorbance at 570 nm was measured using an ELISA reader, and the values were statistically analyzed.
[0083] Crystal violet (CV) staining method for detecting WT and overexpression micC The biofilm-forming ability of the strain was assessed. Results showed that, compared to wild-type WT, overexpression... micC Biofilm formation ability was significantly reduced, and the OD of the biofilm stained with crystal violet was significantly reduced. 570 From 0.67±0.04 in WT to 0.39±0.03 in overexpressed micC (approximately 1.7 times) (e.g. Figure 8 A and Figure 8 (As shown in B). The above results indicate that, micC It can significantly reduce A.veronii C4 Its biofilm formation ability.
[0084] Example 5: micC The strain's cytotoxicity was significantly reduced. 1. Activation, passage, and cryopreservation of Caco-2 cells Cell activation: The frozen cells were removed from liquid nitrogen and quickly thawed in a 37°C water bath. After thawing, the cells were centrifuged at 1000 rpm for 4 min at room temperature, the supernatant was discarded, and DMEM complete medium (DEME medium supplemented with 10% fetal bovine serum (Solarbio, Beijing) and appropriate antibiotics (100 units / ml penicillin G and 100 μg / ml streptomycin (Solarbio, Beijing)) was added. The cells were then placed in cell culture flasks and cultured in a cell culture incubator at 37°C with 5% CO2.
[0085] Cell passage: After the activated cells adhere to the culture medium, discard the culture medium, slowly wash the cell surface with PBS, then add 1-2 ml of trypsin to digest for 3-5 min, centrifuge the digested cells at 1000 rpm for 4 min, discard the supernatant, and place the bottom cells in fresh DMEM complete culture medium to culture until the cells adhere.
[0086] Cell cryopreservation: Digested cells, serum, and DMSO were mixed in a ratio of 7:2:1 and added to cell preservation tubes. The tubes were then placed in a gradient cryopreservation box at -80°C for gradient cryopreservation. After cryopreservation, the cells were permanently stored in liquid nitrogen.
[0087] 2. micC Significantly inhibited the cytotoxicity of Aeromonas verrucosa against Caco-2 cells. Cell culture: Passaged adherent cells were seeded at a rate of 10,000 cells per well in 96-well plates and cultured overnight at 37°C in a cell incubator containing 5% CO2. Cells were washed twice with sterile PBS. The strain was then cultured in LB broth until the exponential growth phase (OD200). 600 =0.6), centrifuged at 6000 rpm for 3 min, then resuspended twice with PBS, and resuspended in DMEM medium containing 10% FBS. The treated cells and cells were co-incubated for 2 h at an MOI of 20. After incubation, the culture medium was removed, and the cells were washed three times with PBS. Fresh DMEM medium containing 400 μg / mL gentamicin was added. One h after infection, the culture supernatant was collected to detect LDH activity. LDH activity was detected using a commercial LDH cytotoxicity kit according to standard procedures.
[0088] Culture supernatant: Passaged adherent cells were seeded at a density of 10,000 cells per well in 96-well plates and cultured overnight at 37°C in a cell culture incubator containing 5% CO2. Cells were washed twice with sterile PBS. The target strain was cultured overnight until OD (October Expiratory Time). 600Centrifuge at 1.0°C, 4°C, 6000 rpm for 3 min. Aspirate the supernatant using a sterile syringe, discard the bacterial cells, and pass the supernatant through a 0.22 μm vacuum filter to remove residual bacteria. Co-incubate the cells with the filtered bacterial culture supernatant for 2 h at an MOI of 100. After incubation, remove the culture medium, wash the cells three times with PBS, and collect the culture supernatant to detect LDH activity. LDH activity was detected using a commercially available LDH cytotoxicity kit according to standard procedures.
[0089] Human colon cancer cells Caco-2 were respectively combined with WT (wild-type Aeromonas verrucosa) and overexpressed... micC The effect of Aeromonas verrucosa strains on cytotoxicity was assessed by co-incubation of bacterial cells and culture supernatant. The amount of LDH released from damaged cells was detected using an LDH kit. Cytotoxicity results showed that at a bacterial / cell ratio of 100 (MOI=20), overexpression... micC The cytotoxicity of the strain's cells and culture supernatant was significantly reduced. The LDH release from wild-type WT cells was 21.95% ± 1.61%, while the LDH release from overexpressing micC was reduced to 13.87% ± 1.85% (approximately 1.6-fold). Figure 9 (As shown in A); the LDH release from wild-type WT in the culture supernatant was 33.79% ± 4.02%, overexpression micC The LDH release decreased to 21.80% ± 0.88% (approximately 1.6 times) (e.g.) Figure 9 (As shown in B). In summary, micC The cytotoxicity of the bacterial cells and culture supernatant is reduced. In some embodiments, the culture supernatant includes wild-type Aeromonas verrucosa or micC Overexpressing secretions.
[0090] Example 6: micC Reduce the ability of bacteria to adhere to host cells The passaged Caco-2 adherent cells were passaged into 96-well plates at a density of 10,000 cells per well and cultured overnight at 37°C in a cell culture incubator containing 5% CO2.
[0091] Add the overnight cultured strains (WT or overexpressing micC) to 96-well plates at a density of 10 bacteria per cell and incubate at 37°C for 30 min.
[0092] After incubation, the bacterial solution was aspirated with a sterile syringe, and the cells were washed with sterile PBS to remove non-adherent bacteria.
[0093] Bacteria adhering to cells were quantified by serial dilution and counting of bacterial counts (CFU) on LB solid medium. Adhesion capacity was assessed by calculating the ratio of colony count to the number of bacteria in the initially infected cells.
[0094] The adhesion of WT and micC-overexpressing strains to human colon cancer cells Caco-2 was detected. The results showed that the cell adhesion rate of WT strains to Caco-2 cells was 6.01% ± 0.44%, while the cell adhesion rate of micC-overexpressing strains to Caco-2 cells was 2.66% ± 0.10% (approximately 2.3 times). Figure 10 As shown), indicating micC It reduced the ability of bacteria to adhere to Caco-2 human colon cancer cells.
[0095] Example 7: micC It exhibited low toxicity and safety in zebrafish models. 1. micC To improve the survival rate of the strain in the zebrafish model Juvenile zebrafish were purchased from Shandong Xiyue Biotechnology Co., Ltd., and kept at 28±1°C (14 / 101 light / dark ratio) with ventilation. Euthanasia was performed using the buffer MS-222 (200 mg / L; Aladdin) for at least 10 minutes until the fish stopped surgical movement and showed no tactile response at the time of death.
[0096] The E3 culture medium preparation group allocation is shown in Table 5.
[0097] Table 5 E3 culture medium
[0098] Add ultrapure water to a final volume of 1L and adjust the pH to 7.2-7.4. Store at 4℃. Before use, filter through a 0.22µm filter membrane for sterilization and add methylene blue to a final concentration of 0.0001% - 0.0003%.
[0099] Once the zebrafish embryos have developed into juveniles, juveniles at 3 dpi are taken and divided into groups of 30 fish per group in 6-well E3 medium plates and placed in an incubator at 28°C for 14 / 10 days and nights.
[0100] After activating the bacterial strains required for viral challenge, they were transferred to new LB liquid medium containing the corresponding resistance and incubated overnight at 30°C and 150 rpm.
[0101] The cultured bacterial solution was subjected to OD testing. 600 Determined, and based on 1OD 600 The bacterial solution contains 2×10 8 To calculate the CFU ratio, the bacterial culture was centrifuged at 6000 rpm for 3 minutes to collect the cells, which were then resuspended in sterile PBS buffer to prepare a final concentration of 5 × 10⁻⁶. 7 CFU / ml bacterial suspension.
[0102] The bacterial suspension was added to zebrafish culture medium, with PBS as a control. The mortality of zebrafish juveniles was recorded every 4 hours, and a survival rate curve was plotted.
[0103] 2. micC Reduce the colonization of the strain in zebrafish Take 5×10 7 Zebrafish juveniles were infected with a CFU / ml bacterial suspension. After 2 hours, the juveniles were removed, washed with sterile PBS, and placed in a new sterile E3 culture medium.
[0104] Five fish were randomly selected from each group at 12, 24, and 48 hours of culture. The samples were homogenized in sterile PBS, serially diluted 10-fold, and colony counted on LB agar plates.
[0105] Evaluation of wild-type WT and overexpression micC Survival rate of strains after challenge. The survival curves show that all strains in the wild-type WT treatment group died 28 hours after challenge, while those overexpressing… micC The treatment group had a 75% survival rate after 28 hours (e.g. Figure 11 As shown in Figure A). micC It significantly reduced host mortality and improved survival rates after the attack. Further evaluation of WT-p is needed. micC In vivo behavior at this dose, cellular load in zebrafish juveniles at 12, 24, and 48 hours post-infection, results as follows Figure 11 As shown in B, the cell load peaked 12 hours after infection and then gradually decreased.
[0106] Example 8: WT-p micC Trigger an immune response Obtaining the overexpression in Example 7 micC Zebrafish were co-cultured with *Aeromonas vesiculosus* strains, and their RNA was extracted. The zebrafish RNA extraction method included: The zebrafish were washed with sterile PBS and rinsed with DEPC water, then collected by centrifugation at 1000 rpm for 3 min.
[0107] Add 1 ml of Trizol reagent and shake to lyse the zebrafish. Let stand at room temperature for 5 min.
[0108] Add 200 μL of chloroform, shake to mix for 15 seconds, let stand at room temperature for 3 minutes, and centrifuge at 12,000 rpm for 15 minutes at 4°C.
[0109] Transfer the supernatant to a new enzyme-free EP tube, add 500 μL of isopropanol, mix well, let stand at room temperature for 10 min, then centrifuge at 12000 rpm for 10 min at 4°C.
[0110] Discard the supernatant, add 75% ethanol and mix well. Centrifuge at 7500 rpm for 5 min at 4°C, then discard the supernatant. Dry the mixture upside down at room temperature, add an appropriate amount of enzyme-free water to dissolve the precipitate, and store at -80℃.
[0111] The steps for RNA reverse transcription to cDNA and real-time quantitative PCR can be found in Example 1, and will not be repeated here.
[0112] Detection of immune-related genes in juvenile zebrafish by RT-qPCR IL-1β , IL-6 , IL-8 , IL-10 , TNF-α , MHC-I , LZM , SOD and CAT The relative expression level of ) was determined 24 hours after infection. Figure 12 A- Figure 12 As shown in Figure I, compared to the PBS control group, the pro-inflammatory factors in the experimental group ( IL-1β , IL-6 , IL-8 , TNF-α , MHC-I ) and anti-inflammatory factors IL-10 Expression increased significantly, while IL-6 The expression of [elements] did not change significantly. Furthermore, SOD and LZM The expression of was significantly increased, while CAT The expression did not change significantly.
[0113] The above embodiments are for illustrative purposes only and are not intended to limit the invention. Those skilled in the art can make various changes and modifications without departing from the scope of the invention. Therefore, all equivalent technical solutions should also fall within the scope of the invention.
Claims
1. An attenuated Aeromonas verrucosa strain was deposited at the Guangdong Provincial Center for Microbial Culture Collection on December 26, 2025, with accession number GDMCC NO. 67551.
2. A method for constructing an attenuated strain of Aeromonas verrucosa, comprising: Aeromonas vesiculosus was treated using genetic engineering techniques to improve the quality of the bacteria. micC Gene overexpression.
3. The construction method according to claim 2, wherein micC The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
4. The construction method according to claim 2, wherein the Aeromonas versicolor belongs to the species Aeromonas versicolor of the genus Aeromonas.
5. The construction method according to claim 2, wherein the genetic engineering technique is homologous recombination technology.
6. An attenuated Aeromonas verrucosa constructed by the construction method according to any one of claims 2-5.
7. The use of the attenuated Aeromonas versicolor or its secretions as described in claim 1 or 6 in the preparation of an attenuated Aeromonas versicolor vaccine.
8. The application according to claim 7, wherein the vaccine is used to prevent Aeromonas versicolor infection in organisms; preferably, the organism is fish, livestock, poultry, or pets.
9. The use of the attenuated Aeromonas verrucosa or its secretions as described in claim 1 or 6 in enhancing the immune response of an organism.
10. A fish feed additive comprising attenuated Aeromonas verrucosa or its secretions as described in claim 1 or 6.