Multiple RPA-CRISPR detection system for human papilloma virus typing
By using RPA-CRISPR/Cas12a technology to achieve eight-fold HPV amplification in a single reaction tube, combined with microfluidic chips and side-flow chromatography test strips, the time-consuming and equipment-dependent problems of HPV testing in low-resource areas are solved, and highly sensitive multiplex genotyping detection is achieved, which is suitable for primary healthcare and home self-testing.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHONGQING MEDICAL UNIVERSITY
- Filing Date
- 2026-01-26
- Publication Date
- 2026-05-08
AI Technical Summary
Existing HPV testing methods are time-consuming and cumbersome when applied in low-resource areas, and rely on expensive instruments and professional personnel. Furthermore, traditional POCT products lack sufficient sensitivity and specificity, making it difficult to achieve multiplex genotyping.
Using RPA combined with CRISPR/Cas12a technology, an eight-fold RPA amplification system was realized in a single reaction tube. High-risk HPV genotyping was performed using eight crRNAs. Multiple reaction steps were integrated using a microfluidic chip, and signal output was achieved using a side-flow chromatography test strip.
It achieves highly sensitive detection of eight high-risk HPV types within 40 minutes, covering 90% of cervical cancer cases. It is suitable for low-resource areas and home self-testing, and the operation is simplified without the need for professional equipment, thus improving the accuracy and accessibility of the test.
Smart Images

Figure CN121992149A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of multiplex nucleic acid detection technology, specifically relating to a multiplex RPA-CRISPR detection system for human papillomavirus typing. Background Technology
[0002] Cervical cancer is a global health problem and a leading cause of cancer-related deaths among women worldwide. In 2020, approximately 604,000 women were diagnosed with cervical cancer, and about 342,000 died from it. Although the incidence of cervical cancer has declined in high-income countries due to widespread cervical cancer screening and vaccination, low- and middle-income countries still bear a significant burden of cervical cancer. More than 85% of new cases and deaths are concentrated in resource-poor areas. It is estimated that over 95% of cervical cancers are caused by HPV. HPV nucleic acid molecular detection methods include Southern blotting, northern blotting, reverse dot blot hybridization, in situ hybridization, hybridization capture (HC)II, polymerase chain reaction (PCR), and microarray technology. All of these methods are time-consuming, cumbersome, and require expensive equipment and specialized personnel, making them unsuitable for low-resource areas. Early diagnosis of cervical HPV infection requires low-cost, highly operable, highly sensitive, and specific detection methods. Therefore, establishing a point-of-care testing (POCT) method for HPV that does not rely on laboratory equipment and professionals, and even allows for self-testing at home, could significantly increase the adoption rate of HPV screening. This approach will meet the needs of primary healthcare markets and home HPV screening, and has enormous market potential.
[0003] In recent years, CRISPR / Cas systems have demonstrated unparalleled advantages in the field of nucleic acid diagnostics, offering high specificity, sensitivity, and eliminating the need for expensive instruments. Typically, the target nucleic acid is first amplified using techniques such as PCR, LAMP, or RPA. Then, CRISPR RNA (crRNA) recognizes the amplicons. The crRNA activates the CRISPR Cas enzyme, which cis-cleaves the target DNA and trans-cleaves the reporter. Its trans-cleavage activity provides continuous cleavage of the reporter at 0.07–7 times per second, significantly enhancing signal output. Combined with lateral flow chromatography, the detection results can be visualized without the need for additional readout devices, making it ideal for point-of-care testing (POCT) scenarios.
[0004] Currently, mature commercial HPV point-of-care testing (POCT) products, such as HPV test strips, utilize cytological staining principles, resulting in sensitivity and specificity far lower than molecular detection methods. Antibody-antigen-related detection methods have a detection window period and are prone to false positives or false negatives. Other HPV nucleic acid point-of-care (POC) detection methods under development, based solely on isothermal amplification technologies such as LAMP, RCA, and RAA, suffer from technical bottlenecks including low throughput, unreliable specificity, and a lack of precise genotyping methods, making it difficult to achieve sensitive multiplex genotyping. Therefore, the development of a new generation of molecularly based HPV POC detection technologies is urgently needed. Summary of the Invention
[0005] To address the problems in existing technologies, this invention provides a multiplex RPA-CRISPR detection system for human papillomavirus (HPV) genotyping. Utilizing RPA combined with CRISPR / Cas12a technology, it targets eight major HPV subtypes (HPV16, 18, 11, 31, 33, 45, 52, and 58), covering 90% of cervical cancer cases. This effectively solves the technical challenge of low amplification throughput caused by primer interactions in RPA multiplex amplification. This invention achieves an eight-fold RPA amplification system within a single reaction tube, using eight crRNAs to detect these eight high-risk HPV types, achieving a detection depth of 10 copies / μL within a 40-minute reaction time. This invention integrates multiple reaction steps and reagents using a microfluidic chip, enabling point-of-care (POC) detection of these eight high-risk HPV types. This significantly promotes the development of POC-based HPV high-risk genotyping detection, increases the availability of HPV testing, and contributes to the standardization, precision, and widespread adoption of risk stratification management for HPV patients.
[0006] The technical problem solved by this invention is achieved by the following technical solution:
[0007] The first objective of this invention is to provide a multiplex RPA-CRISPR detection system for human papillomavirus (HPV) typing, comprising an RPA isothermal amplification module, a CRISPR multiplex detection module, and a signal output module. The RPA isothermal amplification module includes RPA amplification primers targeting eight HPV subtypes (16, 18, 11, 31, 33, 45, 52, and 58) and two lyophilized bulbs, enabling single-tube multiplex amplification of samples. The CRISPR multiplex detection module includes a multiple microcavity device, a detection system pre-embedded in the multiple microcavity device, and a constant-temperature heating pad. The signal output module is a lateral flow chromatography test strip.
[0008] Furthermore, the RPA amplification primers include forward primers and reverse primers, and the RPA amplification primer sequences are shown in SEQ ID NO.1-16.
[0009] Furthermore, the detection system of the CRISPR multiplex detection module includes cas12a, crRNA, and NEBbufferr2.1, and the crRNA sequence is shown in SEQ ID NO.17-24.
[0010] Furthermore, the detection system also includes a reporter probe, which is a fluorescent probe FQ with the sequence 5'-FAM-TTATT-3'-BHQ1, where the 5' end is labeled with a FAM group and the 3' end is labeled with a quenching group.
[0011] Furthermore, the detection system also includes a report probe and ddH2O. The report probe is a test strip probe FB, and the test strip probe sequence is 5'-FAM-CGCGCGCG-3'-Biotin, with the 5' end labeled with a FAM group and the 3' end labeled with a biotin group.
[0012] Furthermore, the detection system is prepared as follows: the cas12a, crRNA, bNEBbuffer r2.1, and FB probes in the detection system are made into CRISPR lyophilized beads targeting different HPV subtypes, and the eight target CRISPR lyophilized beads are pre-embedded in the eight chambers of the multi-chamber device, and then the side-flow chromatography test strip is placed into the test strip slot.
[0013] Furthermore, the lateral flow chromatography test strip includes a sample pad, a conjugate pad, an NC membrane, and an absorbent pad. The conjugate pad is coated with latex microspheres conjugated with anti-FAM antibodies. The NC membrane is sequentially provided with a detection T line and a control C line. The T line is immobilized with streptavidin, and the C line is immobilized with secondary antibody.
[0014] The second objective of this invention is to provide an application of the above-mentioned multiplex RPA-CRISPR detection system in non-diagnostic human papillomavirus typing.
[0015] The third objective of this invention is to provide a non-disease diagnostic method for human papillomavirus (HPV) typing based on a multiplex RPA-CRISPR detection system for HPV typing, comprising the following steps:
[0016] S1. Extract DNA from the sample to be tested;
[0017] S2. Multiple RPA reaction: Using the extracted DNA from the sample to be tested as a template, add RPA amplification primers, magnesium ions, and 2 lyophilized bulbs to the reaction apparatus, and react at 39℃ for 10~20 min.
[0018] S3, CRISPR reaction: After the RPA reaction is completed, a mixture of RPA reaction product and enzyme-free water is injected into the multi-chamber device and reacted on a heating pad at 48°C for 10-20 minutes.
[0019] S4. Side-flow chromatography detection: After the CRISPR reaction is complete, add enzyme-free water again, invert the device to make the mixture flow into the test strip tank for side-flow chromatography detection, and observe the results after 5 minutes.
[0020] Furthermore, the amplification reaction system for multiplex RPA reactions includes the following reagents and amounts: 2.5 μL of 10 μM forward primer, 2.5 μL of 10 μM reverse primer, and 45 μL of DNA template from the sample to be tested.
[0021] Furthermore, the CRISPR reaction system in step S3 includes the following reagents and amounts: 1 μM cas12a 1 μL, 2 μM crRNA 1 μL, 10 μM NEBbuffer r2.1 2 μL, reporter probe 2 μL, RPA product 2 μL, and ddH2O 12 μL.
[0022] Furthermore, when using lateral flow chromatography test strips to detect CRISPR products, a positive result is indicated by the development of the control C line and the absence of the detection T line, meaning the amplified product contains the HPV genotype to be detected. A negative result is indicated by the development of both the detection T line and the control C line, meaning the detected product does not contain the HPV genotype to be detected. When the target is present, the reporter probe is cleaved; the incomplete probe cannot bind to the latex microspheres and is immobilized on the T line, while the latex microspheres are immobilized on the C line by the secondary antibody. Therefore, the T line is not visible while the C line is visible, indicating a positive result. When the target is absent, the reporter probe is not cleaved; the complete probe binds to the latex microspheres and is immobilized on the T line, while the latex microspheres are immobilized on the C line by the secondary antibody. Therefore, both the T line and the C line are visible, indicating a negative result.
[0023] Compared with the prior art, the beneficial technical effects of the present invention are as follows:
[0024] This invention can detect HPV as low as 10 copies / μL, close to the single copy level, and its effect is comparable to qPCR.
[0025] This invention generates effective amplification and corresponding test strip signals for target HPV subtypes, with no cross-reaction between different HPV subtypes, avoiding false positives and ensuring diagnostic accuracy.
[0026] This invention can control the process from sample processing to result presentation within 50 minutes, achieve preliminary screening of high-risk groups in 30 minutes, achieve screening in primary hospitals or on-site in 40 minutes, and can be used for precise testing in large outpatient clinics in 50 minutes.
[0027] The present invention can detect eight HPV subtypes simultaneously using the same reaction system, covering 90% of cervical cancer cases, overcoming the shortcomings of traditional CRISPR-Cas detection signals that are difficult to distinguish.
[0028] The syringe used in this invention is a common medical syringe, and the simple heating pad is also readily available. The device is inexpensive to manufacture, easy to operate, and the results are easy to understand. It requires no expensive instruments or professional personnel and is suitable for self-testing in remote areas and at home.
[0029] The above description is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention and to implement it in accordance with the contents of the specification, and in order to make the above and other objects, features and advantages of the present invention more apparent and understandable, specific embodiments of the present invention are described below. Attached Figure Description
[0030] Figure 1 This diagram illustrates the principle and test results of the cross-reaction verification of eight crRNAs with eight HPV subtypes in Example 1 of this invention.
[0031] Figure 2 This is a PAGE gel electrophoresis image of RPA amplification of eight HPV subtype plasmids using eight RPA target primer pairs in Example 1 of the present invention.
[0032] Figure 3 This is a sensitivity test diagram of eight HPV subtypes under the combination of RPA 10min + CRISPR reaction 10min time in Example 4 of the present invention.
[0033] Figure 4 This is a sensitivity test diagram of eight HPV subtypes under the combination of RPA 10min + CRISPR reaction 20min in Example 4 of the present invention.
[0034] Figure 5 This is a sensitivity test diagram of eight HPV subtypes under the combination of RPA 20min + CRISPR reaction 20min time in Example 4 of the present invention. Detailed Implementation
[0035] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. It should be understood that the following embodiments are merely illustrative and explanatory of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.
[0036] In addition, unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be obtained by purchasing from the market or prepared by existing methods.
[0037] Example 1: Verification of Multiplex RPA-CRISPR Primers and crRNA Specificity
[0038] 1. CrRNA Cross-Reactivity Validation Experiment
[0039] The cross-reactivity of eight crRNAs with L1 gene plasmids of eight HPV subtypes (HPV16, 18, 11, 31, 33, 45, 52, and 58) was detected using an 8×8 lysis assay. A control group without any plasmids was also included. The CRISPR reaction system is shown in Table 1, and the crRNA sequences are shown in Table 2.
[0040] The reaction system was incubated at 48℃ for 60 min in a qPCR analyzer, and the fluorescence intensity was recorded every 20 s.
[0041] Table 1
[0042] Reagent Name Volume (μL) Enzyme-free water 12 NEBbuffer r2.1 2 Cas12a (1μM) 1 crRNA (2 μM) 1 FQ probe (10μM) 2 target DNA 2 total 20
[0043] Table 2
[0044]
[0045] 2. RPA amplification and PAGE gel validation
[0046] RPA amplification was performed on 8 HPV plasmids (100 copies / μL).
[0047] Reaction system: 1 magnesium ion + 2 RPA lyophilized pellets. The reagents in the RPA lyophilized pellets are shown in Table 3, and the RPA primer sequences are shown in Table 4.
[0048] After the reaction system is prepared, gently shake to mix 10 times, centrifuge for 10 seconds, and react at 39°C for 20 minutes.
[0049] The RPA amplification products of eight HPV plasmids were subjected to PAGE electrophoresis.
[0050] Table 3
[0051] Reagent Name Volume (μL) Forward primer (10 μM) 2.5 Reverse primer (10 μM) 2.5 HPV plasmid 45
[0052] Table 4
[0053] name SEQ ID NO sequence HPV16-F SEQ ID NO.1 CTGTCCCAGTATCTAAGGTTGTAAGCACGG HPV16-R SEQ ID NO.2 CTAATGGCTGACCACGACCTACCTCAACAC HPV18-F SEQ ID NO.3 CACTGGGCTAAAGGCACTGCTTGTAAATCG HPV18-R SEQ ID NO.4 CAACTGGGAGTCAGAGGTAACAATAGAGCC HPV11-F SEQ ID NO.5 CCTTTAGGCGTTGGTGTTAGTGGGCATCCATG HPV11-R SEQ ID NO.6 CATCCGATTTATTGGTTTGTAAGTCTGCAA HPV31-F SEQ ID NO.7 CTGTCCCAGTGTCTAAAGTTGTAAGCACGG HPV31-R SEQ ID NO.8 CACTAATACCTACACCTAATGGCTGCCCGC HPV33-F SEQ ID NO.9 CTTGAAATAGGTAGAGGGCAGCCATTAGGC HPV33-R SEQ ID NO.10 CCTCAATAATAGTATTTATAAGTTCTAAAGGTGG HPV45-F SEQ ID NO.11 CCCTTCTCCCAGTGGCTCTATTATTACTTC HPV45-R SEQ ID NO.12 CCAAACTTGTAGTAGGTGGTGGAGGGACAC HPV52-F SEQ ID NO.13 CCTGTCTCTAAGGTTGTAAGCACTGATGAG HPV52-R SEQ ID NO.14 CCCACTAATACCCACAACCTAAAGGCTGTCC HPV58-F SEQ ID NO.15 CTCCTGTGCCTGTGTCTAAGGTTGTAAGCA HPV58-R SEQ ID NO.16 CCAATGGCTGTCCTCTACCTATTTCAAGGC
[0054] 3. Result Verification
[0055] See appendix Figure 1 The 8×8 matrix showed no extensive cross-reactivity, indicating that crRNA exhibited good specificity. (See appendix) Figure 2 The results showed that the RPA primers could successfully amplify plasmids of eight HPV subtypes. The size of the amplicon was consistent with the target region of the RPA primers, and the corresponding bands were obvious and strong.
[0056] Example 2: Multiplex RPA-CRISPR Detection Method for Cervical Swab Samples
[0057] A method for extract-free processing of cervical swab samples and simultaneous detection of eight HPV subtypes includes the following steps:
[0058] (1) DNA in samples that do not require extraction: Take 100 μL of cervical swab dilution and heat it in a metal bath at 95°C for 5 minutes.
[0059] (2) Multiplex RPA reaction: The multiplex RPA reaction system includes 2.5 μL of forward primer (10 μM), 2.5 μL of reverse primer (10 μM), 1 magnesium ion, 2 RPA lyophilized pellets, and 45 μL of DNA template from the sample to be tested. The forward and reverse primers are added in equal portions according to the primers in Table 4 and mixed well.
[0060] Tap the tube wall gently 10 times, then centrifuge briefly for 10 seconds. React in a metal bath at 39°C for 10-20 minutes.
[0061] (3) CRISPR reaction: Configure the CRISPR reaction system according to Table 5. First, form lyophilized balls for different HPV subtypes using the CRISPR reaction system (50 nM cas12a, 100 nM crRNA, 1 μM NEBbuffer r2.1, 1 nM FB probe) and embed them in the eight chambers of the multi-chamber device. Then, add the RPA amplification product and ddH2O to the device and react at 48°C for 10-20 min on a heating pad.
[0062] Table 5
[0063] Reagent Name Volume (μL) <![CDATA[ddH2O]]> 12 NEBbuffer r2.1 (10μM) 2 Cas12a (1μM) 1 crRNA (2 μM) 1 FB probe (10nM) 2 RPA products 2 total 20
[0064] (4) Side flow chromatography detection: After the CRISPR reaction is completed, add enzyme-free water again, invert the device to make the mixture flow to the test paper tank for side flow chromatography detection, and observe the color development results after 5 minutes.
[0065] Example 3: Multiplex RPA-CRISPR Detection Method for Cervical Swab Samples
[0066] A method for extracting and processing cervical swab samples and simultaneously detecting eight HPV subtypes includes the following steps:
[0067] (1) Extracting DNA from the sample: Centrifuge at 13000 rpm for 10 min and discard the supernatant. Add DNA lysis buffer, incubate at 60℃ for 10 min, centrifuge again at 13000 rpm for 10 min, and collect the supernatant.
[0068] (2) Multiplex RPA reaction: The multiplex RPA reaction system includes 2.5 μL of forward primer (10 μM), 2.5 μL of reverse primer (10 μM), 1 magnesium ion, 2 RPA lyophilized pellets, and 45 μL of DNA template from the sample to be tested. The forward and reverse primers are added in equal portions according to the primers in Table 4 and mixed well.
[0069] Tap the tube wall gently 10 times, then centrifuge briefly for 10 seconds. React in a metal bath at 39°C for 10-20 minutes.
[0070] (3) CRISPR reaction: Configure the CRISPR reaction system according to Table 6. First, form lyophilized balls for different HPV subtypes using the CRISPR reaction system (50 nM cas12a, 100 nM crRNA, 1 μM NEBbuffer r2.1, 1 nM FB probe) and embed them in the eight chambers of the multi-chamber device. Then, add the RPA amplification product and ddH2O to the device and react at 48°C for 10-20 min on a heating pad.
[0071] Table 6
[0072] Reagent Name Volume (μL) <![CDATA[ddH2O]]> 12 NEBbuffer r2.1 (10μM) 2 Cas12a (1μM) 1 crRNA (2 μM) 1 FB probe (10nM) 2 RPA products 2 total 20
[0073] (4) Side-flow chromatography detection: After the CRISPR reaction is completed, add enzyme-free water again, invert the device to make the mixture flow to the test strip tank for side-flow chromatography detection, and then perform quantitative detection by the test strip scanner 5 minutes later.
[0074] Example 4: Response Sensitivity Assessment Using Multiple RPA-CRISPR Methods
[0075] Eight HPV subtype plasmids were serially diluted 10-fold using a standard plasmid serial dilution method, with a dilution range of 10. 4 ~1 copy / μL. Different concentrations of diluted single HPV plasmids were used as targets for detection, with ddH2O as a negative control. The detection limit was determined through detection. The detection method is as follows:
[0076] (1) Multiple RPA reactions:
[0077] The multiplex RPA reaction system includes 2.5 μL of forward primer (10 μM), 2.5 μL of reverse primer (10 μM), 1 magnesium ion, 2 RPA lyophilized pellets, and 45 μL of HPV plasmid, as detailed in Table 7.
[0078] Table 7
[0079] Reagent Name Volume (μL) Forward primer (10 μM) 2.5 Reverse primer (10 μM) 2.5 HPV plasmid 45
[0080] Tap the tube wall gently 10 times, then centrifuge briefly for 10 seconds. React in a metal bath at 39°C for 10-20 minutes.
[0081] (2) CRISPR reaction:
[0082] Configure the CRISPR reaction system according to Table 8 and react in a metal bath at 48°C for 10-20 min.
[0083] Table 8
[0084] Reagent Name Volume (μL) Enzyme-free water 12 NEBbuffer r2.1 2 Cas12a (1μM) 1 crRNA (2 μM) 1 FB probe (10nM) 2 target DNA 2 total 20
[0085] (3) Lateral flow chromatography detection: After the CRISPR reaction is completed, 60 μL of enzyme-free water is added to the 20 μL reaction system for lateral flow chromatography detection. Quantitative analysis is performed in the test strip scanner 5 minutes later.
[0086] See appendix Figure 3-5 These are the detection results under different reaction conditions. For example... Figure 3 As shown, with the combination of RPA 10 minutes + CRISPR 10 minutes (total reaction time 20 minutes), the detection sensitivity is 10 copies / μL for HPV16, and 10 for HPV11, 45, and 52. 2 Except for copies / μL, the detection limits for all other HPV subtypes reached 10. 3 copies / μL. Figure 4 As shown, in the combination of RPA 10 minutes + CRISPR 20 minutes (total reaction time 30 minutes), the detection sensitivity of HPV16 is improved to 1 copy / μL, HPV52 to 10 copies / μL, and other HPV subtypes can be detected up to 10 copies / μL. 2 copies / μL. Figure 5 As shown, under the conditions of RPA 20 minutes + CRISPR 20 minutes (total reaction time 40 minutes), the detection sensitivity for HPV16 is 1 copy / μL, and for HPV11, 33, and 58 it is 10 copies / μL. 2 The detection level for all HPV subtypes can reach 10 copies / μL.
[0087] The sequence numbers of the above embodiments of the present invention are for descriptive purposes only and do not represent the superiority or inferiority of the embodiments.
[0088] The embodiments of the present invention have been described above with reference to the accompanying drawings. However, the present invention is not limited to the specific embodiments described above. The specific embodiments described above are merely illustrative and not restrictive. Those skilled in the art can make many other forms under the guidance of the present invention without departing from the spirit and scope of the claims. All of these forms are within the protection scope of the present invention.
Claims
1. A multiplex RPA-CRISPR detection system for human papillomavirus (HPV) typing, characterized in that: The device includes an RPA isothermal amplification module, a CRISPR multiplex detection module, and a signal output module. The RPA isothermal amplification module includes RPA amplification primers targeting eight HPV subtypes (16, 18, 11, 31, 33, 45, 52, and 58) and two lyophilized bulbs, enabling single-tube multiplex amplification of samples. The CRISPR multiplex detection module includes a multiple microcavity device, a detection system pre-embedded in the multiple microcavity device, and a constant-temperature heating pad. The signal output module is a side-flow chromatography test strip.
2. The multiplex RPA-CRISPR detection system for human papillomavirus typing as described in claim 1, characterized in that: The RPA amplification primers include forward primers and reverse primers, and the RPA amplification primer sequences are shown in SEQ ID NO.1-16.
3. The multiplex RPA-CRISPR detection system for human papillomavirus typing as described in claim 1, characterized in that: The detection system of the CRISPR multiplex detection module includes cas12a, crRNA, and NEBbuffer r2.1, and the crRNA sequence is shown in SEQ ID NO.17-24.
4. The multiplex RPA-CRISPR detection system for human papillomavirus typing as described in claim 3, characterized in that: The detection system also includes a reporter probe, which is a fluorescent probe FQ with the sequence 5'-FAM-TTATT-3'-BHQ1, where the 5' end is labeled with a FAM group and the 3' end is labeled with a quenching group.
5. The multiplex RPA-CRISPR detection system for human papillomavirus typing as described in claim 3, characterized in that: The detection system also includes a reporter probe and ddH2O. The reporter probe is a test strip probe FB, and the test strip probe sequence is 5'-FAM-CGCGCGCG-3'-Biotin, with the 5' end labeled with a FAM group and the 3' end labeled with a biotin group.
6. The multiplex RPA-CRISPR detection system for human papillomavirus typing as described in claim 1, characterized in that: The lateral flow chromatography test strip includes a sample pad, a conjugate pad, an NC membrane, and an absorbent pad. The conjugate pad is coated with latex microspheres conjugated with anti-FAM antibodies. The NC membrane has a detection T line and a control C line arranged sequentially. The T line is immobilized with streptavidin, and the C line is immobilized with secondary antibody.
7. The application of the multiplex RPA-CRISPR detection system according to any one of claims 1-6 in the non-diagnostic detection of human papillomavirus typing.
8. A detection method for non-disease diagnostic purposes of human papillomavirus (HPV) typing based on a multiplex RPA-CRISPR detection system for HPV typing according to any one of claims 1-6, characterized in that, Includes the following steps: S1. Extract DNA from the sample to be tested; S2. Multiple RPA reaction: Using the extracted DNA from the sample to be tested as a template, add RPA amplification primers, magnesium ions, and 2 lyophilized bulbs to the reaction apparatus, and react at 39℃ for 10~20 min. S3, CRISPR reaction: After the RPA reaction is completed, a mixture of RPA reaction product and enzyme-free water is injected into the multi-chamber device and reacted on a heating pad at 48°C for 10-20 minutes. S4. Side-flow chromatography detection: After the CRISPR reaction is complete, add enzyme-free water again, invert the device to make the mixture flow into the test strip tank for side-flow chromatography detection, and observe the results after 5 minutes.
9. The detection method of the multiplex RPA-CRISPR detection system for human papillomavirus typing as described in claim 8, characterized in that: The amplification reaction system for multiplex RPA reactions includes the following reagents and amounts: 2.5 μL of 10 μM forward primer, 2.5 μL of 10 μM reverse primer, and 45 μL of DNA template from the sample to be tested.
10. The detection method of the multiplex RPA-CRISPR detection system for human papillomavirus typing as described in claim 8, characterized in that: The CRISPR reaction system in step S3 includes the following reagents and amounts: 1 μM cas12a 1 μL, 2 μM crRNA 1 μL, 10 μM NEBbuffer r2.1 2 μL, reporter probe 2 μL, RPA product 2 μL, and ddH2O 12 μL.