Strawberry anther culture regeneration plant optimization method based on multi-stage screening

Abstract

The invention relates to the field of plant biotechnology breeding, and discloses a strawberry anther culture regeneration plant optimization method based on multistage screening, which comprises the following steps: constructing a regeneration first generation regeneration plant population through in vitro induction culture; detecting the ploidy of a single plant by using flow cytometry, and removing plants with abnormal ploidy according to a ploidy detection result; calculating a genetic similarity coefficient between the ploidy-stable plant and the parent by using a simple repetitive sequence marker, and removing a genetic variation plant to retain a superior line group; planting the superior line group in a field, and then measuring agronomic, physiological and fruit quality indexes; integrating ploidy, genetic coefficient and multi-dimensional character indexes to establish a grading evaluation model, and dividing the plants into different grades to establish a superior line. By constructing a cell, molecule and phenotype three-level linkage screening system, the screening efficiency and accuracy of strawberry anther culture regeneration plants are improved, and objective quantification of optimal line establishment is realized.

Description

Technical Field

[0001] This invention relates to the field of plant biotechnology breeding, specifically to a method for selecting optimal strawberry anther culture regenerated plants based on multi-stage screening. Background Technology

[0002] Strawberry anther culture is an important method for germplasm creation and variety improvement. However, during in vitro culture, regenerated plants generally exhibit high ploidy variation rates. Current technologies typically lack an effective step for systematically screening the ploidy of regenerated populations during the seedling stage. Often, untested regenerated plants are directly transplanted to the field for full-cycle planting and management, resulting in a large number of invalid individuals with disordered ploidy or aneuploidy, wasting land resources and increasing production and management costs.

[0003] Meanwhile, in the process of selecting superior lines for regenerated plants, traditional methods mainly rely on direct observation of agronomic traits in the field. However, the expression of plant phenotypic traits is easily affected by environmental factors such as soil fertility and climate fluctuations. Relying solely on phenotypic observation makes it difficult to accurately distinguish between environmental variations and substantial genetic variations, resulting in a lag in variation identification and making it difficult to ensure that the genetic background of the selected superior lines is truly consistent.

[0004] Furthermore, existing evaluation systems often focus on the examination of single traits, lacking a comprehensive quantitative evaluation standard that integrates cytological characteristics, molecular genetic data, and field phenotypic performance. This makes it difficult for breeders to objectively and accurately determine the application value of plants when faced with complex regenerated populations, resulting in a significant degree of blindness and randomness in the selection process of superior lines. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides a method for selecting optimal strawberry anther culture regenerated plants based on multi-level screening. This method solves the problems in existing strawberry anther culture regeneration technologies, such as the tendency for regenerated plants to experience ploidy confusion and unexpected genetic variations, as well as the lack of quantitative grading and evaluation standards. These problems lead to a large workload, high degree of blindness, and poor genetic stability of superior lines during the breeding process.

[0006] To achieve the above objectives, this invention provides the following technical solution: a method for selecting superior strawberry anther culture regenerated plants based on multi-level screening. This method establishes a multi-dimensional evaluation system integrating cytological detection, molecular marker analysis, and phenotypic identification, aiming to eliminate variant individuals layer by layer from the regenerated population and establish the superior line grade.

[0007] The specific technical solution is as follows: After obtaining the first generation of regenerated plant population through in vitro induction culture, flow cytometry was used to screen individual plants for ploidy. Plants with abnormal ploidy were directly removed based on the ploidy detection results of nuclear DNA content, and only plants with stable ploidy were retained for the next round of screening. Subsequently, genomic DNA was extracted from the plants with stable ploidy and amplified using simple repetitive sequence markers. The degree of genetic variation was quantified by calculating the genetic similarity coefficient between each plant and the donor parent. Based on this, plants with genetic variations were removed, and a population of superior lines with highly consistent genetic backgrounds was retained. After completing the above laboratory screening, the superior line population was planted in the field, and multidimensional data such as agronomic traits, physiological indicators, and fruit quality were collected. Finally, by establishing a graded evaluation model, the regenerated plants were classified into different grades by comprehensively considering ploidy status, genetic similarity, and field performance data, thereby establishing the target superior lines.

[0008] In a preferred embodiment of the present invention, during the in vitro induction culture stage, flower buds developed to the uninucleate marginal stage are selected as explants. The anthers from the flower buds are inoculated into a callus induction medium and cultured in the dark to induce pollen cells to dedifferentiate and form callus. Under light conditions, the callus is then induced to redifferentiate into adventitious shoots using a differentiation medium, and finally, a regenerated population is obtained through rooting culture. This process, through specific light, temperature, and culture medium conditions, induces pollen to shift from the gametophyte developmental pathway to the sporophyte developmental pathway.

[0009] In a preferred embodiment of the present invention, a reference with known ploidy is introduced as an internal control standard in the ploidy detection process. During the detection process, the DNA fluorescence intensity of the sample and the internal control standard are simultaneously acquired, and the ratio of their peak fluorescence intensity is calculated to obtain the relative peak ratio. Based on whether the relative peak ratio conforms to a preset haploid or diploid characteristic ratio, the stability of the plant's ploidy is determined. This method utilizes the principle of relative quantification to quickly identify and eliminate aneuploids and ploidy chimeras.

[0010] As a preferred embodiment of the present invention, the genetic similarity coefficient is calculated based on the principle of band sharing: the number of shared bands between the plant under test and the donor parent is multiplied by two as the numerator, and the sum of the number of shared bands multiplied by two and the number of unique bands of each parent is used as the denominator. The ratio of the two values ​​directly reflects the genetic distance between the plant under test and the parent at the genomic level.

[0011] As a preferred embodiment of the present invention, a preset genetic similarity coefficient screening threshold is set during the molecular screening stage. Individual plants with a genetic similarity coefficient below this threshold are identified as genetically variant plants and removed. For the remaining individual plants with a similarity coefficient above the threshold, cluster analysis is used for further screening to select individual plants that cluster within the same major branch as the donor parent, thereby ensuring the genetic background consistency of the superior line population.

[0012] As a preferred embodiment of the present invention, the field measurement indicators cover the plant's morphological structure and physiological metabolic characteristics: agronomic traits include plant height, stem diameter, leaf area, biomass, and root morphology; physiological indicators include chlorophyll content, net photosynthetic rate, stomatal conductance, and root activity; and fruit quality indicators include single fruit weight, soluble solids content, titratable acid content, soluble sugar content, soluble protein content, and vitamin C content. The collection of data from multiple indicators provides data support for subsequent model evaluation.

[0013] As a preferred embodiment of the present invention, the determination of root vitality is based on the principle of enzymatic reaction: the root system of the plant after transplanting is obtained, phenyltetrazolium is reduced by dehydrogenase to generate formazan, and the metabolic intensity of the root system is quantified by measuring the amount of formazan generated and combining root weight and time parameters.

[0014] As a preferred embodiment of the present invention, the graded evaluation model divides plants into three levels based on genetic stability and phenotypic consistency: Level I highly stable plants exhibit stable octoploid characteristics, a genetic similarity coefficient higher than the preset high genetic stability threshold, and agronomic traits that are no different from the parents; these plants are designated as direct utilization materials. Level II basically stable plants are predominantly octoploid, with a genetic similarity coefficient between the screening threshold and the high stability threshold, and slight phenotypic variations; these plants are used as observation materials. Level III low-stability plants exhibit disordered ploidy, a low genetic similarity coefficient, and are accompanied by growth retardation or malformation; these plants are eliminated.

[0015] This invention provides a method for selecting optimal strawberry anther culture regenerated plants based on multi-stage screening. It has the following beneficial effects: 1. This invention extracts genomic DNA for SSR amplification and calculates the genetic similarity coefficient, which can accurately quantify the genetic differences between regenerated plants and donor parents at the molecular level. This overcomes the shortcomings of traditional breeding, which relies solely on field phenotypic observation and is easily affected by environmental conditions, leading to delayed or misjudged variation identification. This ensures the true consistency of the genetic background of the selected superior line population.

[0016] 2. This invention establishes a graded evaluation model by comprehensively considering ploidy test results, genetic similarity coefficients, and multi-dimensional agronomic and physiological indicators. It transforms complex biological traits into quantitative classification standards of Grade I, Grade II, and Grade III, thereby achieving an objective determination of the application value of regenerated plants. This solves the problem of high blindness in the selection of superior strains in strawberry anther culture breeding due to the lack of a unified evaluation system.

[0017] 3. This invention introduces flow cytometry detection during the seedling stage of in vitro culture and uses an internal reference method to compare and analyze the nuclear DNA content of regenerated plants. This allows for the rapid identification and removal of plants with disordered ploidy and aneuploidy before transplanting and planting, effectively preventing invalid individuals from entering the subsequent cumbersome field planting and management process, thereby reducing land resource occupation and production costs. Attached Figure Description

[0018] Figure 1 This is a flowchart illustrating the overall process of a method for selecting regenerated strawberry anther culture plants based on multi-stage sieving, according to an embodiment of the present invention. Figure 2 This is a schematic diagram of the ploidy screening logic based on flow cytometry in step S200 of an embodiment of the present invention. Figure 3 This is a schematic diagram illustrating the principle of SSR marker-based genetic similarity coefficient calculation and screening in step S300 of an embodiment of the present invention. Figure 4 This is a framework diagram of the comprehensive evaluation model and the superior classification standard in step S500 of one embodiment. Detailed Implementation

[0019] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0020] Reference Appendix Figure 1 This invention provides a method for optimizing strawberry anther culture regenerated plants based on multi-level screening. This method constructs a multi-dimensional collaborative screening platform encompassing cells, molecules, and phenotypes. Through a progressive screening process, it addresses the lack of systematic standards for evaluating the genetic stability of strawberry anther regenerated plants. The optimization process mainly includes: Step S100, the construction of the regenerated plant population, primarily involves obtaining a first-generation regenerated plant population for subsequent screening through in vitro induction culture. This process uses strawberry varieties (such as Miaoxiang 7) as donors, selecting flower buds developed to the uninucleate marginal stage as explant material. Anthers are inoculated into a callus induction medium containing a specific hormone ratio (such as 6-benzylaminopurine and naphthaleneacetic acid) for dark culture to induce callus formation. Subsequently, the callus is transferred to a differentiation medium, where adventitious shoots are induced to differentiate under light conditions. These adventitious shoots are then cut and transferred to a rooting medium. After the root system has fully developed, the shoots are hardened off and transplanted to obtain a complete first-generation regenerated plant population. This step provides a basic sample library for subsequent genetic stability screening.

[0021] Step S200, ploidy screening based on cytological analysis, serves as the first-level screening in the optimization system. Its core logic is to rapidly identify and eliminate plants with abnormal ploidy using flow cytometry, thereby narrowing down the sample range for subsequent high-cost testing. Specifically, a lysis buffer containing a nuclear protectant and a cell suspension of regenerated plant leaf tissue are prepared and stained with a fluorescent dye (such as propidium iodide). The DNA fluorescence intensity of the samples is detected using flow cytometry, with diploid wild strawberry used as an internal control. Based on the biological characteristic that cultivated strawberries are typically octoploid, the target product of anther culture should be haploid (corresponding to biological tetraploid) or naturally doubling diploid (corresponding to biological octoploid). Therefore, based on the detected peak ratio of DNA fluorescence intensity, plants with peak ratios conforming to haploid characteristics (i.e., the first preset characteristic ratio, approximately 2) or diploid characteristics (i.e., the second preset characteristic ratio, approximately 4) are screened, while aneuploid and ploidy-disordered plants are eliminated at this stage.

[0022] Step S300, genetic background rescreening based on SSR (simple repeat sequence) molecular markers, serves as the second-level screening, aiming to accurately determine the genetic consistency of plants with confirmed stable ploidy at the molecular level. In step S300, genomic DNA is extracted from regenerated plants and amplified using polymerase chain reaction (PCR) with highly polymorphic SSR primers. After electrophoresis and color development, the amplified products are analyzed to construct a binary data matrix by observing the presence or absence of bands. Based on this matrix, the genetic similarity coefficient between the regenerated plants and the donor parent is calculated using the Dice similarity coefficient formula. The calculation logic for the genetic similarity coefficient is: twice the number of common bands between the two samples, divided by twice the number of common bands and the sum of the number of unique bands in each sample. Based on the calculation results, a screening strategy is implemented: first, plants with a genetic similarity coefficient lower than a preset genetic similarity coefficient screening threshold (e.g., 0.85) are removed; then, cluster analysis is performed on the remaining plants, selecting those clustered within the same major branch as the donor parent to form a superior population with a highly consistent genetic background.

[0023] Step S400, the detailed identification of phenotypic traits and physiological indicators, serves as the third level of screening. It involves reintroducing the superior lines selected at the molecular level into the field environment for phenotypic verification. After transplanting, the superior lines are systematically measured at specific growth stages (e.g., 90 days after transplanting), including growth indicators such as plant height, stem diameter, leaf area, and biomass, as well as physiological indicators such as photosynthetic parameters and chlorophyll content. Simultaneously, root morphology (total length, volume, surface area) and vigor are quantitatively analyzed, and the propagation coefficient of stolons is continuously calculated. At fruit maturity, yield components and internal fruit quality (such as sugar and acid content, protein content, etc.) are further measured. Step S400 ensures that the selected plants are not only genomically stable but also maintain the superior agronomic traits of the donor parents in actual production, without phenotypic deterioration.

[0024] Finally, in step S500, the comprehensive evaluation and superior line establishment stage, the multi-level detection data from cytology, molecular biology, and phenotyping are integrated to establish a graded evaluation model. Based on the compliance of each level of detection indicators, the regenerated plants are divided into different grades: Grade I, highly stable plants, characterized by stable chromosome number (e.g., octoploid), extremely high genetic similarity coefficient (e.g., >95%), and no phenotypic differences; these plants are established as core germplasm or production seedlings; Grade II, basically stable plants, characterized by minor variations in chromosomes and genetic background but with basically normal phenotypes, can be retained for observation as secondary materials; Grade III, low-stability plants, characterized by chaotic genetic background and phenotypic aberrations, are eliminated. Through this closed-loop process from micro to macro, from initial screening to final selection, efficient selection of regenerated strawberry anther plants is achieved.

[0025] See attached document Figure 1 The preferred method first performs step S100, which is the construction of a regenerated plant population. This step aims to obtain a first-generation regenerated plant population for subsequent genetic stability evaluation through a standardized in vitro induction culture system.

[0026] In the process of material acquisition and population construction, non-virus-free seedlings of the strawberry variety Miaoxiang 7 were selected as donor materials. Flower buds with a diameter of approximately 4 mm and whose pollen development was confirmed by microscopic examination to be in the uninucleate marginal stage were selected (studies have shown that most flower buds of this diameter are in the uninucleate marginal stage, resulting in the highest induction rate). After surface disinfection of the collected flower buds, the anthers were extracted under aseptic conditions using a dissecting needle and inoculated into callus induction medium.

[0027] The callus induction medium consisted of MS medium, 1.0 mg / L 6-benzylaminopurine, 0.5 mg / L naphthaleneacetic acid, and 30 g / L sucrose, with the pH adjusted to 5.8. The inoculated anthers were placed in the dark at (25±1)℃ for 4 to 6 weeks until pale yellow, dense callus tissue was induced.

[0028] Healthy callus tissue was selected and transferred to differentiation medium. The differentiation medium consisted of MS medium, 0.25 mg / L 6-benzylaminopurine, 0.3 mg / L naphthaleneacetic acid, and 30 g / L sucrose, with the pH maintained at 5.8. Differentiation conditions were set as follows: light intensity of 2000 lux, and a photoperiod of 16 hours of alternating light and dark (8 hours). Under these conditions for 3 to 4 weeks, the callus tissue was induced to differentiate into adventitious buds 2 to 3 cm tall with 2 to 3 young leaves.

[0029] Adventitious buds were cut and transferred to rooting medium. The rooting medium consisted of half MS medium (MS medium with macroelements reduced by half), 0.5 mg / L indolebutyric acid, 20 g / L sucrose, and 6 g / L agar, with the pH adjusted to 5.8. The plants were cultured under the same light and temperature conditions as the differentiation culture for 2 to 3 weeks. When the roots reached a length of over 3 cm, the plants were hardened off and transplanted to obtain a first-generation population of 100 complete regenerated plants, which were used in this example for subsequent comprehensive evaluation of genetic stability.

[0030] Reference Appendix Figure 1 and attached Figure 2 After completing step S100 and obtaining the first generation of regenerated plantlets, the method enters the first stage of the multi-stage screening process, namely, performing step S200, ploidy screening based on cytological analysis. This step is implemented as follows: Reagents for flow cytometry were prepared. First, MgSO4 buffer was prepared by precisely adding 0.246 g of magnesium sulfate heptahydrate (MgSO4·7H2O), 0.37 g of potassium chloride, and 0.12 g of hydroxyethylpiperazine ethanesulfonic acid to a 100 mL system, and then bringing the volume to 100 mL with double-distilled water. Cell lysis buffer was then prepared based on this buffer. For example, a 1 mL system contained 25 μL of polyethylene glycol octylphenyl ether, 1 mg of dithiothreitol, and 975 μL of MgSO4 buffer.

[0031] Leaves from the regenerated plant obtained in step S100 were selected as test samples. Approximately 0.2 g of leaf tissue was taken, washed with deionized water, and blotted dry. The tissue was then rapidly minced in 0.8 mL of pre-chilled cell lysis buffer to release the cell nuclei. The minced mixture was filtered through a 300-mesh filter to remove tissue residue. Pre-chilled propidium iodide solution and ribonuclease solution were added to the filtrate, maintaining a final concentration of 50 μg / mL for both. The sample was incubated on ice in the dark for 30 to 60 minutes to complete the specific staining of nuclear DNA.

[0032] Flow cytometry was used to analyze the stained samples. The excitation wavelength was set to 488 nm to excite propidium iodide fluorescence, and 10,000 particle signals were collected for each sample. Diploid wild strawberry was used as an internal control during the detection process. The ratio of the peak fluorescence intensity of the sample DNA to that of the internal control DNA was used as a screening criterion. The following screening steps were performed: plants with a relative peak ratio of 2 or 4 were retained, while plants with a relative peak ratio deviating from these values ​​were removed. A relative peak ratio of 2 corresponds to tetraploid strawberries (i.e., haploids derived from anther culture), and a relative peak ratio of 4 corresponds to octoploid strawberries (i.e., diploids derived from anther culture). This step excluded individuals with non-target ploidy (i.e., neither haploid nor diploid) and ploidy disorders, retaining only plants with the expected ploidy of their genetic material for the next stage of screening.

[0033] See attached document Figure 1 and attached Figure 3 After completing the initial cytological ploidy screening in step S200, step S300, a genetic background rescreening based on simple repetitive sequence markers, is performed on the retained ploidy-stable plant population. This step aims to evaluate the genetic consistency between the regenerated plants and the donor parents at the molecular level, and to remove individuals that, although ploidy-normal, have significant genomic variations.

[0034] In the specific implementation, the first step was the extraction and quality control of genomic DNA. Genomic DNA was extracted from the leaves of each regenerated plant using the cetyltrimethylammonium bromide method. After extraction, the purity and concentration of the DNA solution were detected using a CLARIOstar multi-functional microplate reader. This refers to the absorbance value of the sample at a wavelength of 260nm (the characteristic absorption peak of nucleic acids). It refers to the absorbance value of the sample at a wavelength of 280nm (the characteristic absorption peak of the protein). This is the ratio of the two, serving as a key indicator for measuring DNA purity. This embodiment requires... The ratio was between 1.8 and 1.9, and the DNA concentration was adjusted to be no less than 50 ng / μL.

[0035] Polymerase chain reaction (PCR) amplification was performed using 25 pairs of simple repetitive sequence primers that had been screened and validated. The primer lines were designed based on strawberry genome sequence information (referencing publicly available primer sequence resources such as those published by Huang Zhicheng and Cai Luying). They were selected from 50 synthesized primer pairs through preliminary screening using parental and regenerated plant DNA as templates, exhibiting clear bands, significant polymorphism, and stable repetition. The specific nucleotide sequences of these 25 primer pairs (FA1 to FA25) are listed below, oriented from the 5' end to the 3' end: FA1 (forward primer F: GAGCCTGCTACGCTTTTCTATG; reverse primer R: CCTCTGATTCGATGATTTGCT); FA2 (forward primer F: GCGAGGCGATCATGGAGAGA; reverse primer R: GCGTTTCCTACGTCCCAATAAATC); FA3 (forward primer F: GCGGGCTGTCCACACTCCTTTCT; reverse primer R: GCGATGCGTAAGTCTCTTCAAATA). FA4 (forward primer F: GCGAACCCCATTAACAGCTTCA; reverse primer R: GCGATCAAATTCCCCTCTAACAAT); FA5 (forward primer F: GAGCTACCAATGCCATCAAAA; reverse primer R: GCGCATTCGACTCTGTAACTCT). FA6 (forward primer F: AACAACAGCTCTCGCATATT; reverse primer R: GAACCATCCAGACTATCTCC); FA7 (forward primer F: CATTGCCCACCTCGTAACTT; reverse primer R: TGCAATCTTGCATGTAGCATAA); FA8 (forward primer F: CAAATCCTGTTCCTGCCAGT; reverse primer R: CCGGTCACTAGAACCGAAAG); FA9 (forward primer F: ACACTGCGTTTTGTGTGCTC; reverse primer R: CAGGCCGTAATCCATTTCTT). FA10 (forward primer F: ACTGGTGGAGGAGAGGACTGTA; reverse primer R: TGTGGAGCAGAGAGAATTGAAG). FA11 (forward primer F: CCGGTCAAAACACCAAAACT; reverse primer R: CTGGAAAGGAAACGATTGGA). FA12 (forward primer F: TCATCCTCTTTCACCTCCACTT; reverse primer R: TCAAAAGACTTGGAAATGTTGC). FA13 (forward primer F: GGCACCACGGATTTCAAGTA; reverse primer R: TGTTGCGTTTTCAAGCTCAC). FA14 (forward primer F: ATCAGATTGGGGGTTAGGG; reverse primer R: CCCAATGGGTCCTGTTGACC). FA15 (forward primer F: TTGAAGAACTCAGAGATGTCAAGC; reverse primer R: GGATGAACAGAGAGTCCGGTA). FA16 (forward primer F: CCACCCTCCAATATAACCC; reverse primer R: AGGAGAACCAAGATTAAGCC); FA17 (forward primer F: GCATCTCCAAAGCTCTCACG; reverse primer R: GCCTAAACCAAACCCAAAATC). FA18 (forward primer F: ACGAGGCCTTGTCTTCTTTGTA; reverse primer R: GCTCAGCTTTATTGTCTTGCT). FA19 (forward primer F: GGCAAATGAAAGTTCAATCTTTGTA; reverse primer R: TGTCGTGTGTTTTAGTTCACAATG); FA20 (forward primer F: TTTGTATCGGCCCAAAAGAG; reverse primer R: GTCGTTTTCCACTGCTGGAT); FA21 (forward primer F: GGAATCCAAGTTACAGGCTTCA; reverse primer R: AAGGAGCCTCTCCAATAGCTTC). FA22 (forward primer F: CACGAGGCCTTGTCTTCTTTGTA; reverse primer R: GCTCCAGCTTTATTGTCTTGCT); FA23 (forward primer F: CCCCACCCTAAACTAACCCAA; reverse primer R: CGACGAGGATGAAGAAGAGC). FA24 (forward primer F: TGACAAAACATTCAACCACAC; reverse primer R: GTGCCCTCAGAAGACTACC). FA25 (forward primer F: AAATCCTGTTCCTGCCAGTG; reverse primer R: TGGTGACGTATTGGGTGATG).

[0036] A 20 μl simple repetitive sequence reaction system was established, comprising: 14.8 μl double-distilled water, 0.4 μl deoxyribonucleoside triphosphate mixture, 2 μl buffer, 0.3 μl forward primer (20 μM), 0.3 μl reverse primer (20 μM), 2 μl DNA template, and 0.2 μl Taq DNA polymerase. Polymerase chain reaction amplification was performed using a falling PCR program: first, pre-denaturation at 94 °C for 5 min; then 35 cycles, each cycle consisting of 30 s denaturation at 94 °C, 40 s falling annealing at 65 °C to 60 °C (i.e., annealing temperature gradually decreasing with each cycle), 50 s extension at 72 °C; and finally, 5 min extension at 72 °C.

[0037] Polymerase chain reaction (PCR) products were separated by 8% polyacrylamide gel electrophoresis, followed by silver staining detection. The specific staining and development process was as follows: The gel was immersed in staining solution for 15 min, which was prepared by 50 mL of anhydrous ethanol, 450 mL of double-distilled water, 2.5 mL of glacial acetic acid, and 1 g of silver nitrate. After staining, the gel was transferred to chromogenic solution for 15 min, which was prepared by 25 g of sodium carbonate, 1 mL of formaldehyde, and double-distilled water to a final volume of 1 L. When the bands were clearly visible, the chromogenic solution was quickly discarded, and stop solution (% glacial acetic acid solution) was added and shaken for 3 min. Finally, the gel was washed with deionized water for 10 min.

[0038] Electrophoretic patterns were recorded using a gel imaging system (such as Alphalmager EP). A binary data matrix was constructed based on the pattern, with a clear band at each migration site marked as 1 and no band as 0. This matrix was then imported into NTSYS-PC statistical software (version 2.1), and the genetic similarity coefficient between the regenerated plant and the donor parent was calculated using the Dice similarity coefficient formula. Genetic similarity coefficient. The calculation formula is as follows: ; in: This represents the genetic similarity coefficient between the regenerated plant sample to be tested and the donor parent. This indicates the number of bands shared by the regenerated plant sample and the donor parent. This indicates the number of bands unique to the sample of the regenerated plant being tested. This indicates the number of bands unique to the donor parent.

[0039] Based on the calculated genetic similarity coefficient Screening process: Set the genetic similarity coefficient threshold to 0.85. First, remove individuals with a genetic similarity coefficient below 0.85. Then, classify the remaining individuals using unweighted group average cluster analysis or principal coordinate analysis. Select individuals that cluster within the same major branch as the donor parent to establish a superior population with a highly consistent genetic background.

[0040] See attached document Figure 1 After selecting superior lines with highly consistent genetic backgrounds through step S300, step S400, namely the detailed identification of phenotypic traits and physiological indicators, is performed. This step aims to transplant the molecularly verified regenerated plants into the field environment and verify whether they have maintained the superior characteristics of the donor parents by collecting specific agronomic traits, physiological functions, and fruit quality data.

[0041] In practice, the superior strains established in step S300, the donor parents (mother plants), and shoot tip cultured seedlings (as a control for virus eradication) were simultaneously planted, using uniform water and fertilizer management and pest and disease control measures. The shoot tip cultured seedlings were introduced as a control to compare the differences in virus eradication rate and growth vigor between anther culture-regenerated plants and conventionally virus-free seedlings, thereby verifying the advantages of anther culture technology in seedling health. Based on the grading results determined in step S300, approximately 80 highly stable (and some moderately stable) superior strains were prioritized for refined, multi-replication testing.

[0042] Ninety days after transplanting, vegetative growth and physiological indicators of the plants were measured. Plant height was measured using a ruler with an accuracy of 1 mm, which is the natural vertical distance from the base of the stem to the tip of the highest leaf. The thickness of the shortened stem was measured using a vernier caliper with an accuracy of 0.01 mm. The effective leaf area of ​​the whole plant was scanned and calculated using a leaf area meter. At the same time, plant samples were collected, and the fresh weight of the aboveground and underground parts was measured. The samples were then blanched at 105℃ and dried at 80℃ to constant weight to measure the dry weight, thereby assessing the biomass accumulation capacity. Functional leaves from the middle of the plant were selected simultaneously, and the relative chlorophyll content (SPAD value) was measured using a portable chlorophyll meter. Photosynthetic parameters such as net photosynthetic rate, stomatal conductance, intercellular CO2 concentration, and transpiration rate were measured using a portable photosynthesis measurement system during periods of sufficient light.

[0043] For root characteristics, a root scanning system combined with image analysis software was used to analyze the washed roots, obtaining data on total root length, total root volume, and total root surface area. Root activity was determined using the triphenyltetrazolium chloride reduction method. This method works by using dehydrogenase to reduce phenyltetrazolium to red formazan. The amount of formazan produced is measured using a spectrophotometer, and root activity intensity (i.e., the amount of formazan produced per unit weight of root per unit time) is calculated by combining root fresh weight and reaction time, thereby quantifying the physiological metabolic level of the roots.

[0044] During the reproductive growth stage, the main focus is on asexual reproduction capacity and fruit yield. Starting in April each year, stolons are harvested for four consecutive periods, and the number of seedlings produced per plant is counted to calculate the propagation coefficient. During the fruit ripening period, the total fruit yield is recorded for four consecutive months, and the number of fruits per plant is measured. Mature fruits are randomly selected to measure individual fruit weight, longitudinal diameter, and transverse diameter.

[0045] The identification of the fruit's internal quality includes the determination of the following biochemical indicators: soluble solids content using a handheld refractometer; titratable acid content using sodium hydroxide titration; soluble sugar content using the anthrone colorimetric method; soluble protein content using the Coomassie brilliant blue method; and vitamin C (ascorbic acid) content using the 2,6-dichlorophenolindophenol titration method. Through this multi-dimensional and meticulous identification, detailed phenotypic data are obtained, providing data support for the final comprehensive evaluation and ensuring that the selected plants do not fall below the donor parent in actual production performance.

[0046] See attached document Figure 1 and attached Figure 4 After completing the aforementioned initial cytological screening, molecular marker rescreening, and detailed phenotypic identification, step S500 is executed, namely, comprehensive evaluation and establishment of superior lines. This step establishes a multi-dimensional genetic stability grading evaluation model based on the data obtained at each stage.

[0047] The comprehensive evaluation model uses the ploidy level, genetic similarity coefficient, and agronomic trait variability of regenerated plants as its three core evaluation dimensions. In this example, the comprehensive evaluation of 100 strawberry anther culture regenerated plants, based on the analysis of data from each dimension, clearly divides the regenerated plants into three levels: Grade I plants are highly stable, and a total of 80 plants (80%) were counted in this example. Plants of this grade simultaneously meet the following technical indicators: First, in terms of cytological testing, the chromosome number is stable at octoploid (2n=56), and the flow cytometry peak diagram shows that the DNA fluorescence intensity distribution is concentrated and presents a single peak shape; Second, at the molecular level, the genetic similarity coefficient with the donor parent (maternal parent) calculated based on simple repeat sequence markers is greater than 0.95 (i.e., the preset high genetic stability threshold). ); Third, at the phenotypic level, the plants grew uniformly, and their agronomic traits showed no significant difference from the donor parents. These plants were identified as superior lines that could be used directly.

[0048] Grade II plants are basically stable, and a total of 8 plants (8%) were counted in this example. These plants exhibit the following characteristics: First, in terms of cytological testing, the chromosome number is mainly octoploid (2n=56), but a small number of cells are allowed to have aneuploidy; Second, at the molecular level, the genetic similarity coefficient with the donor parent is between 0.85 and 0.95 (i.e., ); Third, at the phenotypic level, the plants showed largely consistent phenotypes, but slight variations in non-critical traits. Specifically, some plants exhibited slightly wrinkled leaves, and slight differences in plant height, crown width, or number of branches compared to their parents, but overall growth vigor was not significantly inhibited. Regarding fruit characteristics, the fruit shape was slightly irregular, and the uniformity of peel color was slightly poorer. In terms of internal quality, the soluble solids content was slightly reduced, or the titratable acid content was slightly increased. Grade II plants can be retained for further observation as potential secondary materials.

[0049] Grade III plants are classified as low-stability plants, totaling 12 plants (12%) in this example. These plants exhibit the following characteristics: First, in terms of cytological testing, the chromosome number is disordered, and flow cytometry shows abnormal DNA index. Second, at the molecular level, the genetic similarity coefficient with the donor parent is less than 0.85 (i.e., This indicates that significant genetic variation has occurred; Third, at the phenotypic level, the plants failed to maintain the superior traits of the parent plants, specifically manifested as stunted plant growth, dark green and curled leaves, and inconsistent fruit shape. Grade III plants were deemed to have no application value and were therefore eliminated.

[0050] Through the above steps, this preferred method constructs a four-in-one multi-level detection system encompassing cytology, molecular markers, phenotypic traits, and fertility performance. This system can systematically identify various genetic variations induced by tissue culture, including chromosome number variations, gene sequence alterations, and epigenetic modifications, thereby achieving a comprehensive assessment of the genetic stability of strawberry anther culture progeny populations. In particular, the tandem progressive screening strategy of ploidy primary screening, molecular secondary screening, and phenotypic refinement adopted in this embodiment reduces the sample size for molecular detection and field identification compared to traditional full-scale detection methods. In this embodiment, approximately 12% of plants with abnormal ploidy can be eliminated through flow cytometry primary screening, avoiding expensive SSR sequencing and long-term field planting for these useless samples, thus optimizing the allocation efficiency of breeding resources.

Claims

1. A method for selecting optimal strawberry anther culture regenerated plants based on multi-stage sieving, characterized in that, Includes the following steps: A first-generation regenerated plant population was constructed through in vitro induced culture. The ploidy of each individual plant in the first generation of regenerated plant population was detected by flow cytometry to obtain the ploidy detection results. Based on the ploidy detection results, plants with abnormal ploidy were removed and plants with stable ploidy were retained. Genomic DNA was extracted from the ploidy-stable plants, amplified using simple repetitive sequence markers, and the genetic similarity coefficient between each ploidy-stable plant and the donor parent was calculated. Based on the genetic similarity coefficient, plants with genetic variations were removed and a population of superior lines with consistent genetic backgrounds was retained. The superior strains were planted in the field environment, and agronomic, physiological and fruit quality indicators were measured. Based on the ploidy test results, the genetic similarity coefficient, the agronomic trait indicators, the physiological indicators, and the fruit quality indicators, a grading evaluation model is established to classify individual plants in the superior line population into different grades to identify superior lines.

2. The method for selecting optimal strawberry anther culture regenerated plants based on multi-stage sieving according to claim 1, characterized in that, The steps of detecting the ploidy of each individual plant in the first-generation regenerated plant population using flow cytometry, and removing plants with abnormal ploidy and retaining plants with stable ploidy based on the ploidy detection results include: Introduce a reference object with known ploidy as an internal reference standard; The flow cytometry was used to detect the DNA fluorescence intensity of leaf tissues of individual plants in the first generation of regenerated plant population and the internal reference standard, and the peak DNA fluorescence intensity of the leaf tissues and the peak DNA fluorescence intensity of the internal reference standard were obtained respectively. The ratio of the peak DNA fluorescence intensity of the leaf tissue to the peak DNA fluorescence intensity of the internal reference standard is calculated to obtain the relative peak ratio as the ploidy detection result; The single plants whose relative peak ratio matches the first preset characteristic ratio or the second preset characteristic ratio as shown in the ploidy detection results are identified as ploidy-stable plants and retained. Plants whose relative peak ratio deviates from both the first and second preset characteristic ratios in the ploidy detection results are identified as ploidy-abnormal plants and removed.

3. The method for selecting optimal strawberry anther culture regenerated plants based on multi-stage sieving according to claim 1, characterized in that, The steps for eliminating genetically variant plants and retaining superior lines with consistent genetic backgrounds based on the genetic similarity coefficient include: Set a preset genetic similarity coefficient screening threshold; Individual plants with a genetic similarity coefficient lower than the preset genetic similarity coefficient screening threshold are excluded as genetically variant plants; Cluster analysis was used to classify the remaining individual plants, and individual plants that clustered with the donor parent in the same major branch were selected to form a superior line population with the same genetic background.

4. The method for selecting optimal strawberry anther culture regenerated plants based on multi-stage sieving according to claim 3, characterized in that, In the step of establishing a hierarchical evaluation model to classify individual plants in the superior line population into different levels and establishing superior lines, a preset high genetic stability threshold is set. The criteria for determining Level I highly stable plants in the hierarchical evaluation model include: The ploidy test results showed that the chromosome number was stable at octoploid and the DNA fluorescence intensity distribution was concentrated, showing a single peak. The genetic similarity coefficient is greater than the preset high genetic stability threshold; The agronomic traits and the donor parents showed no significant differences. Plants that simultaneously possess the aforementioned chromosome number, genetic similarity coefficient, and agronomic trait indicators are designated as Level I criteria. Plants that meet the Level I criteria are established as superior lines that can be directly utilized.

5. The method for selecting optimal strawberry anther culture regenerated plants based on multi-stage sieving according to claim 4, characterized in that, The criteria for determining Level II basically stable plants in the grading evaluation model include: The ploidy test results showed that the chromosome number was predominantly octoploid. The genetic similarity coefficient is between the preset genetic similarity coefficient screening threshold and the preset high genetic stability threshold; The phenotype showed slight variation in non-critical traits; Plants that simultaneously possess the stated chromosome number, the stated genetic similarity coefficient, and the stated phenotype are considered to meet Level II criteria. Plants that meet the Level II criteria are retained as secondary materials for observation.

6. The method for selecting optimal strawberry anther culture regenerated plants based on multi-stage sieving according to claim 3, characterized in that, The criteria for determining Grade III low-stability plants in the grading evaluation model include: The ploidy test results showed a disordered number of chromosomes; The genetic similarity coefficient is less than the preset genetic similarity coefficient screening threshold; Phenotypic manifestations include stunted plant growth, curled leaves, and deformed fruits; The criteria for determining whether a plant possesses at least one of the following: the number of chromosomes, the genetic similarity coefficient, or the phenotype, are set as Level III criteria. Plants that meet the Level III criteria are then eliminated.

7. The method for selecting optimal strawberry anther culture regenerated plants based on multi-stage sieving according to claim 1, characterized in that, In the step of calculating the genetic similarity coefficient between each of the ploidy-stable plants and the donor parent, the calculation logic for the genetic similarity coefficient includes: The numerator is obtained by multiplying the number of bands shared by the ploidy-stable plant and the donor parent by two. The denominator is obtained by multiplying the number of bands shared by the ploidy-stable plant and the donor parent by two and adding the number of bands unique to the ploidy-stable plant and the donor parent. The genetic similarity coefficient is obtained by calculating the ratio of the numerator to the denominator.

8. The method for selecting optimal strawberry anther culture regenerated plants based on multi-stage sieving according to claim 1, characterized in that, In the steps of determining agronomic traits, physiological indicators and fruit quality indicators, the agronomic traits include plant height, stem diameter, leaf area, biomass and root morphology. The physiological indicators include chlorophyll content, net photosynthetic rate, stomatal conductance, and root activity. The fruit quality indicators include single fruit weight, soluble solids content, titratable acid content, soluble sugar content, soluble protein content, and vitamin C content.

9. The method for selecting optimal strawberry anther culture regenerated plants based on multi-stage sieving according to claim 8, characterized in that, The process of determining root activity includes: Roots of the superior strains were obtained after being planted in the field. The phenyltetrazole in the samples was reduced to formazan using dehydrogenase. The amount of formazan produced was measured. The amount of formazan produced per unit weight per unit time was calculated as root activity based on the fresh weight of the roots and the reaction time.

10. The method for selecting optimal strawberry anther culture regenerated plants based on multi-stage sieving according to claim 1, characterized in that, In the step of constructing a first-generation regenerated plant population through in vitro induced culture, the in vitro induced culture includes: Flower buds that have developed to the edge of the uninucleate stage were selected as explants; The anthers from the flower buds were inoculated into a callus induction medium and cultured in the dark to induce callus formation. The callus tissue was transferred to a differentiation medium and induced to differentiate into adventitious shoots under light conditions. The adventitious buds were transferred into a rooting medium to construct the first generation of regenerated plant population.

Images