Construction method and application of multiple myeloma extramedullary lesion mouse model

Abstract

The invention belongs to the technical field of bioengineering, and relates to a construction method and application of a multiple myeloma extramedullary lesion mouse model. The method comprises the following steps: performing intravenous injection on a Vk12653 tumor cell suspension at the tail of a C57BL / 6J mouse to construct a Vk * MYC myeloma mouse; feeding Vk * MYC myeloma mice to obtain spleen cells infiltrated by tumors; a fibrinogen alpha chain is knocked out from the whole body of a C57BL / 6J mouse, and splenocytes are transplanted; and continuously culturing to obtain the multiple myeloma extramedullary lesion mouse model. The transplanted animal model provided by the invention can be used for effectively screening multiple myeloma extramedullary metastasis drugs and testing multiple drugs and drug combination, meanwhile, the in-vivo mechanism of multiple myeloma extramedullary metastasis can be more comprehensively and deeply researched by using the model, and a basic support is provided for developing new specific drugs.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology and relates to a method for constructing and applying a mouse model of extramedullary lesions of multiple myeloma. Background Technology

[0002] Multiple myeloma (MM) is a hematologic malignancy characterized by the malignant proliferation of clonal plasma cells in the bone marrow. Although the use of novel drugs such as proteasome inhibitors, immunomodulators, and monoclonal antibodies has significantly improved patient survival, most patients eventually relapse and progress to an incurable advanced stage of the disease. Extramedullary lesions (EMD) are a highly aggressive form of MM, referring to myeloma cells breaching the bone marrow barrier and infiltrating extramedullary tissues such as the spleen, liver, lymph nodes, and central nervous system, or forming soft tissue plasmacytomas. The occurrence of EMD is closely associated with extremely poor prognosis, and traditional treatment regimens have limited efficacy. Therefore, a deeper understanding of the pathogenesis of EMD and the development of effective treatment strategies are urgently needed.

[0003] Preclinical studies rely heavily on animal models that can accurately simulate the pathological features of human diseases. Currently, commonly used MM mouse models mainly include the following categories: (1) Immunodeficient mouse transplantation models: such as transplanting human MM cell lines or tumor cells from patients into immunodeficient mice such as NOD / SCID and NSG. These models are the mainstream tools for studying the growth of human MM cells in vivo, but their main limitation is that tumors are usually confined to the bone marrow cavity and are difficult to spontaneously form extensive extramedullary metastases. They also lack a complete host immune system and cannot be used to study immune-mediated anti-tumor responses or immunotherapy. (2) Transgenic mouse models: such as Vk*MYC transgenic mice. This strain of mice can spontaneously produce monoclonal gammaglobulinosis of unknown significance and progress to MM. Some mice may develop extramedullary lesions in the later stages. However, its onset is random, the latency period is long, and the degree of lesions varies, which is not conducive to large-scale, synchronized drug screening experiments. (3) Orthotopic transplantation model: Cells derived from murine MM cell lines such as 5TGM1 and Vk*MYC are transplanted into immunocompetent host mice (C57BL / KaLwRij and C57BL / 6J, respectively). This type of model preserves the immune system and can be used to study the interaction between tumors and the microenvironment, but its extramedullary metastasis ability is usually limited, and the metastasis sites and incidence are unstable.

[0004] Existing MM mouse models have significant shortcomings in simulating EMD: they either fail to spontaneously develop stable and widespread extramedullary metastases, lack immune system support, or have excessively long modeling cycles and numerous uncontrollable factors. Therefore, developing a mouse model that can rapidly, stably, and reproducibly induce multi-organ extramedullary metastases in immunocompetent hosts is of great significance for elucidating the pathological mechanisms of EMD and accelerating the development of anti-metastatic drugs. Summary of the Invention

[0005] This invention addresses the technical problems of traditional MM mouse models in simulating EMD by proposing a method for constructing and applying a mouse model of extramedullary lesions in multiple myeloma.

[0006] To achieve the above objectives, the present invention is implemented using the following technical solution: A method for constructing a mouse model of extramedullary lesions of multiple myeloma, the steps of which are as follows: (1) Vk*MYC myeloma mice were constructed by injecting Vk12653 tumor cell suspension into the tail vein of C57BL / 6J mice; (2) After feeding Vk*MYC myeloma mice, the spleen was dissected and tumor-infiltrating spleen cells were obtained by grinding. (3) The fibrinogen α chain was knocked out in C57BL / 6J mice and gene editing was performed to obtain Fga-KO mice. The spleen cells were transplanted into Fga-KO mice. The fibrinogen α chain sequence is shown in SEQ ID NO: 1. The knockout target sequence is shown in either SEQ ID NO: 2 or SEQ ID NO: 3. (4) Continue culturing until the mice develop a multi-organ tumor metastasis phenotype, thus obtaining a mouse model of extramedullary multiple myeloma.

[0007] Preferably, the concentration of the Vk12653 tumor cell suspension in step (1) is 1-2 × 10⁻⁶. 7 / mL, injection volume is 95-105μL. Specific steps include: rapidly thawing Vk*MYC (Vk12653) cells frozen in liquid nitrogen in a water bath, washing with 1×PBS, centrifuging at room temperature, adding 1×PBS for cell counting, preparing a cell suspension with 1×PBS, injecting into 6-week-old C57BL / 6J mice of the same sex using a sterile syringe, and then feeding and observing them.

[0008] Preferably, in step (2), the Vk*MYC myeloma mice are fed for 3-5 weeks, and the splenomegaly is observed and the expression level of M protein and B220 in peripheral blood is detected. - / CD138 + Cell ratio is used to confirm the feeding situation.

[0009] Preferably, the spleen cell transplantation in step (3) is performed via unilateral intraosseous injection, with a spleen cell concentration of 1-2 × 10⁻⁶. 8 / mL, injection volume is 9-11μL. Specific steps are as follows: Dissect the spleen of the constructed Vk*MYC mice, grind the cells to obtain a spleen single-cell suspension, lyse the red blood cells, wash with 1×PBS, filter using a 70-mesh sterile filter, centrifuge at room temperature, and prepare a cell suspension with 1×PBS for immediate construction of a multiple myeloma extramedullary lesion model. Alternatively, cryopreservation solution can be used to preserve the cells in liquid nitrogen. Prepare 6-week-old same-sex Fga-KO mice and inject them using a BD 300μL sterile insulin injector, using a unilateral intraosseous injection method. Continue feeding and observation after injection.

[0010] Preferably, the multi-organ tumor metastasis phenotype observed in mice in step (4) includes: splenomegaly, expression of M protein in bone marrow and peripheral blood serum, multiple tumor-infiltrating nodules in the liver and spleen, and tumor metastases in the brain; B220 in peripheral blood, spleen, liver, and bone marrow cells. - / CD138 + The proportion of cells increased.

[0011] This invention proposes the application of mouse models prepared by the above method in screening drugs for extramedullary lesions.

[0012] Compared with the prior art, the advantages and positive effects of the present invention are as follows: This invention proposes a transplant animal model that spontaneously forms stable and widespread extramedullary metastases and has a robust immune system. This model can be used to effectively screen drugs for extramedullary metastases of multiple myeloma, test multiple drugs and combination therapies, and provide a more comprehensive and in-depth study of the in vivo mechanisms of extramedullary metastases of multiple myeloma, thus providing fundamental support for the development of new specific drugs. Attached Figure Description

[0013] Figure 1 The results are PCR results for genotyping of Fga-KO mice. NC represents the negative control, PC represents the positive control, and numbers 1-10 represent different individual mice.

[0014] Figure 2These are visual and magnetic resonance imaging (MRI) images of liver metastasis in an EMD mouse model. Images AD are visual images of the liver, with image A representing the C57BL / 6J mouse control group, image B representing the Fga-KO mouse control group, image C representing the C57BL / 6J mouse Vk*MYC group, and image D representing the Fga-KO mouse Vk*MYC group. Images EH are MRI images of the liver, with image E representing the C57BL / 6J mouse control group, image F representing the Fga-KO mouse control group, image G representing the C57BL / 6J mouse Vk*MYC group, and image H representing the Fga-KO mouse Vk*MYC group.

[0015] Figure 3 This is a visual representation of spleen metastasis in an EMD mouse model. Image A shows the control group of C57BL / 6J mice, Image B shows the control group of Fga-KO mice, Image C shows the Vk*MYC group of C57BL / 6J mice, and Image D shows the Vk*MYC group of Fga-KO mice.

[0016] Figure 4 These are magnetic resonance imaging (MRI) images of brain tissue from an EMD mouse model. Image A shows the control group of C57BL / 6J mice, Image B shows the control group of Fga-KO mice, Image C shows the Vk*MYC group of C57BL / 6J mice, and Image D shows the Vk*MYC group of Fga-KO mice. Detailed Implementation

[0017] To better understand the above-mentioned objectives, features, and advantages of the present invention, the present invention will be further described below with reference to specific embodiments. It should be noted that, unless otherwise specified, the embodiments and features described in these embodiments can be combined with each other.

[0018] Numerous specific details are set forth in the following description in order to provide a full understanding of the invention. However, the invention may also be practiced in other ways than those described herein, and therefore the invention is not limited to the specific embodiments disclosed in the following specification.

[0019] In the following embodiments, some of the reagents and materials are from the following sources: C57BL / 6J mice were purchased from Spifort (Beijing) Biotechnology Co., Ltd.

[0020] Fga-KO mice were purchased from Cyagen Suzhou Biotechnology Co., Ltd. (Agreement No.: KOAIP230421YY2).

[0021] The rat tail identification kit was purchased from Nanjing Novizan, product number PD101-01.

[0022] The sterile 0.3 mL insulin syringe used for intraosseous injection was purchased from BD, catalog number 328822.

[0023] The 2,2,2-tribromoethanol used in the preparation of the anesthetic was purchased from Sigma-Aldrich, catalog number T48402-5GM; 2-methyl-2-butanol was purchased from Sigma-Aldrich, catalog number 240486-5ML.

[0024] The capillary blood collection tubes were purchased from HIRSCHMANN.

[0025] The 1.5mL sterile centrifuge tubes were purchased from NEST.

[0026] The 75% alcohol disinfectant was purchased from Shandong Lierkang.

[0027] M protein was tested by Jinan Dian Medical Testing Center.

[0028] The Vk12653 tumor cells were generously provided by Professor Leif Bergsagel of the Mayo Clinic.

[0029] Pregnant mare serum hormone was purchased from Beijing Solarbio, product number P9970.

[0030] Human chorionic gonadotropin (hCG) was purchased from Beijing Bairddi, product number BN80004.

[0031] 1×PBS was purchased from Fisher Bioreagent, catalog number FB04109050.

[0032] The agarose was purchased from SCIENTIFICCHEMICAL, item number 9012-36-6.

[0033] The 100bp Ladder was purchased from Genstar, item number M016.

[0034] RNase-free water was purchased from Shanghai Beyotime, product number ST876.

[0035] The Cas9 protein was purchased from NEB, catalog number M0646M.

[0036] The tracRNA was purchased from IDT and has the sequence: 5'-AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3', as shown in SEQ ID NO: 4.

[0037] The crRNAs were synthesized by GenScript and include crRNA-A1 and crRNA-A2, with the following sequences: crRNA-A1: AAAGGAGCAUGGGUGCAACAGGGGUUUUAGAGCUAUGCUGUUUUG, as shown in SEQ ID NO: 5; crRNA-A2: CAGGCACACUGUGGUCGAUCUGGGUUUUAGAGCUAUGCUGUUUUG, as shown in SEQ ID NO: 6. Example 1

[0038] 1. Construction of Fga-KO mice Select 3-4 week old C57BL / 6 female mice and inject them with 7.5 IU of pregnant mare serum gonadotropin (PMSG) and 7.5 IU of human chorionic gonadotropin (hCG) at an interval of 48 hours. After hCG injection, the female mice were mated with fertile male mice to achieve fertilization. The next day, the female mice were euthanized and fertilized eggs were collected from their oviducts and then stored in an incubator at 37°C and 5% CO2.

[0039] Turn on the electroporator, connect the electrodes, and set the parameters: voltage 200V, current 5mA, pulse duration 40ms, pulse count 3. Then, place the fertilized eggs in 30mL of 0.1M hydrochloric acid solution for zona pellucida weakening for 15 seconds; simultaneously, add the prepared ribonucleoprotein injection complex to the electrode dish. The preparation process of the ribonucleoprotein injection complex is as follows: First, add 0.4μL of 50 pmol / μL SgRNA1 and 0.4μL of 50 pmol / μL SgRNA2 to 5μL of RNase-free water (Beyotime, catalog number: ST876), then add 0.2μL of 30ng / μL Cas9 protein (NEB, catalog number: M0646M), mix well, and incubate (metal bath, 25℃) for 10min to obtain the mixture in tube 1; finally, add 14μL of RNase-free water to the mixture in tube 1 and mix to obtain the ribonucleoprotein injection complex. Subsequently, the treated fertilized eggs were washed three times with sterile 1×PBS and transferred to an electrode dish for electroporation (voltage 200V, current 5mA, pulse duration 40ms, pulse count 3 times). After completion, the fertilized eggs were transferred to M16 medium and cultured at 37℃ and 5% CO2 for 1 hour.

[0040] The SgRNA1 sequence is as follows: AAAGGAGCAUGGGUGCAACAGGGGUUUUAGAGCUAUGCUGUUUUG AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGGCU, as shown in SEQ ID NO: 7.

[0041] The SgRNA2 sequence is as follows: CAGGCACACUGUGGUCGAUCUGGGUUUUAGAGCUAUGCUGUUUUG AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGGCU, as shown in SEQ ID NO: 8.

[0042] Select age-appropriate fertile female mice and mate them with male mice whose vas deferens has been ligated to stimulate pregnancy changes and create pseudopregnant female mice. Fertilized eggs injected with the Fga gene are transferred into the oviduct of the pseudopregnant female mouse. After the transfer, the surrogate mother mouse is placed back in a clean cage and kept warm (30℃) until she regains consciousness. After successful transfer, the mice are raised until the mother gives birth and are designated as F0 mice.

[0043] Tail tissue was collected from F0 mice at 2 weeks of age, and the genome was extracted for PCR amplification and electrophoresis to screen offspring that integrated the foreign gene (first-generation mice). For the propagation and establishment of transgenic mice, mice carrying the foreign gene were mated with non-transgenic mice. The offspring of F0 mice have a 50% probability of carrying the integrated gene. To obtain homozygotes, sibling mating was performed, and the resulting F2 generation mice were selected. Transgenerational data and pedigrees were recorded to ensure stable gene expression and genetic transmission.

[0044] 2. Genotyping of Fga-KO systemic knockout Fga mice The Fga-KO mouse gene was knocked out using PCR technology. The PCR reaction system (20 μL) and amplification conditions are shown in Tables 1 and 2, respectively. Table 1 PCR reaction system (20 μL)

[0045] Genome DNA was extracted from the tail of mice for testing. The PCR band of successfully knocked-out mice should be 294 bp, while the band of wild-type mice should be 254 bp.

[0046] Table 2 PCR amplification reaction conditions

[0047] The PCR primer sequences are as follows: Fga-KO upstream primer 1: GTTATAGCTGAGAACTTTTAGCTC, as shown in SEQ ID NO: 9. Fga-KO downstream primer 1: GAATACAGAATAAGGCAAACAAG, as shown in SEQ ID NO: 10; Fga-KO upstream primer 2: GTTATAGCTGAGAACTTTTAGCTC, as shown in SEQ ID NO: 11. Fga-KO downstream primer 2: CTGTTGCACCCATGCTCCTTTCTC, as shown in SEQ ID NO: 12.

[0048] First, prepare the necessary tools, including mouse toe clippers, disinfectant, labels, and a record sheet. Select the mice to be identified and clean their feet with 75% alcohol disinfectant to ensure sterility during sampling. Then, gently hold the mouse's foot and carefully cut off the tip of the corresponding numbered toe using the toe clippers. Place the cut toe samples into test tubes and label them with the corresponding numbers to ensure clear identification and avoid confusion. Next, extract DNA from the cut toes using a commercial DNA extraction kit (Nanjing Novizan Pharmaceutical Co., Ltd., catalog number PD101-01), following the instructions to obtain high-quality DNA samples. Subsequently, use PCR technology with the primers (Fga-KO upstream primer 1, Fga-KO downstream primer 1, Fga-KO upstream primer 2, Fga-KO downstream primer 2) and PCR reaction system (as shown in Table 1) to amplify the extracted DNA under the reaction conditions shown in Table 2. After amplification, the PCR products were subjected to agarose gel electrophoresis. The first lane was loaded with a 100bp ladder, followed by the negative control (NC), positive control (PC), and the mice to be tested, numbered 1-10. The genotype of the mice was determined based on the position of the bands in the electrophoresis pattern and recorded. Figure 1 As shown, mouse number 3 is homozygous, while mice numbered 2, 5, 7, and 9 are heterozygous.

[0049] 3. Construction of the EMD mouse model Vk*MYC (Vk12653) cells cryopreserved in liquid nitrogen were rapidly thawed in a 37°C water bath. Several vials of cryopreserved cells were revived as needed. After revival, 10 mL of 1×PBS was added, and the cells were centrifuged at 1000 rpm for 5 min at room temperature. Another 10 mL of 1×PBS was added for cell counting, and the cells were prepared to a density of 1×10⁻⁶ cells using 1×PBS. 7 Cell suspension of 100 μL was prepared in 6-week-old C57BL / 6J mice of the same sex and injected into each mouse via the tail vein using a 1 mL sterile syringe. After injection, the mice were fed growth maintenance diet (Beijing Spaford Company) for 4 weeks.

[0050] At week 4, peripheral blood serum was obtained from the orbital cavity of mice to detect the expression of M protein in the serum. The specific steps were as follows: First, mice (300 μL / mouse) were anesthetized with a prepared 1.2% avertin solution. Sterile capillary blood collection tubes and 1.5 mL sterile centrifuge tubes were prepared. Clean tubes without anticoagulants were used for serum separation. The anesthetized mice were placed in a lateral recumbent position, with their heads held still by one hand. The capillary blood collection tube was gently inserted into the orbital venous plexus from the inner corner of the eye towards the fundus. Blood would flow into the collection tube due to capillary action. When approximately 200 μL of blood had been collected, the collection tube was removed, and the eye was gently pressed with sterile gauze to stop the bleeding. The collected blood was carefully transferred to a sterile centrifuge tube and allowed to stand at room temperature for 20 minutes to allow the blood to clot naturally (do not immediately refrigerate, as low temperatures will delay clot contraction and affect serum separation). After the clot had fully contracted, the mice were centrifuged at 2500 rpm for 15 minutes. After centrifugation, a pale yellow, transparent serum layer is clearly visible on top, a thin white membrane (containing leukocytes and platelets) in the middle layer, and a dark red blood clot at the bottom. Carefully aspirate the serum layer using a micropipette and transfer it to a new sterile centrifuge tube (avoiding the middle white membrane layer or the blood cells at the bottom layer to prevent hemolysis or contamination). The obtained serum is immediately sent for M protein testing. The spleen is isolated, its size observed, and photographed for preservation. The spleen is dissected, and a single-cell suspension is obtained by grinding the cells. Part of this suspension is used for flow cytometry analysis of myeloma cells, and the other part is used for live cell cryopreservation to construct mouse models.

[0051] After obtaining single-cell suspensions from the spleen of Vk*MYC mice, cells were prepared to a density of 1×10⁶ cells using 1×PBS. 8 Cell suspensions of 10 μL / mL were prepared in 6-week-old, sex-matched Fga-KO mice (for EMD model construction, as the experimental group) and sex-matched C57BL / 6J mice (for Vk*MYC model construction, as the control group). Injections were administered using a 300 μL sterile insulin syringe via unilateral intraosseous injection, with each mouse receiving 10 μL. The model construction lasted for 4 weeks. Mice were anesthetized with a 1.2% avertin solution (300 μL / mouse), and magnetic resonance imaging (MRI) of the liver and brain was performed. The images are shown below. Figure 2 As shown in Figures 4 (EH) and 4 (AD), the results indicate that the EMD mouse model (Fga-KO Vk*MYC) exhibits significant liver and brain tumor metastases. Subsequent mouse dissections were performed to observe the morphology and tumor metastases in the liver and spleen, as shown in Figures 4 (AD). Figure 2 As shown in AD 3 and AD 4, the results indicate that the EMD mouse model showed significant liver and spleen metastases.

[0052] The model proposed in this invention can simulate the multi-organ infiltration characteristics of clinical extramedullary metastasis, providing a good in vivo research model for the study of the mechanism of extramedullary lesions of myeloma, promoting the deepening of basic research, and laying a preclinical foundation for the development of effective treatment strategies for extramedullary lesions of myeloma.

[0053] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments for application in other fields. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.

Claims

1. A method for constructing a mouse model of extramedullary lesions in multiple myeloma, characterized in that, The steps are as follows: (1) Vk*MYC myeloma mice were constructed by injecting Vk12653 tumor cell suspension into the tail vein of C57BL / 6J mice; (2) After feeding Vk*MYC myeloma mice, the spleen was dissected and tumor-infiltrating spleen cells were obtained by grinding. (3) The fibrinogen α chain was knocked out in C57BL / 6J mice and gene editing was performed to obtain Fga-KO mice. The spleen cells were transplanted into the bone marrow cavity of Fga-KO mice. The fibrinogen α chain sequence is shown in SEQ ID NO:

1. The knockout target sequence is shown in either SEQ ID NO: 2 or SEQ ID NO:

3. (4) Continue culturing until the mice develop a multi-organ tumor metastasis phenotype, thus obtaining a mouse model of extramedullary multiple myeloma.

2. The method for constructing a mouse model of extramedullary lesions of multiple myeloma according to claim 1, characterized in that, In step (1), the concentration of the Vk12653 tumor cell suspension is 1-2 × 10⁻⁶. 7 / mL, injection volume is 95-105μL.

3. The method for constructing a mouse model of extramedullary lesions of multiple myeloma according to claim 1, characterized in that, In step (2), the Vk*MYC myeloma mice were fed for 3-5 weeks. The splenomegaly was observed, and the expression levels of M protein and B220 in peripheral blood were detected. - / CD138 + Cell ratio is used to confirm the feeding situation.

4. The method for constructing a mouse model of extramedullary lesions of multiple myeloma according to claim 1, characterized in that, The spleen cell transplantation method in step (3) is unilateral intramedullary injection, with a spleen cell concentration of 1-2 × 10⁻⁶. 8 / mL, injection volume is 9-11μL.

5. The method for constructing a mouse model of extramedullary lesions of multiple myeloma according to claim 1, characterized in that, The multi-organ tumor metastasis phenotype observed in mice in step (4) includes: splenomegaly, expression of M protein in bone marrow and peripheral blood serum, tumor infiltration in the liver and spleen, and tumor metastases in the brain; B220 in peripheral blood, spleen, liver, and bone marrow cells. - / CD138 + The proportion of cells increased.

6. The application of the mouse model prepared by the method described in claims 1-5 in screening drugs for extramedullary lesions.

Images