Application of TRMT61A as target spot in preparation of medicine for preventing or treating benign prostatic hyperplasia

Abstract

The invention provides application of TRMT61A as a target spot in preparation of a medicine for preventing or treating benign prostatic hyperplasia. The TRMT61A is specifically targeted through shRNA, pathogenic signals are blocked from the post-transcriptional level, accurate intervention on benign prostatic hyperplasia is achieved, dependence on androgen pathways is completely avoided, unavoidable sexual dysfunction and other serious side effects of traditional drugs are fundamentally avoided, and the life quality of patients is remarkably improved.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of TRMT61A as a target in the preparation of drugs for the prevention or treatment of benign prostatic hyperplasia. Background Technology

[0002] Benign prostatic hyperplasia (BPH) is the leading cause of urinary dysfunction in middle-aged and elderly men. The core pathological change is the uncontrolled proliferation of epithelial and stromal cells in the transitional zone of the prostate, leading to a pathological enlargement of the gland, compression of the urethra, and bladder outlet obstruction (BOO). This further results in urinary frequency, urgency, urinary retention, and even kidney damage, severely impacting the patient's quality of life. Currently, clinical treatment for BPH mainly relies on alpha-receptor blockers (such as tamsulosin) and 5α-reductase inhibitors (such as finasteride). However, these therapies have significant limitations: alpha-receptor blockers only relieve symptoms and cannot reduce prostate volume or slow disease progression; while 5α-reductase inhibitors can shrink the gland, their mechanism of action depends on hormone blockade, resulting in a slow onset of action (requiring 3-6 months) and serious side effects such as decreased libido, erectile dysfunction, ejaculatory abnormalities, and drug tolerance. They are ineffective against hormone-independent hyperplasia.

[0003] Therefore, there is an urgent need for a novel therapeutic target that does not rely on the androgen pathway, can rapidly induce apoptosis of prostatic hyperplasia cells, and at the same time reduce side effects.

[0004] Hormone-free epitranscriptome interventions, by regulating the translation efficiency of pathogenic genes at their source, offer advantages over traditional hormone therapy, including no impact on systemic endocrine levels and strong targeting, thus becoming a promising new direction for BPH treatment. Among these, N1-methyladenosine (m...) of tRNA... 1 A) Modification has been shown to be a key switch regulating the rate of protein synthesis in critical signaling pathways, such as the TGF-β pathway. The TGF-β signaling pathway is a key factor driving prostatic epithelial proliferation and stromal fibrosis (EMT), but there is currently a lack of effective means to treat BPH by intervening in its translational regulatory mechanisms. Summary of the Invention

[0005] To address the shortcomings of existing hormone blockade therapies, such as side effects and drug resistance, this invention proposes the application of TRMT61A as a target in the preparation of drugs for the prevention or treatment of benign prostatic hyperplasia. This invention reveals for the first time that TRMT61A maintains the m... 1A modification specifically enhances the translation efficiency of key proteins in the TGF-β signaling pathway, thereby driving prostate cell hyperplasia and fibrosis. This invention intervenes in this pathway through TRMT61A-specific interfering RNA (shRNA), blocking tRNA m at its source. 1 A-modification inhibits abnormal activation of TGF-β signaling, effectively suppressing prostate cell proliferation and fibrosis while preserving the patient's sexual function, thus achieving the treatment of benign prostatic hyperplasia.

[0006] This invention provides the application of TRMT61A as a target in the preparation of drugs for the prevention or treatment of benign prostatic hyperplasia.

[0007] In some embodiments, the benign prostatic hyperplasia is early, intermediate, or advanced benign prostatic hyperplasia.

[0008] In some embodiments, the drug reduces the m-value of tRNA. 1 A methylation level inhibits the overall protein translation efficiency of cells to prevent or treat benign prostatic hyperplasia.

[0009] In some embodiments, the drug includes a TRMT61A inhibitor.

[0010] In some embodiments, the TRMT61A inhibitor is shRNA, siRNA, miRNA mimic, antisense oligonucleotide, CRISPR-Cas gene editing system, aptamer, or neutralizing antibody.

[0011] In some embodiments, the TRMT61A inhibitor is shRNA, and the nucleotide sequence of the shRNA is shown in SEQ ID No. 1 or 2.

[0012] In some embodiments, the TRMT61A inhibitor is delivered to prostate tissue via a viral vector or a non-viral delivery system.

[0013] In some embodiments, the viral vector is an adeno-associated virus, a lentivirus, or an adenovirus.

[0014] In some embodiments, the non-viral delivery system is a liposome, polymer nanoparticle, inorganic nanocarrier, or exosome.

[0015] In some embodiments, the drug may be administered via urethral perfusion of the prostate, ultrasound-guided injection, or as a sustained-release implant.

[0016] In summary, compared with the prior art, the present invention achieves the following technical effects: (1) This invention pioneers a "translation blocking" strategy, which uses shRNA to specifically target TRMT61A, blocking the pathogenic signal at the post-transcriptional level to achieve precise intervention in benign prostatic hyperplasia (BPH). This strategy does not rely on the androgen pathway at all, fundamentally avoiding the serious side effects such as sexual dysfunction that are unavoidable with traditional drugs, and significantly improving the quality of life of patients.

[0017] (2) This invention develops a novel AAV-shRNA gene drug targeting the epitranscriptome, which can simultaneously inhibit uncontrolled proliferation of prostate epithelial cells and stromal fibrosis, achieving dual intervention on "epithelial hyperplasia" and "stromal fibrosis". Specifically, it manifests as a significant reduction in glandular volume, downregulation of the stromal marker α-SMA, and improvement in histopathological structure. This breakthrough overcomes the bottleneck of limited efficacy of existing drugs in inhibiting prostate fibrosis, providing a new technical approach and application prospect for the effective treatment of BPH. Attached Figure Description

[0018] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 For example, in BPH tissue of the present invention, m 1 A. Detection results of modification level and TRMT61A expression; (A) Detection of total RNA m in normal prostate tissue (n=5) and BPH tissue (n=5) by LC-MS / MS. 1 A. Modification level; (BC) qRT-PCR and Western Blot analysis of TRMT61A mRNA and protein expression levels in normal and BPH tissues (n=3); (D) Immunohistochemical (IHC) staining results of TRMT61A in normal and BPH tissues; (E) Immunofluorescence (IF) staining results of TRMT61A in prostate tissue; (F) Immunofluorescence localization results of TRMT61A in prostate cell lines, TRMT61A is shown as green fluorescence, and the cell nuclei are counterstained with DAPI and appear blue.

[0020] Figure 2Example 2 of this invention describes the effects of TRMT61A knockdown on the proliferation and cell cycle of human prostate cells; (AB) qRT-PCR and Western Blot were used to detect the expression level of TRMT61A in WPMY-1 and BPH-1 cells after transfection with shRNA (sh61A-1 and sh61A-2); (CD) CCK-8 cell viability assay was used to analyze the effect of TRMT61A knockdown on the proliferation capacity of prostate cells within 4 days; (EG) EdU incorporation assay was used to detect the change in the proportion of EdU-positive cells in prostate cells after TRMT61A knockdown; (HJ) Flow cytometry was used to analyze the effect of TRMT61A knockdown on the cell cycle distribution of prostate cells.

[0021] Figure 3 Example 3 of the present invention: TRMT61A on tRNA m 1 The regulatory role of A in tRNA modification, tRNA stability, and overall translation efficiency; (A) LC-MS detection of tRNA m in TRMT61A knockdown group (sh61A) and control group cells. 1 A. Relative abundance; (BC) Heatmap and quantitative analysis show the specific tRNA isotype m after TRMT61A knockdown. 1 A. Changes in modification levels; (D) tRNA m 1 (A) Sequence motif analysis of the modified sites showed that the modified sites were enriched in the "RGGUY" conserved motif; (E) tRNA-seq analysis of the overall changes in tRNA expression abundance after TRMT61A knockdown; (F) tRNA-Leu-CAA isoreceptor m 1 A correlation analysis between modification level and expression abundance.

[0022] Figure 4 Example 4 of this invention describes the role of TRMT61-mediated tRNA m1A modification in mRNA translation and neonatal protein synthesis; (A) Polysome profiling analysis of the effect of TRMT61A knockdown on translation status; (BC) Puromycin incorporation experiment and quantitative analysis to detect the effect of TRMT61A knockdown on the rate of neonatal protein synthesis in WPMY-1 and BPH-1 cells.

[0023] Figure 5Example 5 of this invention includes pathway enrichment analysis and differential gene screening; (A) Combined transcriptome & translatome analysis: Transcription: Genes with significant differences only at the transcriptional level; Translation: Genes with significant differences only at the translational level; Homodirection: Genes with significant differences in both omics and in the same up- and down-regulation direction; Opposite: Genes with significant differences in both omics and in opposite up- and down-regulation directions; Unchanged: Genes with no significant differences in either omics; (B) Volcano plot of differentially expressed genes based on translation efficiency (TE); (C) Pathway enrichment map of TE-downregulated GO biological processes; (D) TE-downregulated KEGG pathway enrichment analysis.

[0024] Figure 6 Example 6 of this invention illustrates the negative regulation of TGFβR1 translation efficiency and TGF-β pathway activity by TRMT61A knockdown. (AB) Western blot analysis showed that in both TRMT61A knockdown cell lines, the levels of TGFβR1 and its downstream p-SMAD2 / 3 proteins were significantly reduced; simultaneously, specific downregulation of the myofibroblast marker α-SMA was observed in WPMY-1 cells. (CD) qRT-PCR analysis showed no significant change in the mRNA levels of these targets, confirming the existence of a post-transcriptional regulatory mechanism. (E) Western blot analysis results of E-cadherin, N-cadherin, Vimentin, and α-SMA. (F) Sucrose density gradient separation and qRT-PCR quantification showed that after TRMT61A knockdown, TGFβR1 mRNA significantly shifted from the heavier polyribosomal component to the lighter ribosomal subunit (40S / 60S) component.

[0025] Figure 7Example 7 of this invention describes the partial rescue effect of TGFβR1 overexpression on the prostate cell phenotype induced by TRMT61A deficiency; (AB) qRT-PCR and Western Blot were used to verify the overexpression efficiency of TGFβR1 in TRMT61A-deficient WPMY-1 and BPH-1 cells; (CF) Cell proliferation assays were used to analyze the effect of TGFβR1 overexpression on cell growth inhibition induced by TRMT61A knockdown; (GH) Annexin V-FITC / PI double staining flow cytometry was used to detect the effect of TGFβR1 overexpression on apoptosis and cell death induced by TRMT61A deficiency; (IL) Representative Western Blot results showed the expression and activation status of downstream effector molecules under the condition of TRMT61A knockdown combined with TGFβR1 overexpression; (MN) Western Blot was used to quantitatively analyze the regulatory effect of TRMT61A knockdown combined with TGFβR1 overexpression on the expression of various downstream effector molecules and EMT-related markers in BPH-1 cells.

[0026] Figure 8 Example 8 of this invention: Effect of TRMT61A knockdown on benign prostatic hyperplasia in a BPH rat model; (AB) Representative Western Blot results and quantitative analysis of TRMT61A protein levels in prostate tissues of rats in each experimental group; (C) Using m 1 A quantitative analysis of total RNA m-methylation in prostate tissues of rats from different groups was performed using an RNA methylation detection kit. 1 A. Level; (D) Representative images of the prostate and adjacent urogenital organs of rats in the negative control group, BPH model group, BPH+AAV9-NC group and BPH+AAV9-sh61A group, including: (1) prostate, (2) bladder, (3) seminal vesicle; (E) Representative HE staining images of prostate tissue of rats in each treatment group; (F) Immunohistochemical (IHC) staining results of Ki67 in prostate tissue of rats in each treatment group; (G) Immunohistochemical (IHC) staining results of TRMT61A in prostate tissue of rats in each treatment group; (H) Immunohistochemical (IHC) staining results of TGFβR1 in prostate tissue of rats in each treatment group. Detailed Implementation

[0027] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0028] Example 1: Immunohistochemical and immunofluorescence detection of TRMT61A in prostate tissue (1) Immunohistochemistry (IHC): Prostate tissue was fixed in 10% formalin, dehydrated in a gradient manner, and embedded in paraffin to prepare continuous sections 5 μm thick. After dewaxing, hydration, and antigen retrieval (citrate buffer, pH 6.0), the sections were incubated overnight at 4°C with primary antibody. The next day, the sections were warmed again and incubated with HRP-labeled secondary antibody, followed by DAB staining and hematoxylin counterstaining of the cell nuclei. Images were acquired under an optical microscope, and the average optical density (AOD) of positive areas was analyzed using ImageJ software to quantify protein expression levels.

[0029] (2) Immunofluorescence (IF): Cells were seeded in confocal culture dishes and fixed with 4% paraformaldehyde for 15 minutes after adhesion, followed by permeabilization with 0.2% Triton X-100 for 10 minutes. After washing with PBS, cells were blocked with 3% BSA at room temperature for 1 hour to block non-specific binding. Primary antibody was added and incubated overnight at 4°C, followed by incubation with Alexa Fluor 488-labeled fluorescent secondary antibody for 1 hour in the dark. After counterstaining the cell nuclei with DAPI, the subcellular localization and expression intensity of the target protein were observed and photographed using an Olympus fluorescence microscope. Results are as follows: Figure 1 As shown.

[0030] (3) tRNA m 1 A. Modification detection: Using tRNA m 1 The A-methylation assay kit (Abcam, MA, USA) was used for quantitative analysis of clinical samples. First, total RNA was extracted from prostate tissue of normal controls and BPH patients using TRIzol reagent, and its concentration and purity (A260 / A280 > 1.8) were measured using a NanoDrop spectrophotometer. Then, 200 ng of purified RNA sample and standards were added to the detection wells, and the RNA was immobilized on the bottom of the plate using a high-affinity antibody. Capture antibody and detection antibody were added sequentially for incubation, with negative and positive controls provided to ensure experimental reliability. Finally, after the chromogenic reaction, the absorbance (OD value) at 450 nm was measured using a microplate reader. The m-value of each sample was calculated based on the standard curve. 1 The relative content of A, the results are as follows: Figure 1 As shown in Figure A.

[0031] Figure 1 The results showed that, compared with normal prostate tissue, the total RNA m-value in BPH tissue was significantly lower. 1The level of TRMT61A modification was significantly increased. Further analysis using qRT-PCR and Western blotting revealed that both the mRNA and protein expression levels of TRMT61A were significantly upregulated in BPH tissues. Histological analysis showed that TRMT61A exhibited a stronger positive signal in BPH tissues during immunohistochemical staining. Immunofluorescence results further confirmed the high expression of TRMT61A in BPH tissues. Simultaneously, in prostate cell lines, TRMT61A was primarily localized in the nuclear region.

[0032] Example 2: Effects of TRMT61A knockdown on human prostate cell proliferation and cell cycle (1) Construction of a cell line with stable TRMT61A knockdown To establish a long-term stable TRMT61A knockdown cell model, lentiviral vectors carrying TRMT61A-specific short hairpin RNAs (sh61A-1 and sh61A-2) and control shRNA were purchased from Vigene Bioscience Co., Ltd. lentiviral solution (MOI=10) was mixed with the transduction aid Polybrene (8 μg / mL) and used to infect target cells. After 24 hours of infection, the medium was replaced with complete medium, and after 48 hours, Puromycin (2 μg / mL) was added for resistance selection. This selection was repeated for one week to obtain a stable TRMT61A knockdown cell line. Overexpression strain construction (TGFβR1): To verify the downstream mechanism, an overexpression lentivirus encoding full-length TGFβR1 (nucleotide sequence shown in SEQ ID No. 3) was purchased from Genechem Co., Ltd. Using the same lentiviral infection and drug screening strategy described above, TGFβR1 was overexpressed in TRMT61A knockdown cells to construct a "knockdown + complementation" dual intervention cell model for subsequent functional rescue experiments. Results are as follows: Figure 2 As shown in AB.

[0033] (2) Cell proliferation detection CCK-8 cell viability assay: Digest and resuspend cells at 3.0 × 10⁻⁶. 3 Cells were seeded at a density of 10 cells / well in 96-well plates, with 5 replicates per group. At 0, 24, 48, and 72 hours post-seeding, 10 μL of CCK-8 reagent (Abbkine, Wuhan, China) was added to each well. After incubation at 37°C in the dark for 2 hours, the absorbance (OD value) at 450 nm was measured using a microplate reader, and cell growth curves were plotted. EdU incorporation assay: Cells were seeded at a density of 1.0 × 10⁶ cells / well. 5Cells were seeded per well in 6-well plates. After cell attachment, EdU labeling reagent (final concentration 10 μM, purchased from RiboBio) was added to the culture medium and incubated at 37°C for 2 hours to label the newly synthesized DNA. Subsequently, the cells were washed with PBS, fixed with 4% paraformaldehyde, and permeabilized with 0.5% Triton X-100. Click chemistry was then performed by incubating with Apollo 488 fluorescent dye in the dark for 30 minutes. Finally, cells were collected and the proportion of EdU-positive (proliferating) cells was quantitatively analyzed by flow cytometry. The results are shown below. Figure 2 As shown in CG.

[0034] (3) Cell cycle detection: 1) Cell fixation: Collect cells from each group in the logarithmic growth phase, digest with trypsin, centrifuge, and wash once with pre-chilled PBS. Slowly add pre-chilled 75% ethanol, gently pipette to mix, and fix overnight (at least 12 hours) at 4°C. 2) Staining: Centrifuge to remove the ethanol fixative, and wash cells twice with pre-chilled PBS. Resuspend cells in 500 μL of PI staining working solution (containing RNase A) according to the instructions of the cell cycle assay kit (Yeasen, Shanghai, China). 3) Incubation and detection: Gently mix the cell suspension and incubate at 37°C in the dark for 30 minutes to ensure sufficient RNA degradation and DNA labeling. Immediately afterwards, use flow cytometry (Beckman Coulter) for detection. Based on the DNA content histogram of the FL2 channel, analyze the percentage distribution of cells in G0 / G1, S, and G2 / M phases. The results are shown below. Figure 2 As shown in HJ.

[0035] Figure 2 The results showed that transfection with sh61A-1 and sh61A-2 significantly reduced the mRNA and protein expression levels of TRMT61A in both cell lines, indicating reliable knockdown efficiency. Functional experiments showed that, compared with the control group, TRMT61A knockdown significantly inhibited the proliferation of prostate cells during 4 consecutive days of culture. EdU incorporation assays further showed that after TRMT61A knockdown, the proportion of EdU-positive cells in the DNA synthesis phase significantly decreased. Furthermore, flow cytometry analysis indicated that TRMT61A knockdown significantly altered the cell cycle distribution, with significant cell accumulation in the G1 phase and a significant reduction in the proportion of cells in the S phase.

[0036] Example 3 TRMT61A in tRNA m 1 A Modification and Regulation Effects (1) Detection of m by liquid chromatography-tandem mass spectrometry (LC-MS / MS) 1 A level of modification: 1) tRNA isolation and purification: Total RNA was extracted from cells and separated by 15% TBE-Urea PAGE denaturing gel electrophoresis. Bands at 60-90 nt (corresponding to tRNA size) were excised, homogenized, and soaked in elution buffer overnight for elution. RNA was recovered by ethanol precipitation and accurately quantified using a Qubit RNA HS kit. 2) Enzymatic digestion: 1 μg of purified tRNA was added to nuclease P1 and snake venom phosphodiesterase, and incubated at 37°C for 2 hours to hydrolyze tRNA into mononucleotides. Alkaline phosphatase was then added for 1 hour to remove phosphate groups. The product was centrifuged using a 10 kDa ultrafiltration tube, and the filtrate was collected to remove proteins and enzymes. 3) Mass spectrometry detection: Samples were injected into an Agilent 1260 HPLC system for chromatographic separation, followed by analysis on an Agilent 6460 triple quadrupole mass spectrometer. Multiple reaction monitoring (MRM) mode was used to detect m... 1 Specific detection of A (parent ion / daughter ion pair) and A (adenosine) was performed. This was achieved by calculating m... 1 The ratio of the peak areas of A to A's gives m. 1 The relative content of A modification. Results are as follows: Figure 3 As shown in Figure A.

[0037] (2) tRNA sequencing (tRNA-seq): 1) Small RNA enrichment: Small RNA fractions smaller than 200 nt were enriched from total RNA using the MirVana miRNA isolation kit (Thermo Fisher). 2) Demethylation pretreatment: To overcome m... 1 To remove reverse transcription arrest caused by A-type modifications, enriched small RNAs were mixed with AlkB demethylase and reacted at 37°C for 100 minutes to remove methylation modifications that interfere with reverse transcription. 3) Library construction and sequencing: Following the GenSeq® small RNA library construction kit instructions, adapter ligation, reverse transcription, and PCR amplification were performed on the demodified RNA. PCR products were subjected to PAGE gel electrophoresis, and 140-160 bp bands (corresponding to adapter-bound tRNAs) were excised for purification. After the library passed quality control, sequencing was performed on the Illumina NovaSeq 6000 platform. Bioinformatics analysis was used to calculate the read count and fold change for each tRNA isotype. Results are as follows: Figure 3 As shown in B.

[0038] (3) m 1 A-MAP-seq(m 1 (A-methylation mapping sequencing) 1) Small RNA enrichment and fragmentation: Total RNA was extracted from cells or tissues, and long RNA chains were removed using the MirVana miRNA isolation kit (Thermo Fisher), enriching small RNA fractions (including tRNA) with a length of less than 200 nt. 2) m 1 A. Immunoprecipitation (MeRIP): Utilizing GenSeq m 1 Enrichment was performed using the A-MeRIP kit. Small RNAs were then combined with specific anti-m antibodies. 1 Antibody A was incubated in IP buffer at 4°C for 2 hours, followed by incubation for another hour with pre-washed Protein A / G magnetic beads to capture the antibody-RNA complex. The magnetic beads were rigorously washed with high-salt and low-salt buffers before being incubated with a high concentration of [unclear - likely a specific type of buffer]. 1 A similar product (m) 1 Competitive elution was performed using the eluent from the analogue to collect the product rich in m. 1 A-modified RNA fragments. 3) Demethylation and grouping: The eluted RNA was purified and recovered by Trizol and divided into two groups: Demethylation group [Demethylase(+)]: AlkB demethylase was added and reacted at 37℃ for 100 minutes to remove m-modified RNA fragments. 1 A modification (as a background control to eliminate reverse transcription mismatches). Untreated group [Demethylase(-)]: only reaction buffer was added, retaining m 1 A modifies (m) 1 A causes reverse transcriptase to introduce mismatched bases at the modification site. 4) Library construction and sequencing: Sequencing libraries were constructed for the two groups of RNA using the NEBNext SmallRNA Library Prep Set (NEB). The steps included ligation of 3' and 5' adapters, reverse transcription to synthesize cDNA, PCR amplification, and PAGE gel purification. After the libraries passed quality control, 150 bp paired-end (PE150) sequencing was performed on the Illumina NovaSeq 6000 platform. By comparing the difference in mismatch rates between the two groups of data, m on the tRNA was identified. 1 A. The true locus. (Results as follows) Figure 3 (as shown in CF).

[0039] Example 4: TRMT61-mediated tRNA m 1 The role of A modification in mRNA translation and new protein synthesis (1) Polysome profiling: 1) Sample Preparation: Add cycloheximide (CHX, final concentration 100 μg / mL) to the cell culture medium in the logarithmic growth phase and incubate at 37°C for 15 minutes to freeze the position of ribosomes on mRNA. Discard the culture medium and wash twice with pre-chilled PBS containing CHX. Add 2 mL of pre-chilled lysis buffer (containing 20 mM HEPES-KOH pH 7.4, 15 mM MgCl2, 200 mM KCl, 1% Triton X-100, 2 mM DTT, 100 μg / mL CHX) and lyse on ice for 30 minutes. 2) Gradient Centrifugation: Centrifuge the lysate at 12,000 g for 15 minutes at 4°C to remove cell nuclei and debris. Carefully spread the supernatant onto the surface of a prepared 10%–50% sucrose density gradient solution. Centrifuge at 36,000 rpm at 4°C for 3 hours. 3) Component Collection and Analysis: After centrifugation, an automated component collector was used in conjunction with a liquid chromatograph to continuously monitor the absorbance at 254 nm (A254), and a polyribosome distribution curve was plotted. Free RNA, 40S / 60S subunits, 80S monoribosomes, and polysomes were distinguished based on their peak positions. Results are as follows: Figure 4 As shown in Figure A.

[0040] (2) Detection of the rate of nascent protein synthesis: 1) Drug labeling: After the cells in each group were treated to the predetermined time point, puromycin (final concentration 1 μM) was added to the culture medium. The cells were incubated at 37℃ and 5% CO2 for 30 minutes to allow puromycin to be incorporated into the ends of newly synthesized polypeptide chains. 2) Protein extraction and electrophoresis: The drug-containing culture medium was discarded, the cells were washed twice with PBS, and RIPA lysis buffer was added to extract total cell protein. Equal amounts of protein samples were separated by SDS-PAGE gel electrophoresis and transferred to a PVDF membrane. 3) Immunoblot detection: After blocking with 5% skim milk powder, anti-puromycin monoclonal antibody (#MABE343; Millipore, dilution ratio 1:25,000) was incubated overnight. The next day, secondary antibody was incubated and the color was developed. The overall gray value of the band directly reflects the total amount of nascent protein synthesized by the cells during that time period, as shown in the results. Figure 4 As shown in B.

[0041] (3) Ribo-seq: 1) Cell treatment and lysis: Cells were treated with medium containing 100 μg / mL CHX for 15 minutes to fix ribosomes. After washing with ice-cold PBS, cells were lysed, and RNase I (10 U / μL) was added to the supernatant. The cells were digested at 25°C for 1 hour to degrade unprotected RNA fragments. 2) Ribosomal footprint (RPF) recovery: The digestion products were subjected to sucrose density gradient ultracentrifugation to collect the 80S single ribosome fraction. The ribosome-protected fragments (RPFs, approximately 28-32 nt) were extracted using Trizol. 3) Library construction and sequencing: RPFs were subjected to end repair, 3' adapter ligation, and 5' phosphorylation. The rRNA contamination was removed using the Ribo-Zero kit, and the effective fragments were purified by PAGE gel extraction. Subsequently, reverse transcription, circularization, and PCR amplification were performed to construct a cDNA library. Library quality was assessed using Qubit 2.0 and an Agilent 2100 PCR instrument, and qPCR was performed for accurate quantification. Finally, single-end 50 bp sequencing was performed on an Illumina HiSeq 2500 platform.

[0042] The results are as follows Figure 3 As shown in the figure. LC-MS results showed that, compared with the control group, the m of tRNA in the TRMT61A knockdown group cells was significantly lower. 1 The relative abundance of A was significantly reduced. Further tRNA modification profiling analysis showed that TRMT61A knockdown mainly led to the reduction of m-types of specific tRNAs. 1 The level of modification A is significantly reduced. (Regarding m) 1 Sequence analysis of the A modification site revealed that this modification site exhibited enrichment of a conserved motif characterized by "RGGUY" in the tRNA sequence. Simultaneously, tRNA-seq results showed that TRMT61A knockdown caused an overall change in the tRNA expression profile. Correlation analysis revealed that the m... 1 The level of A modification was significantly positively correlated with its expression abundance, and TRMT61A knockdown led to a significant decrease in the expression of demodified tRNA-Leu-CAA.

[0043] In translational analysis, polyribosome mapping results showed that TRMT61A knockdown significantly increased the 80S monoribosome peak while correspondingly decreasing the polyribosome peak, indicating that overall translation efficiency was inhibited. Puromycin incorporation experiments further confirmed that TRMT61A knockdown significantly reduced the rate of nascent protein synthesis in WPMY-1 and BPH-1 cells.

[0044] Example 5: Pathway enrichment analysis and differential gene screening To further explore the molecular mechanism by which TRMT61A regulates benign prostatic hyperplasia, this embodiment uses transcriptome and translatome sequencing technology to systematically analyze WPMY-1 and BPH-1 cells in the TRMT61A knockdown group and the control group.

[0045] Transcriptomics focuses on differences in gene expression at the transcriptional level, while translatomics uses ribosome-protected fragments (RPFs) to reflect gene translation efficiency. Figure 5 A). Volcano plot analysis visually presents the distribution characteristics of differentially expressed genes in terms of translation efficiency (TE). Figure 5 B). Functional enrichment analysis was performed on the gene set that was significantly downregulated by TE; KEGG pathway enrichment analysis showed that ( Figure 5 D), among which the TGF-β signaling pathway has the highest enrichment.

[0046] Example 6: Negative Regulation of TGFBR1 Translation Efficiency and TGF-β Pathway Activity by TRMT61A Knockdown To verify the regulatory effect of TRMT61A on TGFβR1 and the TGF-β pathway, this study used Western blot analysis to find that TRMT61A knockdown significantly reduced the protein level of TGFβR1 in WPMY-1 and BPH-1 cells, and simultaneously downregulated the phosphorylation level of its downstream key signaling molecules p-SMAD2 / 3; at the same time, the expression of α-SMA, a marker of intermediate fibrosis in WPMY-1 cells, was significantly reduced. Figure 6 A~B). qRT-PCR analysis showed that the mRNA level of TGFβR1 did not change significantly in either group of cells, further confirming that TRMT61A affects TGFβR1 expression through post-transcriptional regulatory mechanisms. Figure 6 C~D). EMT-related biomarker detection results showed that TRMT61A knockdown upregulated the expression of the epithelial biomarker E-cadherin and downregulated the expression of the mesenchymal biomarkers N-cadherin and Vimentin, suggesting that it could inhibit the mesenchymal transition process in this cell line. Figure 6 E). qRT-PCR experiments showed that after TRMT61A knockdown, TGFβR1 mRNA transferred from the heavier polyribosomal component to the lighter ribosomal subunit (40S / 60S), directly demonstrating that TRMT61A knockdown inhibited the translation initiation efficiency of TGFβR1. Figure 6 F).

[0047] Example 7: TGFβR1 overexpression partially reversed the phenotypic changes in prostate cells caused by TRMT61A deficiency. This embodiment is used to verify the regulatory effect of TGFβR1 on prostate cell proliferation, survival and downstream signaling pathways under TRMT61A deficiency conditions.

[0048] In TRMT61A stably knocked-down WPMY-1 and BPH-1 cells, an overexpression vector encoding TGFβR1 was further introduced via lentiviral transduction, and stable expression cell lines were obtained through antibiotic selection. Results were obtained by qRT-PCR and Western blotting. Figure 7 As shown in A and B, the mRNA and protein expression levels of TGFβR1 were significantly increased in the above cells.

[0049] Subsequently, functional analysis was performed on the cell phenotype. Figure 7 Cell proliferation assays (C-F) showed that, against a TRMT61A knockdown background, TGFβR1 overexpression partially restored the growth capacity of prostate cells and alleviated the cell proliferation inhibition caused by TRMT61A deficiency. Further analysis using Annexin V-FITC / PI double staining and flow cytometry revealed… Figure 7 G~H results showed that TGFβR1 overexpression alleviated the increase in apoptosis and cell death caused by TRMT61A deficiency to some extent.

[0050] At the molecular mechanism level, the expression and activation status of various downstream effector molecules were analyzed by Western blotting. Figure 7 I-L results showed that TRMT61A knockdown combined with TGFβR1 overexpression altered the expression and phosphorylation levels of related signaling molecules. Furthermore, in BPH-1 cells, TGFβR1 overexpression also regulated the expression of multiple epithelial-mesenchymal transition (EMT)-related markers. Figure 7 M~N).

[0051] Example 8: In vivo intervention effect of TRMT61A knockdown in a rat model of benign prostatic hyperplasia Animal model construction and in vivo gene intervention: 1) Animal Grouping and Model Establishment: This experiment was approved by the TOPBIOTECH Animal Ethics Committee (Approval No.: TOP-IACUC-20240049). Adult male Sprague Dawley (SD) rats (weighing 200-250 g, n=20) were selected and randomly divided into 4 groups after one week of acclimatization: Negative Control, BPH Model, BPH+Empty Vector Group (BPH+AAV9-NC), and BPH+Treatment Group (BPH+AAV9-sh61A). Except for the Negative Control Group, which was injected with olive oil only, the other groups of rats were subcutaneously injected with testosterone propionate (5 mg / kg, dissolved in olive oil) daily for 3 consecutive weeks to induce the BPH model. 2) Gene Therapy Administration (In Situ Injection): One week after testosterone induction, gene intervention was performed on rats in the BPH+AAV9-NC and BPH+AAV9-sh61A groups. After anesthetizing the rats, the ventral lobe of the prostate was exposed, and a single multi-point in situ injection was performed using a micro-syringe. The treatment group received an injection of adeno-associated virus type 9 (AAV9-sh61A, constructed by Shandong Weizhen Biotechnology) carrying TRMT61A-shRNA, while the control group received an injection of empty vector virus (AAV9-NC). The injection volume per lobe was 20 μL (titer 1×10⁻⁶). 12 VG / mL). 3) Sample collection: At the end of the experiment, rats were euthanized by CO2 asphyxiation. The prostate tissue was quickly and completely dissected, and the wet weight was measured to calculate the organ index. The tissue sample was divided into two parts: one part was fixed in 4% paraformaldehyde for histopathological examination, and the other part was flash-frozen in liquid nitrogen for molecular biological analysis.

[0052] Figure 8 The A-B immunoblotting results showed that, compared with the control group, the TRMT61A protein level in the prostate tissue of rats in the BPH model group and the BPH+AAV9-NC group was significantly increased, while the TRMT61A protein expression was significantly decreased in BPH rats treated with AAV9-sh61A.

[0053] Further analysis of m in total RNA of tissues 1 The level of modification A was detected. Figure 8 The results showed that TRMT61A knockdown significantly reduced the m in the prostate tissue of BPH rats. 1 A. Relative content. Figure 8 D-type histomorphological analysis showed that, compared with the BPH model group and the BPH+AAV9-NC group, the prostate volume of rats in the AAV9-sh61A treatment group was significantly reduced. Figure 8 E HE staining results further showed that TRMT61A knockdown could improve glandular structural abnormalities in the prostate tissue of BPH model rats. Figure 8F-H immunohistochemical staining results showed that in the TRMT61A knockdown treatment group, the positive signal of Ki67, a cell proliferation marker, was significantly reduced in prostate tissue. Simultaneously, the expression levels of TRMT61A and TGFβR1 in prostate tissue also changed accordingly.

[0054] In summary, the purpose of this invention is to provide a novel treatment strategy for benign prostatic hyperplasia (BPH) based on TRMT61A gene interference technology. Firstly, this involves targeting and inhibiting TRMT61A and its mediated tRNA-Leu-CAA m... 1 The A-modification directly blocks pathogenic signals at the translational level, providing a non-hormone-dependent treatment that avoids the side effects of sexual dysfunction caused by hormonal fluctuations. Secondly, by utilizing specific shRNA to block the translational activation of the TGF-β pathway, it achieves dual inhibition of prostatic epithelial proliferation and stromal fibrosis, overcoming the bottleneck of traditional drugs' inability to reverse tissue remodeling. Finally, it explores TRMT61A as a novel target for BPH, filling the therapeutic gap in the "epitranscriptome-translational regulation" dimension and providing more comprehensive and effective drug options for clinical practice. This invention inhibits prostatic hyperplasia and fibrosis by targeting TRMT61A to block translational activation. Its mechanism is clear, demonstrating definite efficacy and good safety at the in vivo level, and has extremely high clinical application value.

[0055] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

[0056] sequence list SEQ ID No. 1: GGGCGCTTCTGCTCCTTCTTTCAAGAGAAGAAGGAGCAGAAGCGCCCTTTTTT SEQ ID No. 2: GGCACTCAGTTGACCTTATTTCAAGAGAATAAGGTCAACTGAGTGCCTTTTT SEQ ID No. 3:

Claims

1. Application of TRMT61A as a target in the preparation of drugs for the prevention or treatment of benign prostatic hyperplasia.

2. The application according to claim 1, characterized in that, The benign prostatic hyperplasia mentioned refers to benign prostatic hyperplasia in its early, middle, or advanced stages.

3. The application according to claim 1, characterized in that, The drug reduces tRNA m 1 A methylation level inhibits the overall protein translation efficiency of cells to prevent or treat benign prostatic hyperplasia.

4. The application according to claim 1, characterized in that, The drugs include TRMT61A inhibitors.

5. The application according to claim 4, characterized in that, The TRMT61A inhibitor is shRNA, siRNA, miRNA mimic, antisense oligonucleotide, CRISPR-Cas gene editing system, aptamer, or neutralizing antibody.

6. The application according to claim 5, characterized in that, The TRMT61A inhibitor is an shRNA, and the nucleotide sequence of the shRNA is shown in SEQ ID No. 1 or 2.

7. The application according to claim 5, characterized in that, The TRMT61A inhibitor is delivered to prostate tissue via a viral vector or a non-viral delivery system.

8. The application according to claim 7, characterized in that, The viral vector is adeno-associated virus, lentivirus, or adenovirus.

9. The application according to claim 7, characterized in that, The non-viral delivery system is a liposome, polymer nanoparticle, inorganic nanocarrier, or exosome.

10. The application according to claim 1, characterized in that, The drug can be administered via urethral perfusion of the prostate, ultrasound-guided injection, or as a sustained-release implant.

Images