Application of WDR74 and / or ALYREF as molecular target in diagnosis and treatment of esophageal squamous cell carcinoma

By revealing the high expression and synergistic oncogenic mechanism of WDR74 and ALYREF in ESCC, a therapeutic strategy to inhibit their expression was provided, solving the challenges of early diagnosis and targeted therapy of ESCC and achieving a breakthrough in precision treatment and diagnosis.

CN122005805APending Publication Date: 2026-05-12SHANXI MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHANXI MEDICAL UNIV
Filing Date
2026-02-14
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing technologies lack biomarkers for early diagnosis of esophageal squamous cell carcinoma (ESCC), which has a high recurrence rate and mortality rate, and lacks effective targeted therapies. The mechanisms of action of WDR74 and ALYREF in ESCC are unclear, and cannot provide a theoretical basis for the design of targeted drugs.

Method used

By deeply analyzing the transcriptome data of cancerous and adjacent tissues in ESCC patients, we revealed that WDR74 and ALYREF are significantly overexpressed in ESCC and confirmed that they are oncogenes. We also found that they participate in the JAK-STAT signaling pathway and proposed a therapeutic strategy to inhibit the expression of WDR74 and ALYREF using small interfering RNA or specific antibodies. We combined immunoprecipitation to verify their interaction and constructed a "WDR74-ALYREF-EGFR-STAT3-MCL1" synergistic oncogenic axis.

Benefits of technology

It provides a clear targeted treatment strategy, offering a scientific basis for the precision treatment of ESCC, enabling early auxiliary diagnosis, efficacy monitoring, and prognosis assessment, thereby improving treatment effectiveness and prevention levels.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122005805A_ABST
    Figure CN122005805A_ABST
Patent Text Reader

Abstract

The invention relates to application of WDR74 and / or ALYREF as molecular targets in esophageal squamous cell carcinoma diagnosis and treatment, and belongs to the technical field of biological medicine. Aiming at the problem that the esophageal squamous cell carcinoma lacks an effective targeted treatment means, the invention discovers that the expression quantity of WDR74 in tumor tissues is obviously higher than that in para-carcinoma tissues, and the high expression of WDR74 prompts poor prognosis of a patient, and reveals that WDR74 protein and ALYREF protein have specific binding, and the mRNA stability of EGFR is enhanced through ALYREF-mediated m5C RNA epigenetic modification, so that STAT3 phosphorylation is activated, and the treatment effect of the esophageal squamous cell carcinoma is enhanced. Further, the STAT3 is combined with the promoter region of the apoptosis-inhibiting gene MCL1, and finally cell apoptosis is inhibited and tumor formation is promoted. The invention provides a new molecular target and a solution for developing a WDR74 and ALYREF targeting medicine for treating esophageal squamous cell carcinoma and related diagnosis and prognosis evaluation products.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology. More specifically, this invention relates to the application of WDR74 and / or ALYREF as molecular targets in the diagnosis and treatment of esophageal squamous cell carcinoma. Background Technology

[0002] Esophageal cancer is one of the most common malignant tumors of the digestive tract in my country. According to epidemiological data from 2022, the incidence rate of esophageal cancer in my country ranks 7th among all cancer types, and the mortality rate ranks 5th. Furthermore, my country accounts for over 90% of new cases and deaths from esophageal cancer in East Asia, with esophageal squamous cell carcinoma (ESCC) being the predominant pathological type. Currently, many challenges remain in the clinical diagnosis and treatment of ESCC, including: a lack of biomarkers for early diagnosis; high recurrence and mortality rates; the absence of effective targeted therapies; and a lack of precision treatment standards for ESCC patients in my country. Therefore, analyzing the molecular markers in the development and progression of ESCC and identifying drug targets for ESCC are of great significance for promoting precision treatment of ESCC.

[0003] The WDR74 gene, or WD Repeat-Containing Protein 74, is a member of the WD40 repeat proteins superfamily. In eukaryotes, WDR74 acts as a ribosome assembly factor, participating in rRNA processing and the synthesis of the 60S ribosome large subunit. Furthermore, WDR74 can participate in the development and progression of various cancer types. For example, in melanoma, WDR74 can activate MDM2 to ubiquitinate and degrade the tumor suppressor gene p53, promoting melanoma cell proliferation. In colorectal cancer, WDR74 increases the expression of phosphorylated β-catenin through the Wnt / β-catenin signaling pathway, thereby affecting the cell cycle and accelerating tumor growth. However, in ESCC, the impact of WDR74 on cancer cell malignant progression and its oncogenic mechanism remain unknown and require further investigation.

[0004] 5-methylcytosine (m 5 C) is an important type of RNA epigenetic modification that plays a crucial role in the expression regulation of tumor-associated driver genes. ALYREF, as one such m) 5 C-recognition proteins can recognize m on specific mRNAs. 5 ALYREF modifies C sites and participates in biological processes such as the stability regulation of target transcripts and nuclear export. Previous studies have shown that ALYREF plays a pro-cancer role in various tumors; in bladder cancer, ALYREF binds to the 3′UTR region of pyruvate kinase M2 (PKM2) mRNA.5 C-modification sites enhance the stability of PKM2 mRNA, thereby promoting tumor cell proliferation through PKM2-mediated glycolysis; in non-small cell lung cancer, ALYREF can bind to the non-coding RNA molecule LINC02159, and through m 5 C modification enhances the stability of YAP1 mRNA, thereby activating the Hippo and β-catenin signaling pathways and exerting a pro-cancer effect. Furthermore, in colorectal cancer, ALYREF recruits the RNA-binding protein ELAVL1 to co-recognize m... 5 C-modification promotes the nuclear export of RPS6KB2 and RPTOR transcripts, participating in the development and progression of colorectal cancer. However, the role of ALYREF in the malignant progression of ESCC and its underlying molecular mechanisms remain unclear to date.

[0005] In summary, our current understanding of the molecular mechanisms of esophageal squamous cell carcinoma (ESCC) is significantly limited. On the one hand, the mechanism of action of WDR74, known to have a clear pro-cancer effect in other cancers, remains a blank in this disease research. On the other hand, the function of the important RNA modification reading protein ALYREF in this disease is also unknown. More importantly, whether WDR74 and ALYREF have a functional association in ESCC, or whether they synergistically act on a certain oncogenic pathway, has never been explored. This double uncertainty constitutes a fundamental difficulty in developing drugs targeting these two molecules, because the criticality of the targets, their downstream pathways, and potential synergistic relationships cannot be confirmed, thus failing to provide any theoretical basis for the rational design of targeted drugs. Therefore, systematically elucidating the expression, function, mechanism, and interrelationship of WDR74 and ALYREF in ESCC is a crucial step in providing a scientific basis for the subsequent development of targeted therapy strategies. Summary of the Invention

[0006] The purpose of this invention is to elucidate the tumor-promoting mechanism of the WDR74 gene in esophageal squamous cell carcinoma, reveal the biological function of the ALYREF gene in this disease, and explore the functional association and synergistic effect of WDR74 and ALYREF in esophageal squamous cell carcinoma. Based on the above findings, this invention provides a novel use for agents that inhibit the expression of the WDR74 and ALYREF genes in the preparation of drugs for treating esophageal squamous cell carcinoma.

[0007] To address the aforementioned problems and achieve the objectives and other advantages of this invention, the use of reagents that inhibit the expression of the WDR74 gene and / or ALYREF gene in the preparation of medicaments for treating esophageal squamous cell carcinoma is provided.

[0008] Preferably, the reagent is a small interfering RNA, and the sequence of the small interfering RNA that inhibits the expression of the WDR74 gene is shown in SEQ ID NO. 1, and the sequence of the small interfering RNA that inhibits the expression of the ALYREF gene is shown in SEQ ID NO. 2.

[0009] Application of WDR74 protein and / or ALYREF protein as therapeutic targets for esophageal squamous cell carcinoma.

[0010] Use of inhibitors of WDR74 and / or ALYREF proteins in the preparation of drugs for the treatment of esophageal squamous cell carcinoma.

[0011] Preferably, the inhibitors of the WDR74 protein and / or ALYREF protein are antibodies against the WDR74 protein and / or antibodies against the ALYREF protein.

[0012] Use of inhibitors of the WDR74 gene and / or ALYREF gene in the preparation of drugs for the treatment of esophageal squamous cell carcinoma.

[0013] Preferably, the inhibitors of the WDR74 gene and the ALYREF gene are small interfering RNAs.

[0014] A pharmaceutical composition for treating esophageal squamous cell carcinoma, comprising a pharmaceutically acceptable carrier and an effective amount of an active ingredient, said active ingredient being an antibody against WDR74 protein and / or an antibody against ALYREF protein, or a small interfering RNA with a sequence as shown in SEQ ID NO. 1 and / or as shown in SEQ ID NO. 2.

[0015] An anticancer drug for the treatment of esophageal squamous cell carcinoma, the active ingredient of which is an inhibitor of the WDR74 gene and / or the ALYREF gene, or an inhibitor of the WDR74 protein and / or the ALYREF protein.

[0016] A kit for diagnosing or assessing the prognosis of esophageal squamous cell carcinoma, comprising reagents for detecting the expression levels of the WDR74 gene and / or the ALYREF gene in a subject's sample.

[0017] The present invention has at least the following beneficial effects: This invention, based on in-depth analysis of transcriptome sequencing data from 155 pairs of ESCC patient cancer and adjacent normal tissue samples, systematically reveals and simultaneously confirms for the first time that WDR74 and ALYREF are expressed at significantly higher levels in ESCC tumor tissues than in adjacent normal tissues (P<0.001). Further Kaplan-Meier survival analysis revealed that high expression of WDR74 is directly associated with poor patient survival. These findings establish WDR74 and ALYREF as novel candidate oncogenes and prognostic biomarkers closely related to the clinical progression of ESCC, filling a research gap in this field.

[0018] This invention comprehensively demonstrates the core oncogenic role of WDR74 in the development and progression of ESCC through a rigorous and systematic set of in vivo and in vitro functional experiments. Specifically, overexpression of the WDR74 gene significantly enhances the proliferation, colony formation, migration, and invasion capabilities of ESCC cells, and significantly promotes tumor formation in a nude mouse subcutaneous tumor-bearing model; simultaneously, its overexpression effectively inhibits apoptosis. Conversely, knockdown of WDR74 produces the opposite inhibitory effect. This provides comprehensive and solid functional evidence for using WDR74 as a therapeutic target for ESCC.

[0019] This invention, through transcriptome RNA-seq sequencing and bioinformatics analysis of WDR74 knockdown cells, revealed for the first time that differentially expressed downstream genes were significantly enriched in the JAK-STAT signaling pathway (P=0.005), thus clarifying that WDR74 mainly exerts its oncogenic effect by regulating this pathway. Further analysis showed that WDR74 can activate the expression of key genes such as EGFR and MCL1 in this pathway, providing a clear pathway direction for understanding its oncogenic mechanism.

[0020] This invention innovatively employs a co-immunoprecipitation (Co-IP) method combined with mass spectrometry analysis to discover and verify for the first time the interaction between WDR74 protein and RNA m. 5 There is a specific binding effect between the C-modified recognition protein ALYREF and EGFR. Mechanistic studies further elucidate that ALYREF can bind to the m-type gene on EGFR mRNA. 5 C-modification enhances its stability, while WDR74 can activate STAT3 phosphorylation; phosphorylated STAT3 then binds to the promoter region of the anti-apoptotic gene MCL1, regulating its transcription. This is the first time that WDR74, through its interaction with ALYREF, constitutes a synergistic oncogenic axis of "WDR74-ALYREF-EGFR-STAT3-MCL1", providing a deep analysis of their functional association and molecular mechanism in ESCC.

[0021] Based on the aforementioned original mechanism discovery, this invention explicitly proposes a novel therapeutic strategy targeting WDR74 and ALYREF, and concretizes it into several feasible applications. These include: the application of reagents that inhibit WDR74 and / or ALYREF gene expression (e.g., using small interfering RNA with specific sequences) or protein function (e.g., using specific antibodies) in the preparation of drugs for treating ESCC; the protection of pharmaceutical compositions containing such active ingredients; and the application of WDR74 and ALYREF themselves as therapeutic targets. This provides a clear, diverse, and direct theoretical basis and technical route for developing targeted drugs against ESCC.

[0022] This invention extends the research findings on the expression characteristics and mechanisms of WDR74 and ALYREF to the field of diagnostic applications, explicitly proposing that these two substances can be used as molecular markers to develop kits for diagnosing ESCC or assessing its prognosis. By detecting the expression levels of WDR74 and / or ALYREF in subject samples, it is expected to achieve early auxiliary diagnosis, efficacy monitoring, and prognostic assessment of ESCC, demonstrating clear prospects for clinical translation.

[0023] This invention directly addresses ESCC, a prevalent condition in my country lacking effective targeted therapies. The discovered molecular targets and mechanisms provide novel, proprietary scientific evidence for the precision treatment of ESCC patients in my country. This research has significant practical and clinical value in promoting the establishment of ESCC diagnosis and treatment standards that meet my country's clinical needs and improving overall prevention and control levels.

[0024] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached Figure Description

[0025] Figure 1 Figure showing the differential expression and survival prognosis analysis of the WDR74 gene in ESCC; Figure 2 The figure shows the effect of knockdown or overexpression of WDR74 on cell proliferation in KYSE150 and KYSE450 cells using the CCK-8 assay. Figure 3 The figure shows the effect of knockdown or overexpression of WDR74 on the colony-forming ability of KYSE150 and KYSE450 cells using a colony formation assay. Figure 4 The figure shows the effect of knocking down WDR74 on cell migration and invasion in KYSE150 and KYSE450 cells using a Transwell assay. Figure 5The figure shows the effect of knockdown or overexpression of WDR74 on apoptosis in KYSE150 cells, as detected by TUNEL staining and Western Blot experiments. Figure 6 To investigate the effect of WDR74 overexpression on ESCC tumor formation ability using a nude mouse subcutaneous tumor-bearing model, HE staining and immunohistochemistry experiments were performed. Figure 7 Volcano plot and KEGG pathway enrichment map of differentially expressed genes after WDR74 knockdown in KYSE150 cells, and cluster heatmap of the top 60 differentially expressed genes downregulated after WDR74 knockdown. padj <0.05, |log2FoldChange|>1.0); Figure 8 The graph shows the correlation between the expression levels of CDKN1A, IL11, BCL2L1, STAT3, EGFR, SOCS2 and WDR74 based on transcriptomic data from 155 reported ESCC patients. Figure 9 This graph shows the changes in mRNA levels of EGFR, MCL1, and IL6ST genes after WDR74 knockdown in KYSE150 cells. Figure 10 The diagram shows the identification and verification of the binding effect of WDR74 and ALYREF using Co-IP and mass spectrometry experiments, as well as the difference in ALYREF expression in cancer and adjacent tissues of 155 ESCC patients. Figure 11 Based on MeRIP-seq data (GSE249045) from KYSE150 cells, EGFR transcript m 5 C. Distribution of enrichment peaks; Figure 12 To detect KYSE150 and KYSE450 cell activity using a dual-luciferase reporter gene activity assay, ALYREF was used via EGFR 3′UTR m 5 The effect of the C site on luciferase activity; Figure 13 The graph shows the changes in EGFR gene mRNA levels after ALYREF knockdown in KYSE150 cells and the effect of ALYREF knockdown or overexpression on the degradation rate of EGFR mRNA detected by the actinomycin D blocking assay. Figure 14 The graph shows the correlation analysis of WDR74, ALYREF and EGFR expression levels based on transcriptome data of esophageal cancer tissue and normal esophageal tissue from the GEPIA database. Figure 15This is a graph showing the changes in p-STAT3 levels in KYSE150 cells after WDR74 knockdown and overexpression, as detected by Western blotting. Figure 16 This is a schematic diagram of the binding sites of transcription factor STAT3 and MCL1 promoter region, where the pink box represents potential STAT3 binding region 1 (P1) and the orange box represents potential STAT3 binding region 2 (P2). Figure 17 The images show the enrichment of H3K4me3 signal at the STAT3 binding site in the MCL1 promoter region of KYSE150 cells, and the ChIP-seq signal enrichment distribution of transcription factor STAT3 at the corresponding binding sites in Hela-S3 cells and five types of basal breast cancer cell lines. Figure 18 To verify the binding activity of STAT3 and MCL1 promoter in KYSE150 cells using ChIP-qPCR experiments. Detailed Implementation

[0026] The present invention will be further described and illustrated below with reference to embodiments. However, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other inventions and embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Furthermore, the specific implementation methods and embodiments of the present invention are for illustrative purposes only, and not for limiting the present invention.

[0027] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples can be obtained commercially or through existing technologies.

[0028] I. Experimental Materials Cell line source: Human esophageal squamous cell carcinoma cells KYSE150, KYSE450, and human embryonic kidney cells HEK-293T were preserved by the Shanxi Provincial Key Laboratory of Esophageal Cancer Pathogenesis and Translational Research, Shanxi Medical University.

[0029] Immunodeficient mice: Nude mice were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd., and the strain was 4-6 week old female BALB / c-Nude mice.

[0030] siRNA: The small interfering RNAs used in this invention, si-WDR74 and si-ALYREF, were synthesized by Guangzhou Ruibo Biotechnology Co., Ltd.

[0031] Plasmids: The pGL3 promoter-EGFR-3'UTR-WT and pGL3 promoter-EGFR-3'UTR-MUT plasmids used in this invention were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0032] Main reagents: RPMI-1640 cell culture medium (VivaCell, C3010); FBS fetal bovine serum (ExCell Bio, FSP500); trypsin (SEVEN, SC107); Lipo2000 transfection reagent (Mei5bio, MF135); Matrigel (Corning, 356234); RIPA lysis buffer (Beyotime, P0013B); 30% (w / w) acrylamide gel (29:1) (Solarbio, S1010); 1.5M Tris-HCl buffer (pH 8.8) (Solarbio, T1010); 1M Tris-HCl buffer (pH 6.8) (Solarbio, T1140); 10% (w / w) sodium dodecyl sulfate (Solarbio, A1010); nucleic acid dye (SEVEN, SM106); DNA marker (Takara, 3428A).

[0033] Major antibodies: Rabbit anti-human phospho-STAT3 antibody (Cell Signaling Technology, 9145T); Rabbit anti-human BAX antibody (Cell Signaling Technology, 5023T); Rabbit anti-human BCL2 antibody (Proteintech, 12789-1-AP); Mouse anti-human GAPDH antibody (Proteintech, 60004-1-Ig); IRDye 800CW goat anti-mouse IgG secondary antibody (LI-CORBiosciences, C50113-06); IRDye 800CW goat anti-rabbit IgG secondary antibody (LI-CORBiosciences, C50113-05).

[0034] Main reagent kits: One-step TUNEL cell apoptosis green fluorescence detection kit (Beyotime, C1086); CCK-8 cell proliferation and cytotoxicity detection kit (APExBIO, K1018); BCA protein concentration assay kit (BOSTER, AR0146); PrimeScript TMRT reagent kit (Takara, RR036A); 2×M5 HiPer Dual SYBRgreen Realtime PCR Super mix (Mei5bio, MF013); endotoxin-free plasmid small-scale preparation kit (TIANGEN, DP108); SimpleChIP® Plus Sonication Chromatin IP Kit (Cell Signaling Technology, 56383), Pierce TM Classic Magnetic IP / Co-IP Kit 40 reactions kit (ThermoFisher SCIENTIFIC, 88804).

[0035] II. Experimental Methods 1. Cell thawing: Place the cryovials in a 37°C water bath until the frozen cells are completely thawed. Centrifuge at 800 rpm for 3 minutes, then discard the supernatant from the cryovials. Add 1 mL of complete culture medium and mix thoroughly. Transfer the mixture to a 10 cm cell culture dish containing 9 mL of complete culture medium, mix well, and place in a 37°C, 5% CO2 incubator. The culture medium can be changed the next day.

[0036] 2. Cell Passaging: When the cell density reaches 70-80%, passage the cells. After discarding the culture medium, add 3 mL of PBS to wash away floating dead cells, then add 2 mL of trypsin to digest the cells. After incubating for 2-3 minutes, observe whether the cells are suspended. If the cells are suspended and spherical, add 6 mL of complete culture medium to stop the digestion reaction. Centrifuge at 800 rpm for 3 minutes, then discard the supernatant. Add 3 mL of complete culture medium and mix thoroughly. Take 1 mL of this mixture and add it to a culture dish containing 9 mL of pre-prepared culture medium. Mix thoroughly and then incubate at 37°C in a 5% CO2 incubator for further culture.

[0037] 3. Cell cryopreservation: After aspirating the complete culture medium from the culture dish, add 3 mL of PBS to wash away any floating dead cells. Add 2 mL of trypsin to digest the cells and incubate for 2-3 minutes. After digestion, observe whether the cells are suspended. If the cells are suspended and spherical, quickly add 6 mL of complete culture medium to stop the digestion reaction. Centrifuge at 800 rpm for 3 minutes, then aspirate the supernatant. Add 1 mL of cell cryopreservation solution, mix well, and transfer to cryovials. Place the cryovials in a pre-cooled cryopreservation box and incubate overnight at -80°C. After cooling, transfer the cryovials from the cryopreservation box to a liquid nitrogen tank.

[0038] 4. siRNA transfection in cells: After trypsin digestion of cells in the logarithmic growth phase, 10 μL of cell suspension was transferred to a cell counting chamber to fill the chambers, and cell counting was performed. The cells were then seeded at a density of 2.5 × 10⁶ cells per well in a 6-well plate. 5 The required cell suspension was prepared and then slowly pipetted into the wells of a 6-well plate. Ensure the cell density reaches approximately 60% by the time of transfection the next day. Mix 7.5 μL of Lipo2000 transfection reagent with 250 μL of opti-MEM; mix 5 μL of siRNA (75 pmol) with 250 μL of opti-MEM, and then mix with the Lipo2000 transfection reagent dilution. The siRNA targeting WDR74 is shown in SEQ ID NO.1, si-WDR74: ACAGGACGGTGAAGCACTT; the siRNA targeting ALYREF is shown in SEQ ID NO.2, si-ALYREF: AAGTGCACGTCTGCTGTTCC. The plates were then incubated at room temperature for 15 min, and then slowly pipetted into the 6-well plates. The plates were incubated at 37°C in a 5% CO2 incubator for 48 h.

[0039] 5. Transfection of plasmids into cells: After trypsin digestion of cells in the logarithmic growth phase, 10 μL of cell suspension was transferred to a cell counting chamber to fill the chambers, and cell counting was performed. The cells were then seeded at a density of 2.5 × 10⁶ cells per well in a 6-well plate. 5 Prepare the required cell suspension for each cell, and then pipette it into the wells of a 6-well plate. Ensure that the cell density reaches approximately 60% by the time of transfection the next day. Mix 7.5 μL of Lipo2000 transfection reagent with 250 μL of opti-MEM. Mix 5 μL of plasmid (2500 ng) with 250 μL of opti-MEM, and then mix with the Lipo2000 transfection reagent dilution. Incubate at room temperature for 15 min, and then slowly pipette it into the 6-well plate. Incubate at 37°C in a 5% CO2 incubator for 48 h.

[0040] 6. CCK-8 assay to detect cell proliferation: Cells from each treatment group were digested with trypsin and seeded into 96-well plates with 5,000 cells per well. Five replicate wells were set up for each treatment group. At four time points, 10 μL of CCK-8 solution from the CCK-8 cell proliferation and toxicity assay kit was added to each well. The plates were incubated for 2 h, and the OD value of each well was detected at a wavelength of 450 nm using a microplate reader.

[0041] 7. Colony formation assay to detect cell proliferation: Cells from each treatment group were digested with trypsin and seeded into 6-well plates, with 1,000 cells per well. The plates were cultured for 8 days. Culture was terminated when visible cell clones appeared in the 6-well plates. After washing with PBS, cells were fixed with 4% paraformaldehyde for 15 min, then discarded. The cells were then stained with 0.5% crystal violet for 30 min, washed with triple-distilled water, and photographed for record-keeping.

[0042] 8. Cell migration and invasion assays to detect cell invasion and migration capabilities: ① Cell migration assay: Place the matching Transwell chamber in a 24-well plate and add 100 μL of the medium at a density of 1×10⁻⁶ cells / well. 6 Cell suspension (serum-free medium) of 10 cells / mL was added to the upper chamber of the Transwell apparatus. 500 μL of RPMI 1640 medium containing 15% (v / v) fetal bovine serum (FBS) was added to the lower chamber. After incubation at 37°C for 48 h, the chambers were removed with forceps, and the solution in the upper chamber was discarded. Cells on the membrane of the inner chamber of the Transwell apparatus were gently wiped with a moistened cotton swab, fixed with 4% paraformaldehyde, and incubated at room temperature for 15 min. Then, they were stained with 0.5% crystal violet and incubated at room temperature for 30 min. Finally, the cells were washed twice with PBS, dried, and observed under a microscope. Three fields of view were randomly selected from each Transwell chamber for photographing, and the number of cells in each field was counted and statistically analyzed.

[0043] ② Cell invasion assay: First, using RPMI 1640 cell culture medium, dilute Matrigel at a volume ratio of 1:10. Then, quickly add the diluted Matrigel to the inner membrane of the Transwell chamber, ensuring the gel solidifies. Add 100 μL of a 1.5 × 10⁻⁶ m³ solution to the upper chamber of the Transwell apparatus. 6 Cells were suspended in serum-free medium at a density of 1 / mL. 500 μL of RPMI 1640 medium containing 15% (v / v) fetal bovine serum (FBS) was added to the lower chamber. After culturing at 37°C for 72 h, the cells were fixed with 4% paraformaldehyde and incubated at room temperature for 15 min. Then, the cells were stained with 0.5% crystal violet and incubated at room temperature for 30 min. Finally, the cells were washed twice with PBS, dried, and observed under a microscope. Three fields of view were randomly selected from each Transwell chamber for photographing. The number of cells in each field of view was counted and statistically analyzed.

[0044] 9. TUNEL staining to detect apoptosis: Cells from each treatment group were digested with trypsin and seeded into 6-well plates, with 3 × 10⁶ cells per well.5 When the cells reach approximately 40-50% confluence, wash them once with PBS (moderate drying can help the cells adhere better). Then fix them with immunostaining fixation solution, incubate at room temperature for 15 minutes, wash once with PBS, and then permeabilize with a 0.3% Triton X-100 solution, incubating at room temperature for 5 minutes. During incubation, prepare the TUNEL assay solution from the one-step TUNEL apoptosis green fluorescence detection kit, calculating the dosage as follows: 5 μL TdT enzyme and 45 μL fluorescent labeling solution per well. Add the required total amount of TdT enzyme and fluorescent labeling solution sequentially. Store the prepared solution away from light. After incubation with 0.3% Triton X-100, wash the cells once with PBS, add the prepared TUNEL assay solution, and incubate at 37°C in the dark for 1 hour. Wash with PBS solution, add 50 μL of DAPI staining solution, incubate at room temperature in the dark for 10 min, wash the cells twice with PBS solution, mount with anti-fluorescence quenching mounting medium, observe and photograph under a fluorescence microscope.

[0045] 10. Detection of the effect of WDR74 on tumor growth in a nude mouse tumor-bearing model: 5×10 6 WDR74-overexpressing cells or negative control cells were suspended in PBS buffer and subcutaneously inoculated into 4-week-old female BALB / c nude mice to establish a nude mouse tumor-bearing model and to detect the effect of WDR74 on tumor growth. Tumor size was measured every 3 days. When a significant difference was observed between the experimental and control groups, and the tumor diameter was no greater than 1.5 cm, the mice were sacrificed, and the tumor tissue was extracted, photographed, measured, and fixed. Subsequent staining with hematoxylin and eosin (HE) and immunohistochemical staining was performed on the tumor tissue.

[0046] 11. Detection of mRNA expression levels in cells: Carefully wash the transfected cell pellet twice with PBS and collect the pellet. Add 1 mL of RNAiso Plus to the cell pellet and resuspend, incubate at room temperature for 5 min. Add 200 μL of chloroform, mix rapidly using a vortex mixer, and incubate on ice for 10 min until separation occurs. Centrifuge at 12,000 rpm for 15 min at 4°C. Aspirate the supernatant, add 500 μL of isopropanol, shake vigorously up and down, incubate on ice for 15 min, and centrifuge at 12,000 rpm for 10 min at 4°C. Discard the supernatant, add 300 μL of 70% anhydrous ethanol to wash the pellet, centrifuge at 12,000 rpm for 5 min at 4°C, and carefully discard the supernatant. Dissolve the RNA completely in 30 μL of DEPC water and determine its concentration. Perform reverse transcription in a 20 μL reaction volume. See Table 1 for reaction reagents and quantities used.

[0047] Table 1. Reagents and Amounts Used After mixing and centrifugation, the mixture was subjected to reaction on an instrument. The reaction conditions are shown in Table 2.

[0048] Table 2 Reaction conditions Then, the reverse transcription product was subjected to real-time quantitative PCR according to the following system. The reaction volume was 20 μL. The upstream primer for the WDR74 gene was 5′-AATGCTTTGAAGATATGGGA-3′, as shown in SEQ ID NO. 3; the downstream primer for the WDR74 gene was 5′-AAACACGGACCTGGTGGTAC-3′, as shown in SEQ ID NO. 4. The reaction reagents and quantities used are shown in Table 3.

[0049] Table 3 Reagents and Amounts Used After mixing and centrifugation, the mixture was subjected to reaction on an instrument. The reaction conditions are shown in Table 4.

[0050] Table 4 Reaction conditions 12. Western Blot: First, collect the cell pellet to be analyzed by Western blotting, add RIPA lysis buffer, lyse on ice for 5 min, then lyse using a cell sonicator, centrifuge at 12,000 rpm for 30 min at 4°C, and collect the protein supernatant. Protein concentration is determined using a BCA protein assay kit. The protein loading amount per well is set to 50 μg, and the loading volume is set to 30 μL, containing 6 μL of 5× Loading Buffer. After mixing, boil at 100°C for 5 min and place on ice for loading. Then, prepare a polyacrylamide gel using 30% (w / w) acrylamide gelling solution (29:1), 1.5M Tris-HCl buffer (pH 8.8), 1M Tris-HCl buffer (pH 6.8), and 10% (w / w) sodium dodecyl sulfate. Assemble the gel casting apparatus first, and prepare the separating gel according to the molecular weight of the protein to be tested. After the separating gel solidifies, select a suitable 10-well or 15-well loading comb according to the experimental group, prepare a 5% (w / w) stacking gel, pour the gel into the wells, and insert the loading comb. After the stacking gel solidifies, remove the loading comb; the protein gel is now ready. Soak the gel in 1× electrophoresis buffer for later use. After assembling the protein gel electrophoresis tank, pour in 1× electrophoresis buffer, load the protein samples, and add protein markers to the designated wells. Set the voltage to 80 V for electrophoresis. After 30 min, increase the voltage to 120 V. After 1 h, stop electrophoresis. For protein electroporation, remove the long and short glass plates from the electrophoresis tank. Use a clean plastic gel cutter to remove the top layer of stacking gel and place it on filter paper. Position this side of the filter paper on the black side of the sandwich clamp. Then, use tweezers to pick up the activated PVDF membrane and place it on top of the polyacrylamide gel. Lightly cover the white side of the sandwich clamp with two more layers of filter paper, close the sandwich clamp, and place it in the electroporation tank. Add 1× electroporation buffer, ensuring the liquid level reaches the top edge of the sandwich clamp. Assemble the transfer apparatus according to the principle of black electrodes to black and red electrodes to red. Take out the 1× electroporation buffer, pre-cooled in a 4°C chromatography cabinet, and pour it into the electroporation tank. Place the electroporation tank in a bowl filled with ice. Place the entire transfer apparatus in a 4°C chromatography cabinet and transfer at a constant voltage of 100 V for 2 hours. Prepare 5% (w / w) skim milk powder and place it in a container containing the PVDF membrane. At room temperature, adjust the shaker speed to approximately 70 rpm and shake for 2 hours to seal. Then, rabbit anti-human phospho-STAT3 antibody, or rabbit anti-human BAX antibody, or rabbit anti-human BCL2 antibody, or mouse anti-human GAPDH antibody were added to the container containing the PVDF membrane. The mixture was incubated overnight at 4°C and 70 rpm with shaking. The next day, the mixture was rinsed with TBST solution at room temperature and 110 rpm.Then, IRDye 800CW goat anti-mouse IgG secondary antibody or IRDye 800CW goat anti-rabbit IgG secondary antibody were added to the container containing the PVDF membrane, and the mixture was shaken at 70 rpm for 2 hours. After rinsing with TBST solution, development was performed using a dual-color infrared laser imaging system.

[0051] 13. Construction of overexpression plasmid: RNA was extracted from KYSE150 cells and reverse transcribed into cDNA. A fragment containing the target gene WDR74 was cloned by PCR, with NheI and XhoI restriction sites added to both ends of the primers. The laboratory vector pcDNA3.1 was then linearized by double digestion with the same enzymes. The concentrations of the linearized vector pcDNA3.1 and the insert fragment WDR74 were determined. A recombination reaction was performed, and the optimal amounts of linearized vector pcDNA3.1 and insert fragment WDR74 were calculated. The optimal vector amount was (0.02 × bp) ng, or 0.03 pmol; the optimal insert fragment amount was (0.04 × bp) ng, or 0.05 pmol. All reagents were placed on ice, and the reaction volume was 20 μL. Reagents and quantities are shown in Table 5.

[0052] Table 5 Reagents and Dosage Where X and Y are the linearized vector and the volume of the inserted fragment used, calculated according to the above formula, respectively. After preparing the system, mix and centrifuge, then incubate at 50℃ in a metal bath for 20 min. After the reaction, place a 1.5 mL EP tube on ice for 5 min to cool. Transform the recombinant product and plate it. Thaw DH5α competent cells on ice. Take 10 μL of the recombinant product from 20 μL and quickly add it to 100 μL of competent cells, then wait on ice for 30 min. Then heat shock at 42℃ for 90 sec, incubate on ice for 2 min, then add 900 μL of LB medium, shake at 200 rpm on a shaker at 37℃ for 1 h. After shaking, centrifuge at 5,000 rpm for 3 min and discard 700 μL of supernatant. Resuspend the cells in the remaining 200 μL of liquid medium in an EP tube, then spread evenly on an ampicillin (Amp) resistant plate using a sterile spreader. When no obvious bacterial culture is visible on the petri dish, invert the plate, label it, and incubate overnight at 37°C. The next day, prepare a new plate containing ampicillin resistance (Amp) and preheat it at 37°C. Use a sterile, flamed pipette tip to pick up a single colony, streak it on the plate, and label it accordingly. Invert the plate and incubate at 37°C for 6-8 hours. Colony PCR identification is performed. Prepare a 15 μL PCR system, mix, centrifuge, and run the reaction on the instrument. The reaction conditions are shown in Table 6. Then, prepare an agarose gel using agar powder, 1×TAE solution, and nucleic acid dye, and perform agarose gel electrophoresis. Use DNA markers to distinguish band size and select positive clones. Finally, pick the labeled positive clones with a pipette tip and place the tip in 2 mL of liquid culture medium containing 1.5 μL of ampicillin. Incubate overnight at 37°C and 200 rpm. Extract plasmids using an endotoxin-free plasmid mini-prep kit and send them to the company for sequencing.

[0053] Table 6 Reaction conditions 14. Transcriptome Sequencing Data Analysis: Next-generation RNA-seq sequencing analysis was performed on the WDR74 gene knockdown group and the control group of KYSE150 cells (each group contained 3 biological replicates). Each sample had a sequencing yield of 6 G, and differential expression analysis between the knockdown group and the control group was performed using an Illumina sequencer and the DEseq2 algorithm. padj Differentially expressed genes were screened using thresholds of <0.05 and |log2FoldChange|>1.0. Finally, all differentially expressed genes were analyzed for GO and KEGG signaling pathways.

[0054] 15. Chromatin Immunoprecipitation (ChIP): ChIP experiments were performed using the SimpleChIP® Plus Sonication Chromatin IP Kit. First, cell cross-linking was performed. The culture dishes were placed in a fume hood, and 540 μL of 37% formaldehyde was added to each 15 cm cell culture dish. The mixture was incubated at room temperature for 10 min. Then, 2 mL of glycine was added, and the mixture was incubated at room temperature for 5 min. Next, 2 mL of pre-chilled PBS + PIC was added, and the cells were scraped off. The mixture was centrifuged at 1,500 rpm for 5 min at 4°C, and the PBS was removed. The cells were then dispersed with 950 μL of 1× ChIP Sonication Cell Lysis Buffer + PIC and placed on ice for 10 min. The mixture was centrifuged at 3,000 rpm for 6 min at 4°C, and the supernatant was discarded. The cells were resuspended in 1 mL of pre-chilled ChIP Sonication Nuclear Lysis Buffer + PIC and incubated on ice for 10 min. The mixture was then divided into three aliquots of 333 μL each. The lysate was placed in a glass tube and sonicated for 9 cycles. After sonication, it was transferred to a 1.5 mL centrifuge tube and centrifuged at 12,000 rpm for 10 min at 4°C until the lysate became clear. 50 μL of the supernatant was collected for chromatin digestion and concentration analysis. The DNA was purified, and 10 μL of the sample was subjected to agarose gel electrophoresis. Approximately 60-90% of the DNA fragments should be less than 1 kb. The DNA concentration was then determined using a spectrophotometer; the concentration should be between 50-200 μg / mL.

[0055] Chromatin precipitation was then performed. For each immunoprecipitation, 5–10 µg of chromatin DNA was diluted to 500 μL with 1 × ChIP Buffer + PIC. The mixture was placed on ice, and 10 μL of the diluted chromatin sample was taken as a 2% (v / v) input control. The corresponding immunoprecipitation antibody was added to the remaining diluted immunoprecipitate. 2 µg of the corresponding species' IgG was added to the negative control, and the mixture was incubated overnight at 4°C with shaking. The next day, the ChIP-Grade Protein G Magnetic Beads were gently vortexed to resuspend them. Immediately after vortexing, 30 μL of the beads were transferred to an EP tube. Immunoprecipitate samples from each group were aspirated into the EP tube and incubated with shaking at 4°C for 4 h. Protein G Magnetic Beads were then precipitated using a magnetic separator. After the magnetic beads were attracted to the centrifuge tube wall, the supernatant was discarded. The beads were washed sequentially with low-salt wash solution and high-salt wash solution. Add 150 μL of 1× ChIP Elution Buffer to an EP tube containing 2% input sample and incubate at room temperature. Add 150 μL of 1× ChIP Elution Buffer to each immunoprecipitation sample and dissolve in a 65°C metal bath for 30 min, vortexing every 5 min to mix. Precipitate Protein G Magnetic Beads on a magnetic separator. After the magnetic beads are attracted to the centrifuge tube wall, aspirate the chromatin supernatant from the previous step for later use.

[0056] Next, cross-linking was decrosslinked. 6 μL of 5M NaCl and 2 μL of Proteinase K were added to all immunoprecipitated samples (including 2% of the input sample), and the mixture was incubated at 65°C for 2 h. The DNA was purified and subjected to qRT-PCR detection. The reaction system is shown in Table 7.

[0057] Table 7 Reaction conditions After mixing and centrifugation, the mixture is then subjected to reaction on an instrument. The reaction procedure is shown in Table 8.

[0058] Table 8 Reaction Procedure We used the JASPAR database to predict the binding of two regions (P1 and P2) in the MCL1 promoter to the transcription factor STAT3 and designed ChIP-qPCR primers, as shown in Table 9.

[0059] Table 9 ChIP-qPCR Primers 16. Co-Immunoprecipitation (Co-IP): Using Pierce TM Co-IP experiments were performed using the ClassicMagnetic IP / Co-IP Kit 40 reactions kit. HEK-293T cells were first transfected with pcDNA3.1-FLAG and pcDNA3.1-WDR74-FLAG plasmids, respectively. After 48 h of transfection, IP lysis buffer was added, and the cells were incubated on ice for 10 min. The supernatant was then collected, and protein concentration was determined using a BCA protein assay kit.

[0060] Two samples with a total protein content of 1 mg were prepared. Cell lysate from one sample was conjugated with 10 μg of FLAG immunoprecipitation antibody; the other sample was conjugated with 10 μg of IgG immunoprecipitation antibody from the same species. The samples were diluted to 500 μL with IP lysis buffer and incubated overnight at 4°C. Next, 0.25 mg of Pierce protein A / G magnetic beads were added to a 1.5 mL EP tube. The immune complex was then added to the EP tube containing the washed magnetic beads and incubated at room temperature for 4 h. The EP tube was placed in a magnetic separator, and after the magnetic beads were attracted to the centrifuge tube wall, the unbound sample was discarded. IP wash buffer was added again, mixed well, and the EP tube was placed in the magnetic separator again. After the magnetic beads were attracted to the centrifuge tube wall, the wash buffer was discarded. This washing process was repeated twice. Finally, add 100 µL of diluted 1× electrophoresis loading buffer to the EP tube, heat at 100℃ for 10 min, and then use a magnetic separator to attract the magnetic beads to the centrifuge tube wall. The supernatant is the solution containing the target antigen, which is then aspirated for SDS-PAGE electrophoresis.

[0061] 17. Actinomycin D blocking assay: Digest and count the cells in each group, seed them in 6-well plates, and inoculate 3 × 10⁶ cells per well. 5 Cells were cultured overnight, and then actinomycin D (10 μg / mL) was added to each well for 2, 4, 6, and 8 hours, respectively. Cells were collected at the corresponding time points and stored at -20℃. Total RNA was extracted from each sample, and 1 μg of RNA was used for reverse transcription. The expression level of the target gene in each sample was detected by qRT-PCR. The average Ct value at each time point was normalized to the average Ct value at 0 h to obtain the ΔCt value. ΔCt = (Ct value at each time point - Ct value at 0 h). The relative expression level at each time point was calculated: mRNA = 2 (-△CT) The relative mRNA expression levels at each time point relative to t = 0 were plotted using GraphPad Prism.

[0062] 18. Dual-luciferase reporter gene assay: Cells from each treatment group were digested with trypsin and seeded in 24-well plates. On the second day, the cell density reached approximately 60% at transfection. Prepare 50 μL of Opti-MEM solution, 500 ng of luciferase reporter gene plasmid, and 1.5 ng of pRL-TK internal control plasmid in each well. Add the above mixture to Lipo2000 transfection reagent and incubate at room temperature for 20 min. After incubation, add the mixture dropwise to each treatment group's cells. 48 h after transfection, add 100 μL of prepared 1× cell lysis buffer to each treatment group's cells, incubate at room temperature for 10 min, then scrape cells into EP tubes and centrifuge at 4°C, 12,000 rpm for 10 min. Transfer the supernatant from centrifugation to a new EP tube. Prepare for fluorescence detection using an ultrasensitive tube chemiluminescence analyzer. First, pipette 50 μL of LAR I (Luciferase Reaction Reagent Ⅰ) solution into a new EP tube. Then, add 10 μL of the supernatant after centrifugation to the EP tube, mix well, and place it in an ultrasensitive tube chemiluminescence analyzer to detect the fluorescence signal value of firefly luciferase. Then, remove the EP tube, add 50 μL of LAR II (Luciferase Reaction Reagent Ⅱ) solution to the EP tube, mix well, and place it in an ultrasensitive tube chemiluminescence analyzer to detect the fluorescence signal value of sea cucumber luciferase.

[0063] III. Experimental Results 1. Differential expression of WDR74 and prognostic analysis in ESCC: To elucidate the clinical significance of the WDR74 gene in ESCC, we analyzed transcriptome sequencing data from 155 previously reported pairs of ESCC patient cancer and adjacent normal tissue samples. We found that the expression level of the WDR74 gene in ESCC tumor tissue was significantly higher than that in adjacent normal tissue. P <0.001)( Figure 1 Furthermore, we used WDR74 expression data to divide patients into a low WDR74 expression group (n = 99) and a high WDR74 expression group (n = 55) based on ROC curves. Subsequently, Kaplan-Meier survival analysis revealed that patients with high WDR74 expression in tumor tissue had a poorer survival prognosis. Figure 1 The findings suggest that WDR74 plays a pro-cancer role in ESCC and could be a potential molecular drug target for ESCC.

[0064] 2. WDR74 significantly promotes ESCC cell proliferation, migration, and invasion; inhibits apoptosis; and enhances tumorigenesis: To investigate the effect of the WDR74 gene on cell proliferation in ESCC, we used a CCK-8 assay and found that the WDR74 gene significantly promotes cell proliferation in ESCC. Figure 2 We further validated these results using colony formation experiments, finding that knocking down the WDR74 gene significantly reduced the number of monoclonal colonies formed by KYSE150 and KYSE450 cells. Overexpression of the WDR74 gene significantly increased the number of monoclonal colonies formed by KYSE150 cells. Figure 3 The above results indicate that WDR74 significantly promotes the proliferation of ESCC cells.

[0065] Furthermore, to clarify the effect of WDR74 on ESCC cell invasion and migration, we performed Transwell experiments on WDR74-knockdown KYSE150 and KYSE450 cells, and found that WDR74 knockdown significantly inhibited the migration and invasion ability of ESCC cells. Figure 4 ).

[0066] Next, to further investigate the effect of WDR74 on apoptosis in ESCC cells, we used TUNEL staining to observe the fluorescence intensity of cells in each treatment group. The results showed that in KYSE150 cells, compared with the control group, knockdown of WDR74 significantly enhanced TUNEL fluorescence intensity, while overexpression of WDR74 significantly reduced TUNEL fluorescence intensity. Figure 5 The results showed that knockdown of WDR74 significantly promoted apoptosis, while overexpression of WDR74 significantly inhibited apoptosis.

[0067] To further clarify the role of WDR74 in ESCC cell apoptosis, we used Western blotting to detect the expression levels of apoptosis-related proteins BAX and BCL2. The results showed that in KYSE150 cells, compared to the control group, knockdown of WDR74 significantly increased the protein expression level of the pro-apoptotic gene BAX and significantly decreased the protein expression level of the anti-apoptotic gene BCL2. Conversely, overexpression of WDR74 significantly decreased the protein expression level of the pro-apoptotic gene BAX and significantly increased the protein expression level of the anti-apoptotic gene BCL2. Figure 5 The above results suggest that WDR74 significantly inhibits apoptosis in ESCC cells.

[0068] Furthermore, to investigate the effect of WDR74 on tumor-forming ability, this invention constructed a subcutaneous tumor-bearing model in nude mice. 5×10 6 WDR74-overexpressing cells or negative control cells were subcutaneously inoculated into 4-week-old female BALB / c nude mice. Mice were sacrificed when a significant difference was observed between the experimental and control groups and the tumor diameter did not exceed 1.5 cm, and tumor tissue was extracted. Results showed that the subcutaneous tumor volume and weight were significantly increased in the WDR74-overexpressing group. Figure 6HE staining results showed that the tumor tissue in the WDR74 overexpression group had a denser cell arrangement and a significantly altered tissue structure compared to the control group. Furthermore, immunohistochemical results showed that after WDR74 overexpression, the expression of the cell proliferation marker Ki67 was significantly increased. Figure 6 The above in vivo experimental results suggest that WDR74 can enhance the tumor-forming ability of ESCC, indicating that it is a potential therapeutic target for ESCC.

[0069] 3. Downstream signaling network and differentially regulated gene enrichment analysis of WDR74: To further explore the mechanism of action of WDR74 in ESCC, we performed second-generation transcriptome sequencing RNA-seq (three independent biological replicates per group) on WDR74 knocked-down KYSE150 cells and their control group cells. We used the DESeq2 algorithm to analyze differential gene expression in the second-generation sequencing data, and the criteria for screening differentially expressed genes were as follows: padj <0.05, |log2FoldChange|>1.0, a total of 115 downstream genes were found to be significantly upregulated (including IL6R, STAT3, etc.), and 134 genes were found to be significantly downregulated (including IL6ST, MCL1, CDKN1A, EGFR, etc.). Figure 7 ).

[0070] To identify downstream target genes and molecular signaling pathways of WDR74 in ESCC, we performed KEGG enrichment analysis on the differentially identified gene set. The results showed that differentially identified genes were enriched in the JAK-STAT tumor signaling pathway (…). P =0.005). Furthermore, knockdown of WDR74 significantly downregulated several key genes in the JAK-STAT pathway, including IL11, IL6ST, CDKN1A, and MCL1. Figure 7 ).

[0071] Furthermore, we analyzed the correlation between JAK-STAT pathway-related genes and WDR74 gene expression levels using transcriptomic data from clinical samples of 155 ESCC patients. The results showed that the expression of WDR74 was significantly positively correlated with the expression of five key oncogenes in the JAK-STAT pathway: CDKN1A, IL11, BCL2L1, STAT3, and EGFR, while the expression of one key inhibitor, SOCS2, was significantly negatively correlated with WDR74 expression. Figure 8We also used qRT-PCR to detect the changes in the mRNA levels of key JAK-STAT genes EGFR, MCL1, and IL6ST after WDR74 knockdown. The results showed that knockdown of WDR74 expression in KYSE150 cells significantly reduced the mRNA expression levels of EGFR, MCL1, and IL6ST. Figure 9 The trend of change was consistent with the RNA-seq results. These results indicate that WDR74 can induce changes in the expression levels of several key molecules in the JAK-STAT pathway.

[0072] 4. WDR74 binds to the protein ALYREF via m 5 C-modification enhances the stability of EGFR mRNA, a key gene in the JAK-STAT pathway: To further explore the molecular mechanism by which WDR74 exerts its oncogenic function through binding to specific proteins, this invention screened and identified potential binding proteins of WDR74 using Co-IP combined with mass spectrometry. First, HEK-293T cells were transfected with the empty vector plasmid pcDNA3.1-FLAG as an Empty control group; the WDR74 overexpressing plasmid pcDNA3.1-WDR74-FLAG was transfected as the WDR74 experimental group. Total protein was extracted from each treatment group, and Co-IP experiments were performed using a FLAG antibody. Electrophoretic separation showed differentially expressed protein bands between 25KD and 35KD. Subsequently, to identify the differentially expressed protein, gel excision and mass spectrometry analysis were performed. The results showed that the differentially expressed protein was likely the 27KD Aly / REF export factor (ALYREF), which had the highest protein score and a sequence coverage of 29% in the mass spectrometry results. This suggests that ALYREF may be a potential binding protein of WDR74. Further Co-IP validation experiments showed that ALYREF protein was specifically detected in the immunoprecipitates of the WDR74-FLAG experimental group, while it was not detected in the IgG control group. Figure 10 This confirms that ALYREF is a binding protein of WDR74. Furthermore, analysis of transcriptome sequencing data from 155 pairs of ESCC patient cancer and adjacent normal tissue samples revealed that ALYREF expression was significantly higher in tumor tissue than in adjacent normal tissue. P <0.001)( Figure 10 ).

[0073] Furthermore, given that ALYREF is an m 5 C RNA modification recognition proteins can specifically recognize m through the lysine residue K171. 5C modification regulates the stability of target transcript mRNA, thereby participating in molecular regulatory processes related to tumorigenesis and development. This invention first studies the mRNA expression of KYSE150 cells from the Gene Expression Omnibus (GEO) database. 5 cRNA immunoprecipitation sequencing (m 5 An analysis of the C-methylated RNA immunoprecipitation sequencing (MeRIP-seq) dataset (GSE249045) revealed a potential m-type gene in EGFR, a key gene in the JAK-STAT signaling pathway. 5 C-modification enrichment peaks suggest that EGFR may be a potential target transcript for ALYREF. Figure 11 Based on the above analysis results, this invention synthesizes a compound containing m 5 The EGFR 3′UTR fragment containing the C potential modification site (CCCCC) and its upstream and downstream ±50 bp sequences was cloned into the pGL3-promoter luciferase reporter gene vector to construct a gene containing the wild-type EGFR 3′UTR sequence (pGL3promoter-EGFR-3'UTR-WT). Figure 12 The report plasmid (abbreviated as WT) is used to destroy potential m 5 At site C, the CCCCC sequence is mutated to GAGAG, constructing the corresponding mutant (pGL3 promoter-EGFR-3'UTR-MUT). Figure 12 The EGFR-3′UTR-WT reporter plasmid is described in SEQ ID NO. 9: 5′-CCTAAAGGAAGGGCCTGGTGGGATCTACTTGGCACTCGCTGGGGGGCCACCCCCCAGTGCCACTCTCACTAGGCCTCTGATTGCACTTGTGTAGGATGAAGCTGG-3′; EGFR-3′UTR-WT reporter plasmid sequence (SEQ ID NO. 10): 5′-CCTAAAGGAAGGGCCTGGTGGGATCTACTTGGCACTCGCTGGGGGGCCACGAGAGAGTGCCACTCTCACTAGGCCTCTGATTGCACTTGTGTAGGATGAAGCTGG-3′; Dual-luciferase reporter gene activity assays were subsequently performed, and the results showed that in KYSE150 and KYSE450 cells, ALYREF overexpression significantly enhanced the luciferase activity of the wild-type EGFR 3′UTR construct. P <0.001); while when m 5After mutation at the C-modification site, the enhancing effect is significantly weakened. Figure 12 The above results indicate that ALYREF's regulation of EGFR transcripts depends on the m in its 3′UTR region. 5 C-modified sites.

[0074] Furthermore, qRT-PCR experiments showed that knocking down ALYREF significantly reduced EGFR expression levels in KYSE150 cells. P <0.01). Actinomycin D blocking assays further demonstrated that knockdown of ALYREF significantly reduced the stability of EGFR mRNA; while overexpression of ALYRF significantly enhanced the stability of EGFR mRNA. P <0.05)( Figure 13 This indicates that ALYREF participates in regulating the expression level of EGFR, a key gene in the JAK-STAT signaling pathway, by enhancing the stability of EGFR mRNA. Furthermore, this invention utilizes transcriptome data from esophageal cancer and normal esophageal tissues from the Gene Expression Profiling Interactive Analysis (GEPIA) database to analyze the expression correlation between WDR74 and EGFR, and between ALYREF and EGFR. The results show that the expression levels of both WDR74 and ALYREF are significantly positively correlated with EGFR. Figure 14 This suggests that EGFR may be jointly regulated by WDR74 and ALYREF.

[0075] 5. WDR74 regulates the apoptosis-related gene MCL1 through the transcription factor STAT3: Furthermore, previous studies have confirmed that p-STAT3, a key component in the JAK-STAT pathway, is the activated form of STAT3 after tyrosine phosphorylation. Tyrosine-phosphorylated STAT3 (p-STAT3) forms a dimer, regulating the expression of target genes and influencing cancer progression. Moreover, previous research has shown that EGFR, a key gene in the JAK-STAT3 pathway, can mediate STAT3 phosphorylation in a ligand-independent manner, thereby activating STAT3 phosphorylation and promoting tumor progression. Therefore, this invention hypothesizes that WDR74 may activate STAT3 phosphorylation through EGFR, thereby regulating its downstream target genes and promoting the development of ESCC. We first used Western blotting to detect changes in p-STAT3 protein levels in KYSE150 cells after WDR74 changes. The results showed that knocking down WDR74 expression significantly reduced p-STAT3 protein expression; overexpression of WDR74 significantly increased p-STAT3 protein expression. Figure 15This indicates that WDR74 can activate the phosphorylation of STAT3 protein.

[0076] Next, we further explored the specific molecular mechanism by which WDR74 influences the transcriptional regulation of downstream target genes through STAT3 phosphorylation, ultimately promoting the malignant phenotype of ESCC cells. We first discovered that the anti-apoptotic gene MCL1 is a downstream gene of the JAK-STAT pathway and is also present in the significantly differentially expressed gene set obtained from previous RNA-seq screening. Subsequently, we used the JASPAR database to analyze potential binding sites of the transcription factor STAT3 in the MCL1 promoter. The results showed two potential STAT3 transcription factor binding regions. To distinguish them, we named the chr1:150,579,717-150,579,570 sequence P1, and the chr1:150,580,002-150,579,911 sequence P2. Figure 16 Then, using the Cistrome Data Browser (http: / / cistrome.org / db / ), we analyzed the enrichment of STAT3 at P1 and P2 sites in HeLa-S3 cells and five types of basal-like breast cancer cells; and analyzed the enrichment of H3k4me3 signaling at P1 and P2 sites in KYSE150 cells. Figure 17 The results showed that STAT3 and H3K4me3 signals were enriched at both the P1 and P2 sites of the MCL1 promoter. This analysis suggests that the MCL1 promoter may be regulated by the transcription factor STAT3.

[0077] To further verify the binding effect of transcription factor STAT3 to the MCL1 promoter, we performed ChIP-qPCR experiments in KYSE150 cells targeting the two predicted STAT3 binding sites, P1 and P2. First, ChIP-qPCR primers were designed for the P1 and P2 sites to perform chromatin immunoprecipitation experiments with STAT3 antibodies. Simultaneously, IgG antibodies of the corresponding species were used as a control group for chromatin immunoprecipitation experiments. The results showed that in KYSE150 cells, the chromatin enrichment at the P1 and P2 sites of the MCL1 promoter was significantly higher in the STAT3 antibody-precipitated group compared to the control group. Figure 18 The above results indicate that the transcription factor STAT3 may regulate the MCL1 gene by binding to the promoter region of MCL1, ultimately inhibiting apoptosis and promoting tumor formation. In summary, this invention reveals that WDR74 can regulate the expression levels of EGFR and MCL1 genes by activating the JAK-STAT3 signaling pathway. Furthermore, the WDR74 protein specifically binds to ALYREF and, via ALYREF-mediated m… 5C modification participates in regulating the stability of EGFR mRNA, a key gene in the JAK-STAT pathway, ultimately activating STAT3 phosphorylation and regulating the downstream anti-apoptotic gene MCL1, thereby inhibiting apoptosis and promoting the development of ESCC. These results indicate that WDR74 and ALYREF have potential application value as anti-tumor molecular targets for ESCC.

[0078] In this invention, we analyzed WDR74 expression data from cancerous and adjacent tissues of 155 ESCC patients. We found that WDR74 expression levels in ESCC tumor tissues were significantly higher than in adjacent tissues, and patients with high WDR74 expression in tumor tissues had poorer survival prognoses, suggesting that WDR74 plays a pro-cancer role in ESCC and has potential application value as a drug target for ESCC. Furthermore, this invention confirmed the biological effects of WDR74 in significantly promoting the malignant phenotype of ESCC cells and inhibiting ESCC cell apoptosis through in vitro and in vivo functional experiments. We also explored the specific molecular mechanism by which WDR74 exerts its effect in ESCC using transcriptome sequencing and bioinformatics methods, finding that WDR74 promotes the expression of target genes EGFR and MCL1 by activating the JAK-STAT pathway. Simultaneously, Co-IP experiments showed that ALYREF is a binding protein of WDR74, and ALYREF expression levels in ESCC tumor tissues were also significantly higher than in adjacent tissues. Moreover, ALYREF-mediated m 5 C modification can regulate the mRNA stability of EGFR, a key gene in the JAK-STAT pathway, ultimately activating STAT3 phosphorylation, which in turn regulates the anti-apoptotic gene MCL1, promoting the occurrence and development of ESCC. This invention provides important evidence for WDR74 and ALYREF as potential drug targets for ESCC intervention.

[0079] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of reagents that inhibit the expression of the WDR74 gene and / or ALYREF gene in the preparation of drugs for the treatment of esophageal squamous cell carcinoma.

2. The application according to claim 1, characterized in that, The reagents are small interfering RNAs. The sequence of the small interfering RNA that inhibits the expression of the WDR74 gene is shown in SEQ ID NO. 1, and the sequence of the small interfering RNA that inhibits the expression of the ALYREF gene is shown in SEQ ID NO.

2.

3. Application of WDR74 protein and / or ALYREF protein as therapeutic targets for esophageal squamous cell carcinoma.

4. Use of inhibitors of WDR74 protein and / or ALYREF protein in the preparation of drugs for the treatment of esophageal squamous cell carcinoma.

5. The use according to claim 4, characterized in that, The inhibitors of the WDR74 protein and / or ALYREF protein are antibodies against the WDR74 protein and / or antibodies against the ALYREF protein.

6. Use of inhibitors of the WDR74 gene and / or ALYREF gene in the preparation of drugs for the treatment of esophageal squamous cell carcinoma.

7. The use according to claim 6, characterized in that, The inhibitors of the WDR74 and ALYREF genes are small interfering RNAs.

8. A pharmaceutical composition for treating esophageal squamous cell carcinoma, characterized in that, It includes a pharmaceutically acceptable carrier and an effective amount of an active ingredient, said active ingredient being an antibody against WDR74 protein and / or an antibody against ALYREF protein, or a small interfering RNA with a sequence as shown in SEQ ID NO. 1 and / or as shown in SEQ ID NO.

2.

9. An anticancer drug for treating esophageal squamous cell carcinoma, characterized in that, Its active ingredient is an inhibitor of the WDR74 gene and / or the ALYREF gene, or an inhibitor of the WDR74 protein and / or the ALYREF protein.

10. A kit for diagnosing esophageal squamous cell carcinoma or assessing its prognosis, characterized in that, This includes reagents for detecting the expression levels of the WDR74 gene and / or ALYREF gene in subject samples.