Application of GABRD gene expression inhibitor in preparation of medicine for inhibiting lung metastasis of liver cancer cells

By targeting and knocking out the GABRD gene using the CRISPR-Cas9 tool, a drug to inhibit lung metastasis of liver cancer cells was prepared, solving the problem of inhibiting lung metastasis of liver cancer cells in existing technologies and achieving significant inhibition of liver cancer cell metastasis to the lungs and a reduction in the number of tumor lesions.

CN122005869APending Publication Date: 2026-05-12THE SECOND AFFILIATED HOSPITAL ARMY MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
THE SECOND AFFILIATED HOSPITAL ARMY MEDICAL UNIV
Filing Date
2026-03-26
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Current technologies are insufficient to effectively inhibit lung metastasis of liver cancer cells. Targeted drugs have limited applicability, significant individual differences in treatment efficacy, and side effects, thus failing to meet clinical needs.

Method used

The GABRD gene is knocked out or knocked down using the CRISPR-Cas9 tool. Drugs are prepared by targeting GABRD gene expression inhibitors. The sgRNA sequence of the CRISPR-Cas9 tool is SEQ ID NO:1. The dosage form is injection or powder. Gene editing is achieved using recombinant expression vectors or recombinant engineered bacteria to inhibit lung metastasis of liver cancer cells.

Benefits of technology

It significantly inhibits the metastasis of liver cancer cells to the lungs, reduces the number of metastatic lesions, decreases the migration and invasion capabilities of tumor cells, and provides a lasting therapeutic effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122005869A_ABST
    Figure CN122005869A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of a GABRD gene expression inhibitor in preparation of a medicine for inhibiting lung metastasis of liver cancer cells. The GABRD gene expression inhibitor is a CRISPR-Cas9 tool for targeted knockout or knockdown of a GABRD gene and a related biological reagent, and a sense strand sequence of sgRNA of the CRISPR-Cas9 tool is as shown in SEQ ID NO: 1. Experiments prove that lung metastasis of liver cancer cells can be remarkably inhibited by inhibiting expression of the GABRD gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically involving GABRD Application of gene expression inhibitors in the preparation of drugs that inhibit lung metastasis of liver cancer cells. Background Technology

[0002] Liver cancer is one of the leading causes of cancer-related morbidity and mortality worldwide, with hepatocellular carcinoma accounting for the highest proportion. Due to the insidious nature of early symptoms, most patients are diagnosed at an advanced stage, accompanied by tumor invasion and distant metastasis, severely threatening their lives and health. The lungs are the most common target organ for distant metastasis of liver cancer, and lung metastasis is one of the main reasons for treatment failure and poor prognosis. Clinical data show that the 5-year survival rate of liver cancer patients with lung metastasis is significantly reduced. Therefore, developing treatment strategies and drugs that can effectively inhibit lung metastasis of liver cancer cells has significant clinical and social value for improving the prognosis and survival rate of liver cancer patients.

[0003] Currently, treatment options for liver cancer metastasis mainly include surgical resection of metastatic lesions, radiotherapy, chemotherapy, targeted therapy, and immunotherapy. However, surgical resection is only suitable for a small number of patients with localized metastatic lesions, and most patients with advanced metastases cannot tolerate it. Radiotherapy and chemotherapy have problems such as poor targeting and strong side effects, easily causing damage to normal tissues, and long-term use can easily lead to drug resistance in tumor cells. Although existing targeted drugs and immunotherapies have shown efficacy in some patients, they still have shortcomings such as limited applicable populations and large individual differences in treatment effects, making it difficult to meet the clinical needs for liver cancer metastasis treatment. Therefore, in-depth research into the molecular mechanisms of liver cancer cell lung metastasis, identification of key regulatory genes, and development of targeted intervention methods have become important directions in the current field of liver cancer research.

[0004] The GABRD gene encodes the delta subunit of the γ-aminobutyric acid (GABA) type A receptor, which belongs to the ligand-gated ion channel family and is mainly involved in the regulation of inhibitory neurotransmission in the central nervous system. In recent years, with the deepening of tumor molecular biology research, it has been discovered that some neurotransmitter receptor-related genes play abnormal regulatory roles in tumor development and progression. However, the association between the GABRD gene and hepatocellular carcinoma (HCC) metastasis has not been clearly reported. Currently, there is no research on the regulation of lung metastasis of HCC by inhibiting GABRD gene expression, nor have any drugs for treating HCC lung metastasis based on inhibiting GABRD gene expression been developed. Therefore, exploring the role of the GABRD gene in HCC lung metastasis, developing GABRD gene expression inhibitors, and applying them to the preparation of drugs for treating HCC lung metastasis has significant research value and clinical application prospects. Summary of the Invention

[0005] Based on this, the purpose of this invention is to provide GABRD Application of gene expression inhibitors in the preparation of drugs that inhibit lung metastasis of liver cancer cells.

[0006] To achieve the above objectives, the present invention can adopt the following technical solutions: This invention provides one aspect GABRD The application of gene expression inhibitors in the preparation of drugs that inhibit lung metastasis of liver cancer cells. GABRD Gene expression inhibitors are targeted knockouts or knockdowns. GABRD The CRISPR-Cas9 tool for the gene, wherein the positive strand sequence of the sgRNA of the CRISPR-Cas9 tool is shown in SEQ ID NO:1.

[0007] Preferably, in the above applications, the dosage form of the drug is an injection solution or a powder.

[0008] Another aspect of the present invention provides GABRD The application of gene expression inhibitors in the preparation of drugs that inhibit lung metastasis of liver cancer cells. GABRD Gene expression inhibitors are targeted inhibitors GABRD A recombinant expression vector for gene expression, the recombinant expression vector containing a CRISPR-Cas9 tool, the sense strand sequence of the sgRNA of the RISPR-Cas9 tool is shown in SEQ ID NO:1.

[0009] Preferably, in the above applications, the recombinant expression vector is obtained by embedding sgRNA into the lentiCRISPRv2 plasmid vector.

[0010] Preferably, in the above applications, the dosage form of the drug is an injection solution or a powder.

[0011] In another aspect, the present invention provides GABRD The application of gene expression inhibitors in the preparation of drugs to inhibit lung metastasis of liver cancer cells; GABRD gene expression inhibitors are targeted inhibitors. GABRD The recombinant engineered bacteria expressing the gene were obtained by transducing the recombinant expression vector into the engineered bacteria. The recombinant expression vector contained a CRISPR-Cas9 tool, and the sense strand sequence of the sgRNA of the CRISPR-Cas9 tool is shown in SEQ ID NO:1.

[0012] Preferably, in the above applications, the engineered bacteria is Escherichia coli.

[0013] Preferably, in the above applications, the dosage form of the drug is an injection solution or a powder.

[0014] In another aspect, this invention provides a drug for inhibiting lung metastasis of liver cancer cells, the drug comprising targeted knockout or knockdown. GABRDThe CRISPR-Cas9 tool for the gene and related biological reagents, the positive strand sequence of the sgRNA of the CRISPR-Cas9 tool is shown in SEQ ID NO:1; wherein, the related biological reagents are recombinant expression vectors or recombinant engineered bacteria; the recombinant expression vector contains the CRISPR-Cas9 tool; the recombinant engineered bacteria are obtained by transducing the recombinant expression vector into the engineered bacteria.

[0015] Preferably, in the above-mentioned drugs, the recombinant expression vector is obtained by embedding sgRNA into the lentiCRISPRv2 plasmid vector.

[0016] Preferably, the engineered bacteria in the above-mentioned drug is Escherichia coli.

[0017] Preferably, the dosage form of the above-mentioned drug is an injection solution or a powder.

[0018] The beneficial effects of this invention include at least the following: (1) The present invention showed through in vivo fluorescence imaging experiments in mice that the lung region of the NTC group (control group) mice had obvious blue-green fluorescence signals, indicating the presence of fluorescently labeled tumor cells in this area, indicating that the tumor cells had metastasized; while the GABRD-KO group ( GABRD The fluorescence signal in the lung region of the gene knockout mice was very weak, with almost no obvious fluorescent bright spots, indicating that the tumor cells did not metastasize significantly. (2) The present invention shows that the fluorescence intensity of the NTC group mice increased continuously over time, reaching the highest value at week 6; while the fluorescence intensity of the GABRD-KO group mice increased more gradually and remained lower than that of the NTC group; and at week 6, the difference in fluorescence intensity between the two groups was statistically significant (P<0.05). (3) The present invention shows that by observing the HE staining of lung tissue, multiple tumor metastatic foci (orange-red dotted areas) marked by red dashed boxes can be seen in the NTC group. The cells in these areas are abnormal in morphology and densely arranged, which are lesions formed by the metastasis of tumor cells to the lungs. In contrast, the number of tumor metastatic foci in the lung tissue of the GABRD-KO group is significantly reduced, and there are fewer abnormal areas marked by red dashed boxes, indicating that the metastasis of tumor cells to the lungs is significantly inhibited after gene knockout. (4) The present invention showed that the number of lung metastases (nodules) in mice was approximately 12.6 in the NTC group and approximately 5.8 in the GABRD-KO group, which was significantly lower than that in the NTC group (p<0.0004), indicating that Gabrd-KO inhibited lung metastasis of HCC. Attached Figure Description

[0019] Figure 1Western blotting was used to verify the expression of Gabrd protein in wild-type and gene knockout cell lines; Figure 2 In vivo fluorescence of mice in different groups; Figure 3 The changes in fluorescence intensity and time in different groups of mice; Figure 4 HE staining of lung tissue sections from different groups of mice; Figure 5 The number of lung metastases in different groups of mice. Detailed Implementation

[0020] The embodiments described are provided to better illustrate the present invention, but are not intended to limit the scope of the invention to the embodiments described. Therefore, non-essential improvements and adjustments made to the embodiments by those skilled in the art based on the above description are still within the scope of protection of the present invention.

[0021] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit this disclosure. Singular expressions include plural expressions unless they have a distinct meaning in the context. As used herein, it should be understood that terms such as “comprising,” “having,” “including,” are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials, or combinations thereof. The terminology of the invention is disclosed in the specification and is not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials, or combinations thereof may be present or added. As used herein, “ / ” may be interpreted as “and” or “or,” depending on the context.

[0022] In a first aspect, embodiments of the present invention provide a GABRD The application of gene expression inhibitors in the preparation of drugs that inhibit lung metastasis of liver cancer cells. GABRD Gene expression inhibitors are targeted knockouts or knockdowns. GABRD The CRISPR-Cas9 tool for the gene, wherein the positive strand sequence of the sgRNA of the CRISPR-Cas9 tool is shown in SEQ ID NO:1.

[0023] It should be noted that, through screening and verification using targeted gene editing technology, this invention has found that the CRISPR-Cas9 tool mediated by the aforementioned specific sgRNA can specifically recognize the target sequence of the GABRD gene, and achieve precise knockout or knockdown of the GABRD gene under the action of Cas9 nuclease, thereby blocking the functional expression of the GABRD gene. Further experiments have confirmed that after the expression of the GABRD gene is inhibited, the migration and invasion ability of liver cancer cells is significantly reduced, and the metastasis process to lung tissue can be effectively blocked. Therefore, this CRISPR-Cas9 tool can be used to prepare drugs that inhibit the lung metastasis of liver cancer cells.

[0024] In some specific examples, the dosage form of the drug in the above applications is an injection or a powder.

[0025] It should be noted that injectable solutions can be delivered directly to the lesion or blood circulation via intravenous injection or local injection, and have a rapid onset of action; powders can be dissolved and then injected, or further processed with excipients, and are convenient to store and transport. Both dosage forms meet the routine requirements of clinical medication, and their preparation methods are well known in the field. For example, injectable solutions can be prepared by mixing the active ingredient with pharmaceutically acceptable carriers such as physiological saline or buffer solution and then filtering and sterilizing, while powders can be obtained by removing moisture and adding stabilizers through freeze drying, spray drying, or other techniques.

[0026] Secondly, embodiments of the present invention provide a GABRD The application of gene expression inhibitors in the preparation of drugs that inhibit lung metastasis of liver cancer cells. GABRD Gene expression inhibitors are targeted inhibitors GABRD A recombinant expression vector for gene expression, the recombinant expression vector containing a CRISPR-Cas9 tool, the sense strand sequence of the sgRNA of the RISPR-Cas9 tool is shown in SEQ ID NO:1.

[0027] It should be noted that the recombinant expression vector contains the aforementioned CRISPR-Cas9 tool (sgRNA positive strand sequence as shown in SEQ ID NO:1), that is, the sgRNA coding sequence is inserted into the vector backbone through molecular cloning technology, so that the vector can express functional CRISPR-Cas9 components after entering the cell, thereby exerting a gene repression effect.

[0028] In some specific examples, in the above applications, the recombinant expression vector was obtained by embedding sgRNA into the lentiCRISPRv2 plasmid vector.

[0029] It should be noted that the lentiCRISPRv2 plasmid vector is a commonly used gene editing vector in this field, which has the characteristics of efficient transfection, stable integration and continuous expression of exogenous sequences. After embedding sgRNA into this vector, the delivery efficiency and persistence of CRISPR-Cas9 tools in liver cancer cells can be significantly improved, and the anti-metastatic effect of drugs can be enhanced.

[0030] In some specific examples, the dosage form of the drug in the above applications is an injection or a powder.

[0031] It should be noted that injectable solutions can be delivered directly to the lesion or blood circulation via intravenous injection or local injection, and have a rapid onset of action; powders can be dissolved and then injected, or further processed with excipients, and are convenient to store and transport. Both dosage forms meet the routine requirements of clinical medication, and their preparation methods are well known in the field. For example, injectable solutions can be prepared by mixing the active ingredient with pharmaceutically acceptable carriers such as physiological saline or buffer solution and then filtering and sterilizing, while powders can be obtained by removing moisture and adding stabilizers through freeze drying, spray drying, or other techniques.

[0032] Thirdly, embodiments of the present invention provide GABRD The application of gene expression inhibitors in the preparation of drugs to inhibit lung metastasis of liver cancer cells; GABRD gene expression inhibitors are targeted inhibitors. GABRD The recombinant engineered bacteria expressing the gene were obtained by transducing the recombinant expression vector into the engineered bacteria. The recombinant expression vector contained a CRISPR-Cas9 tool, and the sense strand sequence of the sgRNA of the RISPR-Cas9 tool is shown in SEQ ID NO:1.

[0033] It should be noted that the recombinant engineered bacteria were obtained by transducing the aforementioned recombinant expression vector (containing the CRISPR-Cas9 tool, and the sgRNA positive strand sequence as shown in SEQ ID NO:1) into the engineered bacteria. That is, the recombinant expression vector was introduced into the engineered bacterial host through transformation, transduction and other methods, so that the engineered bacteria could mass-produce or deliver the recombinant expression vector.

[0034] In some specific examples, the engineered bacteria in the above applications are Escherichia coli.

[0035] It should be noted that Escherichia coli has the advantages of low culture cost, fast proliferation rate and strong capacity to accommodate exogenous vectors, making it the preferred engineered bacteria for large-scale preparation of recombinant vectors in this field. Recombinant engineered bacteria constructed using Escherichia coli as a host can efficiently produce target recombinant expression vectors, providing support for the large-scale preparation of drugs.

[0036] In some specific examples, the dosage form of the drug in the above applications is an injection or a powder.

[0037] It should be noted that injectable solutions can be delivered directly to the lesion or blood circulation via intravenous injection or local injection, and have a rapid onset of action; powders can be dissolved and then injected, or further processed with excipients, and are convenient to store and transport. Both dosage forms meet the routine requirements of clinical medication, and their preparation methods are well known in the field. For example, injectable solutions can be prepared by mixing the active ingredient with pharmaceutically acceptable carriers such as physiological saline or buffer solution and then filtering and sterilizing, while powders can be obtained by removing moisture and adding stabilizers through freeze drying, spray drying, or other techniques.

[0038] Fourthly, embodiments of the present invention provide a drug for inhibiting lung metastasis of liver cancer cells, the drug comprising targeted knockout or knockdown. GABRD The CRISPR-Cas9 tool for the gene and related biological reagents, the positive strand sequence of the sgRNA of the CRISPR-Cas9 tool is shown in SEQ ID NO:1; wherein, the related biological reagents are recombinant expression vectors or recombinant engineered bacteria; the recombinant expression vector contains the CRISPR-Cas9 tool; the recombinant engineered bacteria are obtained by transducing the recombinant expression vector into the engineered bacteria.

[0039] In some specific examples, the recombinant expression vector in the aforementioned drugs is obtained by embedding sgRNA into the lentiCRISPRv2 plasmid vector.

[0040] It should be noted that this limitation is consistent with the aforementioned preferred scheme for recombinant expression vectors. By using the mature lentiCRISPRv2 vector, the efficacy and stability of the active ingredients in the drug are ensured, thus guaranteeing the drug's therapeutic effect.

[0041] In some specific examples, the engineered bacteria in the aforementioned drugs are Escherichia coli.

[0042] It should be noted that Escherichia coli, as a commonly used engineered bacterium, can achieve efficient mass production of recombinant expression vectors, and its biosafety has been widely verified, making it a suitable host type for recombinant engineered bacteria in drugs.

[0043] In some specific examples, the dosage form of the aforementioned drugs is either an injection solution or a powder.

[0044] It should be noted that the choice of drug dosage form can be adjusted according to the clinical application scenario. Injectable preparations are suitable for treatment needs with rapid onset of action, while powders are suitable for scenarios requiring long-term storage or flexible preparation. The selection of excipients and preparation processes for both dosage forms are well known to those skilled in the art. For example, when preparing powders, stabilizers such as mannitol and sucrose can be added to prevent degradation of active ingredients, while when preparing injectable preparations, buffers can be added to maintain the pH stability of the system.

[0045] To better understand the present invention, specific examples are provided below to further illustrate the content of the present invention, but the content of the present invention is not limited to the examples below.

[0046] Example 1

[0047] (I) Construction and validation of lentiCRISPRv2 recombinant expression vector

[0048] (1) Construction of linearized lentiCRISPRv2 expression vector

[0049] (1-1) Obtaining the sgRNA sequence

[0050] According to mice Gabrd Gene targeting sequence design targets the sgRNA sequence of the GABRD gene; among which, Gabrd The gene's target sequence (SEQ ID NO:3) is: 5'-CCGGTGGCTCTGAGATCAGT-3'; Target GABRD The sgRNA sequence of the gene is as follows: Chain of Justice (SEQ ID NO:1): CACCCCGGTGGCTCTGAGATCAGT; Reverse complementary strand (SEQ ID NO:2): AAACACTGATCTCAGAGCCACCGG; Oligochain dilution: Dilute the synthesized dry oligochain powder to 100 μmol / L stock solution with TE buffer / enzyme-free ddH2O and aliquot and store at -20℃; dilute the working solution to 10 μmol / L.

[0051] Annealing of (1-2) sgRNA oligonucleotide chains

[0052] The sgRNA oligonucleotide chains were annealed, and the annealed double-stranded products were diluted 1:20 with enzyme-free ddH2O (working concentration 25 nmol / L) and stored at -20℃ for subsequent ligation. The annealing system and annealing program are shown below: Annealing system (20 μL): 2 μL 10× annealing buffer, 5 μL 10 μmol / L sense strand, 5 μL 10 μmol / L antisense strand, 8 μL enzyme-free ddH2O; Annealing procedure (executed by PCR instrument, with the heating cap on at 105℃ throughout): denature at 95℃ for 5 min → slowly cool to 25℃ at a rate of 0.1℃ / s → keep warm at 4℃ for later use.

[0053] (1-3) Enzyme digestion of linearized lentiCRISPRv2 plasmid vector

[0054] 1) Enzyme digestion procedure: After mixing the enzyme digestion system, incubate at 37℃ in a water bath / metal bath for 1.5h → After incubation, heat at 65℃ for 20min to inactivate BsmBI → briefly centrifuge (12000rpm, 1min) and collect the liquid at the bottom of the tube; The enzyme digestion system is as follows: Modified lentiCRISPRv2 plasmid (the modified lentiCRISPRv2 plasmid contains the SpCas9 coding region), 10μL; 10×NEB Buffer 3.1, 5μL; 100×BSA, 0.5μL; BsmBI (10U / μL), 2μL; Enzyme-free ddH2O, 32.5μL; 2) Agarose gel electrophoresis separation: Gel preparation: 1% agarose (1g agarose + 100mL 1×TAE), heat to dissolve and cool to about 50℃, add nucleic acid dye (5μL per 100mL), pour the gel and insert the comb; Sample loading: Load all enzyme digestion products and DNA marker simultaneously; Electrophoresis parameters: 1×TAE buffer, 120V constant voltage electrophoresis for 30min; Band identification: Observe under the gel imaging system, the circular plasmid band of lentiCRISPRv2 plasmid (about 10kb) is higher than the linearized band, cut off the linearized single target band (about 10kb), avoid cutting the circular band and impurities; 4) Gel extraction and purification of linearized vector: Follow the instructions of the Qiagen Gel Extraction Kit. Key parameters: Melting the gel: Add Binding Buffer from the kit and incubate at 55℃~60℃ until the gel is completely melted; Column washing: Wash twice with Buffer WB, centrifuge at 8000rpm for 1min; Elution: Add 30μL of enzyme-free ddH2O / Elution Buffer (pH 8.0), let stand at room temperature for 2min, then centrifuge at 12000rpm for 2min and collect the eluent; Concentration detection: Detect the concentration of linearized vector after elution using NanoDrop. The concentration should be ≥30ng / μL. Store at -20℃ for later use.

[0055] (1-4) Connection reaction

[0056] After mixing the ligation reaction mixture, place it in a constant temperature metal bath and ligate overnight at 16°C (long fragment vector + short fragment insert; overnight incubation at low temperature can improve ligation specificity). After ligation, inactivate the T4 ligase by incubating in a 65°C water bath for 10 min, and store at 4°C for a short period (≤24 h). The ligation reaction mixture (10 μL, prepared on ice) is shown below: Linearized lentiCRISPRv2 vector after gel recovery, 1 μL; 10-fold diluted double-stranded sgRNA, 3 μL; 10×T4 DNA Ligase Buffer, 1 μL; T4 DNA ligase (400 U / μL), 0.5 μL; enzyme-free ddH2O, 4.5 μL.

[0057] (2) Obtaining the recombinant lentiCRISPRv2 expression vector

[0058] (2-1) Obtaining recombinant Escherichia coli competent cells

[0059] 1) Take 50 μL of DH5α competent cells into a 1.5 mL enzyme-free centrifuge tube, add 5 μL of ligation product, gently tap the tube to mix, and incubate on ice for 30 min; 2) Heat shock in a constant temperature water bath at 42℃ for 90 seconds, then immediately transfer to an ice bath and cool for 2 minutes; 3) Add 450 μL of SOC medium to the tube and incubate at 37°C and 220 rpm for 1 hour to allow the bacteria to recover and express the resistance gene; 4) After resuscitation, centrifuge at 5000 rpm for 5 min, discard 400 μL of supernatant, and keep 100 μL of supernatant to resuspend the bacterial pellet for later use.

[0060] (2-2) Screening of positive clones

[0061] 1) Using a sterile spreader, spread 100 μL of resuspended bacterial solution evenly on a 50 μg / mL kanamycin LB agar plate and incubate upside down in a 37°C incubator for 16 h. 2) Pick 10 single colonies from the plate and inoculate them into 5 mL of LB liquid medium containing 50 μg / mL kanamycin. Incubate at 37°C and 220 rpm for 16 h. 3) Take 1.5 mL of bacterial culture, extract plasmid using a plasmid mini-prep kit, and detect the concentration using NanoDrop (≥20 ng / μL). 4) PCR identification: PCR is performed using sgRNA insertion verification primers. A positive clone is indicated by a band of approximately 200 bp, while no band is indicated by a negative clone. 5) PCR-positive clones are sent to a sequencing company for Sanger sequencing (sequencing primers are lentiCRISPRv2-F). The sequencing results are compared with the sgRNA target sequence. If they match completely, they are considered as the final positive clones.

[0062] (2-3) Expanded culture

[0063] Take 1 mL of positive clone bacterial suspension and inoculate it into 500 mL of LB liquid medium containing 50 μg / mL kanamycin. Incubate at 37℃ and 220 rpm for 16 h (until the bacterial suspension OD600 = 1.0-1.2). Centrifuge the bacterial suspension at 4℃ and 8000 rpm for 10 min, collect the bacterial pellet, and extract the plasmid according to the instructions of the endotoxin-free plasmid extraction kit. Elute the plasmid with 500 μL of enzyme-free ultrapure water and detect it with NanoDrop: concentration ≥1 μg / μL, A260 / A280 = 1.8-2.0, A260 / A230 ≥2.0 (no endotoxin and salt contamination).

[0064] (3) Functional validation of recombinant lentiCRISPRv2 expression vector

[0065] 1) Plate seeding: 293T cells were seeded into 6-well plates at a density of 50%–60%; 2) Transfection: Using Lipofectamine 3000 transfection reagent, 2.5 μg of recombinant plasmid was transfected into cells according to the instructions; an empty vector control was set up at the same time. 3) Culture: Collect cells after 72 hours; 4) Detection: Cas9 protein expression: Total cell protein was extracted and subjected to Western blotting; the anti-Cas9 antibody (Mouse anti-Cas9) was used for detection, and a specific band was seen at 160kDa, proving that Cas9 was expressed normally; 5) Verification of cutting efficiency: 293T cells were collected 72 hours after transfection, genomic DNA was extracted, PCR products were directly subjected to Sanger sequencing and mutation efficiency was analyzed using online sequencing.

[0066] (II) Screening and identification of Gabrd stable knockout Hepa1-6 cell lines

[0067] (1) Lentiviral infection of Hepa1-6 cells

[0068] 1) Cell plating: Hepa1-6 cells (ATCCCRL-1830) in logarithmic growth phase were digested with trypsin and counted; cells were then plated at 2×10⁻⁶ cells per cell line. 5 Cells were seeded at a density of 10% per well in 6-well plates, and 2 mL of complete culture medium (DMEM (high glucose) + 10% FBS + 1% Penicillin / Streptomycin) was added. The plates were then gently shaken in a cross-shaped manner to mix. The plates were incubated at 37°C in a 5% CO2 incubator for 24 hours, until the cell confluence reached 50%–60% as observed under a microscope. 2) Infection preparation: Virus volume (μL) = (MOI × cell number) / virus titer (TU / μL); approximately 4 × 10⁶ cells per well for a 6-well plate. 5 One, MOI=10, titer 1×10 8TU / mL, viral volume = (10 × 4 × 10) 5 ) / 1×10 5 =40μL; 3) Infection: Discard the old 1.5 mL culture medium and prepare the infection mixture: Take 1.5 mL of fresh complete culture medium + the calculated lentivirus solution + Polybrene (final concentration 8 μg / mL); gently add the mixture dropwise to each well and shake well in a cross shape; 4) Enhancement: Place the 6-well plate in a centrifuge and centrifuge at 800×g for 30 minutes (room temperature). Aspirate the supernatant and add 2 mL of fresh culture medium (containing 8 μg / mL Polybrene). 5) Incubation: Continue incubation at 37℃ with 5% CO2; 6) Change the medium: 24 hours after infection, aspirate the virus-containing culture medium, wash once with PBS, and add 2 mL of fresh complete culture medium.

[0069] (2) Screening of stable knockout cell lines

[0070] 48 hours after infection, puromycin was added to a final concentration of 2 μg / mL for selection (the lentiCRISPRv2 recombinant expression vector carries the puromycin resistance gene). The drug-containing medium was changed every 3 days, and the selection was continued for 14 days until the blank control group (Hepa1-6 cells that were not infected with the virus) died completely. The surviving cells were the candidate Gabrd stable knockout cell lines.

[0071] (3) Identification of Gabrd knockout efficiency

[0072] Genomic-level identification: Genomic DNA was extracted from candidate cell lines, and specific primers were designed upstream and downstream of the sgRNA target region (upstream (SEQ ID NO:4): 5'-TGGCTGCTGCTGCTGTTTAT-3'; downstream (SEQ ID NO:5): 5'-CAGAGCAGCAGCAGCAGTAA-3'). The target fragment was amplified by PCR, and the amplification products were detected by 1% agarose gel electrophoresis. If a band of abnormal size compared with the wild type appeared (indicating gene fragment deletion), or if frameshift mutations or base insertions / deletions were verified by Sanger sequencing, it indicates that double-stranded sgRNA successfully mediated Gabrd gene editing.

[0073] Protein level identification: Gabrd protein expression was verified by Western blotting. Candidate cells and wild-type Hepa1-6 cells were collected, total protein was extracted and its concentration was determined. After SDS-PAGE electrophoresis, transfer to a membrane, and blocking, Gabrd primary antibody (Abcam, catalog number: ab109004, 1:1000 dilution) was added and incubated overnight at 4°C. Secondary antibody was incubated at room temperature for 1 hour, followed by ECL imaging, with GAPDH as an internal control. If no Gabrd protein band was observed in candidate cells and a clear band was observed in wild-type cells, a stably Gabrd-knockout Hepa1-6 cell line (Hepa1-6-Gabrd-KO) was confirmed (see [link to relevant documentation]). Figure 1 ).

[0074] (III) Establishment of a mouse lung metastasis model by tail vein injection

[0075] (1) Collect Hepa1-6-Gabrd-KO cells in the logarithmic growth phase, wash twice with PBS, digest with trypsin, centrifuge, resuspend in serum-free DMEM medium, and adjust the cell concentration to 1×10⁻⁶. 6 Cells / 100μL, trypan blue staining to detect cell viability ≥95%, keep on ice for later use.

[0076] (2) Six to eight-week-old female C57BL / 6 mice (Vitollea, approved by the Experimental Animal Welfare and Ethics Committee of the Army Medical University of the Chinese People's Liberation Army) were selected and grouped after 1 week of acclimatization. They were randomly stratified according to body weight and divided into a control group (NTC) and an experimental group (GABRD-KO), with 6 mice in each group. The body weight data of each group are as follows: Control group (NTC, n=6): body weight range 19.2g~21.5g, average body weight 20.3g±0.8g; Experimental group (GABRD-KO, n=6): body weight range 19.0g~21.8g, average body weight 20.5±0.9g; Among them, the control group was injected with wild-type Hepa1-6 cells, and the experimental group was injected with Hepa1-6-Gabrd-KO cells. The specific steps are as follows: The mice were fixed in a restraint device, the dilated veins of the tail were wiped with 75% ethanol, and 100μL of cell suspension (containing 1×10⁻⁶ cells) was slowly injected into the mice with a 1mL syringe. 6 Mice were injected with one knockout cell and then hemostasis was achieved by applying pressure with a cotton ball for 30 seconds. The control group was injected with the same amount of wild-type cells. After the surgery, the mice were returned to the SPF-grade animal house for rearing.

[0077] Six weeks after injection, the fluorescence in each group of mice was observed by intravenous injection of luciferin sodium substrate (15 mg / mL, 200 μL / mouse) (IRES-Firefly luciferase kit). The results are as follows: Figure 2As shown (fluorescent areas are concentrated only in the tumor areas formed by lung metastasis), the results showed that the lung areas of the NTC group mice had obvious blue-green fluorescent signals, indicating the presence of fluorescently labeled tumor cells in this area, indicating that the tumor cells had metastasized; while the fluorescent signals in the lung areas of the GABRD-KO group mice were very weak, with almost no obvious fluorescent bright spots, indicating that the tumor cells had not metastasized significantly.

[0078] In addition, the changes in fluorescence intensity of lung metastases in the two groups of mice are as follows: Figure 3 As shown, the results indicated that the fluorescence intensity of the NTC group mice continued to increase over time, reaching its highest value at week 6; while the fluorescence intensity of the GABRD-KO group mice increased much more gradually and remained lower than that of the NTC group; and at week 6, the difference in fluorescence intensity between the two groups was statistically significant (P<0.05).

[0079] In addition, mice were euthanized by cervical dislocation 6 weeks after injection, lung tissue was isolated, and the number of metastatic nodules on the surface was observed. The lung tissue was fixed in 4% paraformaldehyde, embedded in paraffin, sectioned, stained with hematoxylin and eosin (HE), and the morphology and infiltration of metastatic lesions were observed under an optical microscope.

[0080] HE staining of lung tissue from the two groups of mice is as follows: Figure 4 As shown, the results indicate that the NTC group showed multiple tumor metastases (orange-red dotted areas) marked by red dashed boxes. These areas had abnormal cell morphology and dense arrangement, which were lesions formed by tumor cells metastasizing to the lungs. In contrast, the number of tumor metastases in the lung tissue of the GABRD-KO group was significantly reduced, and there were fewer abnormal areas marked by red dashed boxes, indicating that the metastasis of tumor cells to the lungs was significantly inhibited after gene knockout.

[0081] In addition, the statistical results of the number of lung metastases (nodules) in the two groups of mice are as follows: Figure 5 As shown, the results indicated that the number of metastatic lesions in the NTC group was 12.6±2.3, while the number of metastatic lesions in the GABRD-KO group was 5.8±1.3, which was significantly lower than that in the NTC group, indicating that GABRD-KO inhibited lung metastasis of HCC.

[0082] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. GABRD The application of gene expression inhibitors in the preparation of drugs that inhibit lung metastasis of liver cancer cells. GABRD Gene expression inhibitors are targeted knockouts or knockdowns. GABRD CRISPR-Cas9 tools for genes, among which, The positive strand sequence of the sgRNA of the CRISPR-Cas9 tool is shown in SEQ ID NO:

1.

2. GABRD The application of gene expression inhibitors in the preparation of drugs that inhibit lung metastasis of liver cancer cells. GABRD Gene expression inhibitors are targeted inhibitors GABRD A recombinant expression vector for gene expression, the recombinant expression vector containing a CRISPR-Cas9 tool, the sense strand sequence of the sgRNA of the RISPR-Cas9 tool is shown in SEQ ID NO:

1.

3. The application according to claim 2, characterized in that, The recombinant expression vector was obtained by embedding sgRNA into the lentiCRISPRv2 plasmid vector.

4. GABRD The application of gene expression inhibitors in the preparation of drugs to inhibit lung metastasis of liver cancer cells; GABRD gene expression inhibitors are targeted inhibitors. GABRD The recombinant engineered bacteria expressing the gene were obtained by transducing the recombinant expression vector into the engineered bacteria. The recombinant expression vector contained a CRISPR-Cas9 tool, and the sense strand sequence of the sgRNA of the RISPR-Cas9 tool is shown in SEQ ID NO:

1.

5. The application according to claim 4, characterized in that, The engineered bacteria is Escherichia coli.

6. The application according to any one of claims 1 to 5, characterized in that, The drug is available in either an injection solution or a powder form.

7. A drug for inhibiting lung metastasis of liver cancer cells, characterized in that, Drugs include targeted knockout or knockdown GABRD CRISPR-Cas9 tools for genes and related biological reagents; the positive strand sequence of the sgRNA of the CRISPR-Cas9 tool is shown in SEQ ID NO:

1. Among them, the relevant biological reagents are recombinant expression vectors or recombinant engineered bacteria; The recombinant expression vector includes the CRISPR-Cas9 tool; Recombinant engineered bacteria are obtained by transducing recombinant expression vectors into engineered bacteria.

8. The medicament according to claim 7, characterized in that, The recombinant expression vector was obtained by embedding sgRNA into the lentiCRISPRv2 plasmid vector.

9. The drug according to claim 7, characterized in that, The engineered bacteria is Escherichia coli.

10. The medicament according to any one of claims 7 to 9, characterized in that, The drug is available in either an injection solution or a powder form.