Type III recombinant human collagen peptide with heterologous expression of yeast and preparation method of type III recombinant human collagen peptide

Abstract

The invention discloses a yeast heterologous expression type III recombinant human collagen peptide and a preparation method thereof. The recombinant human collagen peptide comprises an amino acid sequence as shown in SEQ ID No. 1. The multi-copy tandem repeat peptide comprises a basic repeat unit as shown in SEQ ID No. 1. The preparation method comprises the following steps: connecting a nucleic acid molecule for coding the multi-copy tandem repeat peptide into a vector to construct a recombinant expression vector plasmid, and transferring the recombinant expression vector plasmid into a host cell to obtain a multi-copy positive transformant; culturing a multi-copy positive transformant, and performing induction treatment; performing centrifugation, microfiltration, ultrafiltration and purification on the fermentation liquor to obtain multi-copy tandem repeat peptide; carrying out enzymolysis on the multi-copy tandem repeat peptide, and then carrying out ultrafiltration, collection and purification. According to the invention, human collagen amino acid sequences are screened, and specific amino acids are replaced, so that the influence caused by glycosylation and non-specific combination of MMP-1 enzyme cutting sites and lysine sites is avoided, and the biological activity and the utilization degree are remarkably improved.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, specifically to a yeast heterologous expression of type III recombinant human collagen peptide and its preparation method, and particularly to a yeast heterologous expression of type III recombinant human collagen peptide, a multicopy tandem repeat peptide, a nucleic acid molecule, a recombinant expression vector plasmid containing at least one nucleic acid molecule, a host cell containing at least one nucleic acid molecule or a recombinant expression vector plasmid, and their preparation method. Background Technology

[0002] Collagen is a natural biopolymer that plays a vital role in the human body and has wide applications in various industries. As a crucial protein comprising one-third of the total protein in the human body, collagen is responsible for maintaining the structural integrity of tissues and organs, and is the basic building block of major organs such as skin, muscles, bones, and blood vessels. Furthermore, it plays a vital role in providing appropriate elasticity and strength, and is an indispensable component for maintaining normal skin function. Particularly in the dermis, collagen protein fibers exhibit extremely high resistance to stretching and tearing.

[0003] In the cosmetics industry, collagen is widely used due to its biocompatibility with the skin, as it is a natural component of the skin. As we age, the body's natural collagen production gradually decreases, which is why cosmetics and cosmeceutical manufacturers develop products that can replenish collagen both internally and externally. Furthermore, collagen has demonstrated its importance in promoting wound healing, a function that makes collagen-based biomaterials, such as collagen sponges, potential drug delivery systems.

[0004] Of the 29 known types of collagen, type III collagen, encoded by the COL3A1 gene in the human body, is a protein molecule with a long triple helical domain that requires three α1 chains to form. Type III collagen is distributed in a complex network in the alveolar interstitium, helping to maintain the flexibility and elasticity of lung tissue. Simultaneously, type III collagen is abundant in blood vessels, maintaining vascular strength and tension through its excellent mechanical properties, and to some extent providing nutrition to cells and promoting angiogenesis. Compared to other types, type III collagen is particularly effective in tissue damage repair, activation of coagulation mechanisms, and promotion of platelet aggregation.

[0005] Type III collagen, as a natural protein, is highly favored in the fields of biomedicine, food, and daily chemicals due to its strong biocompatibility, weak antigenicity, high affinity for skin, and controllable biodegradability. However, most collagen currently on the market is extracted from animal tissues, which not only easily triggers immune rejection reactions but also carries the risk of contamination by animal-derived pathogens (such as prions, foot-and-mouth disease virus, HIV, rabies virus, etc.) and excessive heavy metals, increasing the difficulty of product quality control.

[0006] With the development of genetic engineering and high-density fermentation technology, the production of collagen through biosynthesis has become a focus of research. This method not only effectively avoids the risks of viral infection and immune rejection associated with traditional animal-derived collagen, but also offers advantages such as simplified processes, resource conservation, and ease of large-scale production. The resulting products typically exhibit excellent hydrophilicity and high safety. However, as an insoluble fibrous protein, natural collagen's unique (Gly-XY)n repeat sequence and reliance on complex post-translational modifications and self-assembly processes present challenges for recombinant expression, including low expression levels, poor secretion efficiency, and purification difficulties. These issues are particularly pronounced for type III collagen, leading to its scarcity and high cost. Currently, developing low-molecular-weight, transdermal collagen peptides is crucial, but these products often face difficulties in achieving efficient soluble expression in expression systems, and subsequent purification processes are complex, hindering their application. Furthermore, some existing collagen peptides on the market have not effectively avoided matrix metalloproteinase (MMP) cleavage sites in their molecular design, making them prone to degradation in practical applications and affecting functional stability.

[0007] Therefore, constructing a recombinant human type III collagen peptide with small molecular weight, high homology, easy expression, and the ability to circumvent MMP cleavage sites is of great practical significance. Summary of the Invention

[0008] Due to the aforementioned deficiencies in the existing technology, the present invention provides a recombinant human type III collagen peptide with small molecular weight, high homology, easy expression, and the ability to circumvent MMP cleavage sites.

[0009] To achieve the above objectives, the present invention adopts the following technical solution:

[0010] A yeast heterologous expression of a type III recombinant human collagen peptide, wherein the yeast heterologous expression of a type III recombinant human collagen peptide comprises the amino acid sequence shown in SEQ ID No. 1.

[0011] SEQ ID NO:1 is specifically:

[0012] GEAGPPGVPGAPGEDGPDGSPGEPGANGLPGAAGER

[0013] The sequence encoding type III recombinant human collagen peptide monomers was tandemly encoded in multiple copies and expressed in a yeast system to form a multi-copy tandem repeat peptide. Subsequently, the repeat peptide was enzymatically digested, and the monomeric form of recombinant human collagen peptide was obtained after separation and purification. This type III recombinant human collagen peptide is the first of its kind. Its sequence was designed to effectively avoid the MMP-1 restriction site and avoid glycosylation and non-specific combination of lysine sites, thereby eliminating the adverse effects that these factors may have. The product has more than 90% homology with human type III collagen and has excellent characteristics such as small molecular weight and high transdermal performance.

[0014] The amino acid sequence of the aforementioned recombinant human collagen peptide III is derived from a partial fragment (functional segment) of human type I and II collagen, and its amino acid composition is modified to avoid interference from MMP-1 cleavage sites and non-specific combinations. To improve the stability and biocompatibility of the protein product, this design specifically avoids the enzymatic cleavage of matrix metalloproteinase-1 (MMP-1) during sequence construction. Specifically, by replacing or modifying key amino acid pairs (including Gly-|-Ile and Gly-|-Leu) in the MMP-1 recognition domain, the collagen peptide can effectively resist MMP-1-mediated degradation, thereby prolonging its functional half-life in vivo. In addition, to address the issue that lysine residues are prone to hydroxylation, glycosylation, and participation in non-specific intermolecular cross-linking, this application intentionally removes lysine residues in the sequence design and partially replaces them with arginine, which is less susceptible to modification. This substitution not only helps avoid unnecessary post-translational modifications and cross-linking reactions, but also forms a trypsin cleavage site (Arg-|-Gly) when recombinant human collagen peptides are joined end-to-end, thereby enhancing their controllable processability under specific application conditions.

[0015] The present invention also provides a multicopy tandem repeat peptide, the multicopy tandem repeat peptide comprising a basic repeating unit as shown in SEQ ID No. 1.

[0016] As a preferred technical solution:

[0017] In the multi-copy tandem repeat peptide described above, the number of basic repeating units is 5 to 15. Specifically, it is 5, but the specific number can be set by those skilled in the art according to actual needs.

[0018] A multicopy tandem repeat peptide as described above, the multicopy tandem repeat peptide comprising the amino acid sequence shown in SEQ ID No. 2.

[0019] SEQ ID NO.2 is as follows:

[0020] GEAGPPGVPGAPGEDGPDGSPGEPGANGLPGAAGERGEAGPPGVPGAPGEDGPDGSPGEPGANGLPGAAGERGEAGPPGVPGAPGEDGPDGSPGEPGANGLPGAAGERGEAGPPGVPGAPGEDGPDGSPGEPGANGLPGAAGERGEAGPPGVPGAPGEDGPDGSPGEPGANGLPGAAGERHHHHHH

[0021] The present invention also provides a nucleic acid molecule that encodes a type III recombinant human collagen peptide heterologously expressed in yeast as described above, or a multicopy tandem repeat peptide as described above.

[0022] As a preferred technical solution:

[0023] A nucleic acid molecule as described above includes a nucleotide sequence as shown in SEQ ID No. 3. This nucleotide sequence carries an easily purified 6×His tag and is optimized according to Pichia pastoris codon preferences.

[0024] SEQ ID NO.3 is as follows:

[0025] GGAGAAGCTGGTCCACCAGGTGTTCCAGGTGCTCCAGGTGAAGATGGTCCAGATGGTTCTCCAGGTGAACCAGGTGCTAACGGTTTGCCTGGTGCTGCTGGAGAAAGAGGTGAGGCTGGTCCACCAGGTGTTCCAGGAG CTCCAGGTGAGGATGGTCCAGACGGTTCTCCAGGAGAGCCAGGTGCCAACGGTTTGCCAGGTGCTGCTGGTGAGAGAGGTGAAGCTGGTCCTCCAGGTGTCCCAGGTGCTCCTGGAGAGGATGGTCCTGATGGTTCTCCA GGTGAGCCAGGTGCTAATGGTTTGCCTGGTGCAGCTGGTGAAAGAGGTGAAGCCGGTCCACCAGGAGTTCCAGGAGCTCCAGGTGAGGATGGTCCAGATGGTTCCCCAGGTGAACCAGGTGCTAACGGTTTTACCAGGTG CCGCTGGTGAGAGAGGTGAAGCTGGTCCACCTGGTGTTCCAGGTGCTCCAGGTGAAGATGGTCCAGACGGTTCCCCAGGTGAACCTGGTGCTAATGGTTTGCCAGGTGCTGCTGGTGAAAGACACCACCATCACCACCAC

[0026] The present invention also provides a recombinant expression vector plasmid containing at least one nucleic acid molecule as described above.

[0027] The present invention also provides a host cell containing at least one nucleic acid molecule as described above or a recombinant expression vector plasmid as described above. The host cell is a prokaryotic cell or a eukaryotic cell, preferably a eukaryotic cell, preferably Pichia pastoris, wherein the engineered Pichia pastoris strain is GS115-pPIC9K-COL.

[0028] Furthermore, the present invention also provides a method for preparing a yeast heterologously expressed type III recombinant human collagen peptide as described above, or a multicopy tandem repeat peptide as described above, comprising the following steps:

[0029] (1) The nucleic acid molecule encoding the multi-copy tandem repeat peptide is linked into a vector to construct a recombinant expression vector plasmid. The recombinant expression vector plasmid is then transferred into host cells and screened to obtain multi-copy positive transformants.

[0030] (2) Culture multi-copy positive transformants, add an inducer to the fermentation broth for induction treatment, and collect the fermentation broth after induction expression;

[0031] (3) The fermentation broth is centrifuged, filtered through a microfiltration membrane, ultrafiltered to remove impurities and purified to obtain the multicopy tandem repeat peptide (the expression level of the protein can reach 10 g / L).

[0032] (4) After enzymatic digestion of the multicopy tandem repeat peptide obtained in step (3), ultrafiltration is used to collect and purify the yeast heterologous expression of type III recombinant human collagen peptide.

[0033] As a preferred technical solution:

[0034] The host cell used in the method described above is an engineered Pichia pastoris strain;

[0035] The procedure for culturing multi-copy positive transformants is as follows:

[0036] 1) Inoculate the multi-copy positive transformants into YPD medium and incubate overnight;

[0037] 2) Transfer the bacterial cells cultivated in step 1) to BMGY medium. During the cultivation process, add glycerol after the initial glycerol is exhausted. When the bacterial cell concentration rises to the target, stop adding glycerol and starve the bacterial cells for a period of time before centrifuging and collecting the bacterial cells.

[0038] The induction treatment is performed as follows: the bacterial cells obtained in step 2) are introduced into BMMY medium to induce expression. During the expression process, methanol is added to induce the expression of multi-copy tandem repeat peptides. The expression level can be further improved by adding yeast extract and amino acid solution.

[0039] The purification is performed by nickel column purification, alcohol precipitation purification, or salting out purification.

[0040] The temperature for the culture and induction treatment is 28–29°C;

[0041] Step 2) is carried out in a fermenter under the following conditions: pH 4.5–6.0, agitator speed 300–700 rpm, and air flow rate 1.0–1.5 L / min.

[0042] The YPD medium consists of: 2 wt% tryptone, 1 wt% yeast extract, 2 wt% glucose, and the remainder water;

[0043] The BMGY medium consists of: 2 wt% tryptone, 1 wt% yeast extract, 0.23 wt% dipotassium hydrogen phosphate, 1.18 wt% potassium dihydrogen phosphate, 1 wt% glycerol, 1.34 wt% YNB, 0.004 wt% biotin, and the balance being water.

[0044] The BMMY medium consists of: 2 wt% tryptone, 1 wt% yeast extract, 0.23 wt% dipotassium hydrogen phosphate, 1.18 wt% potassium dihydrogen phosphate, 1 wt% methanol, 1.34 wt% YNB, 0.004 wt% biotin, and the balance being water.

[0045] The above technical solution is only one feasible technical solution of the present invention. The scope of protection of the present invention is not limited thereto. Those skilled in the art can reasonably adjust the specific design according to actual needs.

[0046] The above invention has the following advantages or beneficial effects:

[0047] (1) The present invention screens the amino acid sequence of type III recombinant human collagen peptides and avoids interference from the glycosylation and non-specific combination of MMP-1 restriction sites and lysine sites by replacing one or more amino acids. The homology is >90%, resulting in a recombinant collagen with low rejection reaction, high biological activity and high bioavailability.

[0048] (2) This invention provides a method for preparing recombinant human collagen peptides with small molecular weight, high homology, easy expression and effective avoidance of MMP-1 restriction site by optimizing the amino acid sequence and introducing it into the Pichia pastoris expression system. It has good application prospects. Attached Figure Description

[0049] The invention, its features, shape, and advantages will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings. Like reference numerals denote like parts throughout the drawings. The drawings are not drawn to scale; their focus is on illustrating the gist of the invention.

[0050] Figure 1 The pPIC9K-COL expression vector plasmid constructed in this invention is shown in the image.

[0051] Figure 2 Agarose gel electrophoresis image of the pPIC9K-COL expression vector plasmid;

[0052] Figure 3 SDS-PAGE electrophoresis image of the fermentation broth of Pichia pastoris GS115-pPIC9K-COL induced expression;

[0053] Figure 4 SDS-PAGE electrophoresis image of crude purification of multicopy tandem repeat peptides;

[0054] Figure 5 The chromatogram for the fine purification of the crude product using a nickel column is shown.

[0055] Figure 6 This is a diagram of the enzymatic digestion of multicopy tandem repeat peptides.

[0056] Figure 7 MALDI-TOF-MS mass spectrum of type III recombinant human collagen peptide heterologously expressed in yeast. Detailed Implementation

[0057] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but this is not intended to limit the invention.

[0058] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0059] The sources of the experimental materials used in the following examples are as follows:

[0060] The plasmid vector pPIC9K was purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0061] Pichia pastoris GS115 is preserved in the laboratory;

[0062] The restriction endonuclease Sal I was purchased from BioNTech Biotechnology (Beijing) Co., Ltd.

[0063] The composition of YPD medium is: 2 wt% tryptone, 1 wt% yeast extract, 2 wt% glucose, and the balance water; the composition of BMGY medium is: 2 wt% tryptone, 1 wt% yeast extract, 0.23 wt% dipotassium hydrogen phosphate, 1.18 wt% potassium dihydrogen phosphate, 1 wt% glycerol, 1.34 wt% YNB, 0.004 wt% biotin, and the balance water; the composition of BMMY medium is: 2 wt% tryptone, 1 wt% yeast extract, 0.23 wt% dipotassium hydrogen phosphate, 1.18 wt% potassium dihydrogen phosphate, 1 wt% methanol, 1.34 wt% YNB, 0.004 wt% biotin, and the balance water.

[0064] The relevant sequences involved in this invention are as follows:

[0065] 1. SEQ ID NO.1 is specifically:

[0066] GEAGPPGVPGAPGEDGPDGSPGEPGANGLPGAAGER

[0067] 2. SEQ ID NO.2 specifically refers to:

[0068] GEAGPPGVPGAPGEDGPDGSPGEPGANGLPGAAGERGEAGPPGVPGAPGEDGPDGSPGEPGANGLPGAAGERGEAGPPGVPGAPGEDGPDGSPGEPGANGLPGAAGERGEAGPPGVPGAPGEDGPDGSPGEPGANGLPGAAGERGEAGPPGVPGAPGEDGPDGSPGEPGANGLPGAAGERHHHHHH

[0069] 3. SEQ ID NO.3 (5'-3') specifically refers to:

[0070] GGAGAAGCTGGTCCACCAGGTGTTCCAGGTGCTCCAGGTGAAGATGGTCCAGATGGTTCTCCAGGTGAACCAGGTGCTAACGGTTTGCCTGGTGCTGCTGGAGAAAGAGGTGAGGCTGGTCCACCAGGTGTTCCAGGAG CTCCAGGTGAGGATGGTCCAGACGGTTCTCCAGGAGAGCCAGGTGCCAACGGTTTGCCAGGTGCTGCTGGTGAGAGAGGTGAAGCTGGTCCTCCAGGTGTCCCAGGTGCTCCTGGAGAGGATGGTCCTGATGGTTCTCCA GGTGAGCCAGGTGCTAATGGTTTGCCTGGTGCAGCTGGTGAAAGAGGTGAAGCCGGTCCACCAGGAGTTCCAGGAGCTCCAGGTGAGGATGGTCCAGATGGTTCCCCAGGTGAACCAGGTGCTAACGGTTTTACCAGGTG CCGCTGGTGAGAGAGGTGAAGCTGGTCCACCTGGTGTTCCAGGTGCTCCAGGTGAAGATGGTCCAGACGGTTCCCCAGGTGAACCTGGTGCTAATGGTTTGCCAGGTGCTGCTGGTGAAAGACACCACCATCACCACCAC

[0071] Example 1

[0072] A method for preparing type III recombinant human collagen peptides heterologously expressed in yeast includes the following steps:

[0073] (1) Design of type III recombinant human collagen peptides for heterologous expression in yeast:

[0074] The recombinant collagen peptide amino acid sequence was obtained from the human type III collagen α1 chain (COL3A1-HUMAN) fragment in the UniProt database. One or more amino acids were replaced to avoid interference from MMP restriction enzyme sites and lysine residues via glycosylation and non-specific combinations, achieving >90% homology. The amino acid sequence is shown in SEQ ID NO.1. Trypsin restriction sites were formed by repeatedly splicing the recombinant collagen peptide amino acid fragment, and a 6×His tag was added to the end. The amino acid sequence is shown in SEQ ID NO.2. Based on the codon preference of Pichia pastoris, the gene was optimized to reduce rare codons. The nucleotide sequence is shown in SEQ ID NO.3. The obtained nucleotide sequence was used to synthesize the recombinant expression vector plasmid pPIC9K-M1-2, the map of which is shown below. Figure 1 As shown, its agarose gel electrophoresis pattern is as follows: Figure 2 As shown.

[0075] (2) Construction and screening of engineered Pichia pastoris strains:

[0076] The linearized recombinant expression vector plasmid pPIC9K-M1-2 was digested with restriction endonuclease Sal I and transformed into Pichia pastoris GS115 by electroporation. The electroporated Pichia pastoris GS115 recombinant bacterial culture was plated on MD plates and incubated at 30°C until single colonies appeared.

[0077] The Pichia pastoris GS115 recombinant was subjected to G418 gradient resistance screening to obtain multi-copy transformants. The G418 gradient was set to 0.5 g / L, 1.0 g / L, 3.0 g / L, and 5.0 g / L. Finally, the multi-copy positive transformant GS115-pPIC9K-M1-2 was obtained on a 5.0 g / L G418 plate.

[0078] (3) Fermentation-induced expression of engineered Pichia pastoris:

[0079] Level I seed culture:

[0080] Select a single colony of the multi-copy positive transformant GS115-pPIC9K-M1-2, transfer it to 100mL of YPD medium, and incubate at 30℃ and 260rpm for 16-18h to obtain Grade I seed culture.

[0081] Level II seed culture:

[0082] Inoculate the seed culture at a rate of 10% into a 1L fermenter containing BMGY medium. Fermentation conditions are: temperature 28℃, pH 4.5–6.0, agitator speed 300–700 rpm, and air flow rate 1.0–1.5 L / min. Glycerol supplementation is as follows: once dissolved oxygen reaches above 90%, add 1–2% 100% glycerol to the fermenter until the cell wet weight reaches 100–150 g / L (approximately 24 hours of culture), then stop adding glycerol.

[0083] Fermentation-induced expression of recombinant yeast:

[0084] After the dissolved oxygen level reaches above 90%, maintain this level for 2-3 hours to ensure glycerol depletion. Then, add methanol to induce the exocrine expression of multicopy tandem repeat peptides by GS115-pPIC9K-M1-2. The methanol addition method is as follows: after the dissolved oxygen level reaches above 90%, add 1-3% 100% methanol to the fermenter. The SDS-PAGE electrophoresis image of the fermentation broth is shown below. Figure 3 As shown.

[0085] (4) Crude purification of multi-copy tandem repeat peptides:

[0086] The crude purification method includes the following steps: centrifuging the fermentation broth and collecting the supernatant; passing the supernatant through a 0.45 μm microfiltration membrane for sterilization; fractionating the precipitate with ethanol, collecting the precipitate, drying and redissolving it to obtain the crude purified product. The SDS-PAGE electrophoresis image of this product is shown below. Figure 4 As shown.

[0087] (5) Fine purification of multi-copy tandem repeat peptides using nickel columns:

[0088] The crude purified product was further purified using nickel column affinity chromatography. The specific steps included: loading the pretreated nickel column with the crude purified product, followed by gradient elution with imidazole solutions of different concentrations, and collecting the elution fraction containing multiple copies of tandem repeat peptides. The chromatogram of the crude purified product after nickel column purification is shown below. Figure 5 As shown.

[0089] (6) Enzymatic digestion of multi-copy tandem repeat peptides:

[0090] The elution buffer of the multi-copy tandem repeat peptide purified by nickel column chromatography was concentrated using a 10 kDa ultrafiltration centrifuge tube after buffer exchange. Subsequently, trypsin was added at an appropriate ratio to the Tris-HCl buffer (containing CaCl2) at pH 8.0 for enzymatic digestion. After the reaction, the peptide was purified using an ultrafiltration centrifuge tube to obtain the yeast heterologous expression type III recombinant human collagen peptide. The enzymatic digestion process was illustrated by SDS-PAGE. Figure 6 As shown.

[0091] The type III recombinant human collagen peptide solution was desalted by dialysis and then analyzed by MALDI-TOF-MS mass spectrometry. The MALDI-TOF-MS mass spectrum of the obtained yeast heterologously expressed type III recombinant human collagen peptide is shown below. Figure 7 As shown, the results verified that the obtained product was the target peptide, and its molecular weight was consistent with the theoretical expectation, thus confirming the correctness of the expressed protein sequence.

[0092] (7) MMP-1 enzyme digestion verification:

[0093] The lyophilized collagen peptide product was taken and enzymatically hydrolyzed using MMP-1. The hydrolyzed product was then subjected to 10kD ultrafiltration to remove the enzyme.

[0094] High-performance liquid chromatography (HPLC) was used to analyze the permeate sample after enzymatic hydrolysis and the same concentration of unhydrolyzed collagen peptide stock solution (control). Chromatographic comparison results showed that the retention time and peak shape of the main components in the enzymatically hydrolyzed sample and the unhydrolyzed control sample remained consistent, with no new characteristic peaks or significant reductions in the original main peaks observed due to enzymatic cleavage.

[0095] Those skilled in the art should understand that variations can be implemented by combining existing technology with the above embodiments, which will not be elaborated here. Such variations do not affect the essence of the present invention, and will not be elaborated here either.

[0096] The preferred embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and the devices and structures not described in detail should be understood as being implemented in a conventional manner in the art. Any person skilled in the art can make many possible variations and modifications to the technical solutions of the present invention using the methods and techniques disclosed above, or modify them into equivalent embodiments with equivalent changes, without departing from the scope of the present invention. This does not affect the essential content of the present invention. Therefore, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the present invention's technical solutions still fall within the protection scope of the present invention.

Claims

1. A type III recombinant human collagen peptide heterologously expressed in yeast, characterized in that, The yeast heterologous expression of the type III recombinant human collagen peptide includes the amino acid sequence shown in SEQ ID No.

1.

2. A multi-copy tandem repeat peptide, characterized in that, The multicopy tandem repeat peptide comprises a basic repeating unit as shown in SEQ ID No.

1.

3. The multi-copy tandem repeat peptide according to claim 2, characterized in that, The number of basic repeating units is 5 to 15.

4. The multi-copy tandem repeat peptide according to claim 3, characterized in that, The multicopy tandem repeat peptide includes the amino acid sequence shown in SEQ ID No.

2.

5. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes a type III recombinant human collagen peptide heterologously expressed in yeast as described in claim 1, or a multicopy tandem repeat peptide as described in any one of claims 2 to 4.

6. A nucleic acid molecule according to claim 5, characterized in that, Includes the nucleotide sequence shown in SEQ ID No.

3.

7. A recombinant expression vector plasmid containing at least one nucleic acid molecule as described in claim 5 or 6.

8. A host cell containing at least one nucleic acid molecule as described in claim 5 or 6, or a recombinant expression vector plasmid as described in claim 7.

9. A method for preparing a yeast heterologously expressed type III recombinant human collagen peptide as described in claim 1, or a multicopy tandem repeat peptide as described in any one of claims 2-4, characterized in that, Includes the following steps: (1) The nucleic acid molecule encoding the multi-copy tandem repeat peptide is linked into a vector to construct a recombinant expression vector plasmid. The recombinant expression vector plasmid is then transferred into host cells and screened to obtain multi-copy positive transformants. (2) Culture multi-copy positive transformants, add an inducer to the fermentation broth for induction treatment, and collect the fermentation broth after induction expression; (3) The fermentation broth is centrifuged, filtered through a microfiltration membrane, ultrafiltered to remove impurities, and purified to obtain the multicopy tandem repeat peptide. (4) After enzymatic digestion of the multicopy tandem repeat peptide obtained in step (3), ultrafiltration is used to collect and purify the yeast heterologous expression of type III recombinant human collagen peptide.

10. The method according to claim 9, characterized in that, The host cell is Pichia pastoris engineered strain; The procedure for culturing multi-copy positive transformants is as follows: 1) Inoculate the multi-copy positive transformants into YPD medium and incubate overnight; 2) Transfer the bacterial cells cultivated in step 1) to BMGY medium. During the cultivation process, add glycerol after the initial glycerol is exhausted. When the bacterial cell concentration rises to the target, stop adding glycerol and starve the bacterial cells for a period of time before centrifuging and collecting the bacterial cells. The induction treatment is performed as follows: the bacterial cells obtained in step 2) are introduced into BMMY medium to induce expression, and methanol is added during the expression process to induce the expression of multicopy tandem repeat peptides. The purification is performed by nickel column purification, alcohol precipitation purification, or salting out purification. The temperature for the culture and induction treatment is 28–29°C; Step 2) is carried out in a fermenter under the following conditions: pH 4.5–6.0, agitator speed 300–700 rpm, and air flow rate 1.0–1.5 L / min. The YPD medium consists of: 2 wt% tryptone, 1 wt% yeast extract, 2 wt% glucose, and the remainder water; The BMGY medium consists of: 2 wt% tryptone, 1 wt% yeast extract, 0.23 wt% dipotassium hydrogen phosphate, 1.18 wt% potassium dihydrogen phosphate, 1 wt% glycerol, 1.34 wt% YNB, 0.004 wt% biotin, and the balance being water. The BMMY medium consists of: 2 wt% tryptone, 1 wt% yeast extract, 0.23 wt% dipotassium hydrogen phosphate, 1.18 wt% potassium dihydrogen phosphate, 1 wt% methanol, 1.34 wt% YNB, 0.004 wt% biotin, and the balance being water.

Images