SiRNA for inhibiting INHBE gene expression and conjugate and application thereof

By designing siRNA that inhibits INHBE gene expression and conjugating it to GalNAc, it is specifically delivered to the liver, solving the problems of poor tolerance and weight rebound in existing obesity treatments, and achieving safe and effective weight loss.

CN122012498APending Publication Date: 2026-05-12YOUJIA (HANGZHOU) BIOMEDICAL TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511641898.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-11-11
Filing Date
2025-11-10
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing treatments for obesity suffer from poor tolerance, significant side effects, and weight rebound, and there is a lack of effective and safe weight loss drugs.

Method used

We designed siRNAs to inhibit INHBE gene expression, which, through coupling with GalNAc, are specifically delivered to the liver to interfere with INHBE mRNA, reduce INHBE protein expression, and promote healthy fat storage.

Benefits of technology

It effectively reduces weight, has stable long-term efficacy, no weight rebound, good patient compliance, does not affect appetite, and increases muscle mass.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012498A_ABST
    Figure CN122012498A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of biological medicine, and particularly relates to siRNA for inhibiting INHBE gene expression and a conjugate and application thereof. According to the present invention, the corresponding siRNA is designed according to the INHBE gene, and the siRNA is delivered to the liver by coupling GalNAc so as to interfere the INHBE mRNA at the liver position, such that the expression of the INHBE protein can be effectively reduced, the healthy fat storage can be promoted, and the obesity treatment effect can be further achieved. The siRNA and the siRNA conjugate provided by the invention can be used for remarkably inhibiting proliferation of human liver cancer cells Hep-G2, and have an effect on inhibiting mouse liver INHBE mRNA, so that the siRNA and the siRNA conjugate provided by the invention have a good prospect in application of obesity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedicine, specifically to siRNAs that inhibit INHBE gene expression, their conjugates, and their uses. Background Technology

[0002] RNA interference (RNAi) is a molecular biological phenomenon of gene silencing induced by double-stranded RNA. Its mechanism involves inhibiting gene expression by blocking the transcription or translation of specific genes. When a double-stranded RNA homologous to the coding region of endogenous messenger RNA (mRNA) is introduced into a cell, the mRNA degrades, leading to gene silencing. Small interfering RNAs (siRNAs), with a length of 20-25 nt, can trigger RNAi, specifically downregulating or shutting down the expression of specific genes. They are highly efficient, easy to synthesize, and easy to manipulate, making this technology widely used in exploring gene function and in gene therapy for infectious diseases and malignant tumors.

[0003] Acetylgalactosamine (GalNAc) is a monosaccharide that recognizes the sialic acid glycoprotein receptor, which is highly expressed in hepatocytes. Using GalNAc derivatives, such as divalent or trivalent branched linkers, attached to the 3' end of the positive strand of siRNA can promote siRNA specific targeting to liver tissue, thereby improving its bioavailability and reducing dosage and side effects.

[0004] Obesity has been rapidly increasing globally in recent decades. Data from the World Health Organization (WHO) shows that the number of obese people worldwide has almost tripled since 1975. In 2016, more than 1.9 billion adults (18 years and older) were overweight, of whom more than 650 million were obese. While obesity prevalence is relatively high in high-income countries, it has also been rising sharply in low- and middle-income countries in recent years. For example, in North America, the United States is one of the countries with the most severe obesity problems, with an adult obesity rate exceeding 30%. In some Pacific island nations, such as Nauru and the Cook Islands, obesity rates are as high as 70%-90%. Obesity rates are also rising in the Middle East and North Africa, with countries like Egypt experiencing increasingly prominent obesity problems. In Asia, although obesity rates have traditionally been low, the number of obese people is also increasing rapidly with economic development and changes in lifestyle. For example, China and India, due to their large populations, have seen significant growth in the absolute number of obese people. China's obesity rate has risen from a relatively low level in the past to around 10%-15% among adults in urban areas.

[0005] At the physiological level, obesity is caused by a long-term excess of energy intake compared to energy expenditure, with the excess energy stored in the body as fat. This process involves a complex imbalance in metabolic regulatory mechanisms, including the neuroendocrine system, abnormal secretion of adipokines, and gut microbiota dysbiosis. For example, the hypothalamic-pituitary-adrenal (HPA) and hypothalamic-pituitary-thyroid (HPT) axes in the neuroendocrine system play crucial roles in energy balance regulation; imbalances can affect appetite and metabolism. Changes in the secretion of adipokines such as leptin and adiponectin can interfere with insulin sensitivity and energy metabolism. Gut microbiota is also closely related to obesity; dysbiosis can affect food digestion and absorption, as well as energy acquisition.

[0006] Obesity is closely linked to a variety of serious diseases and is a major risk factor for cardiovascular disease, type 2 diabetes, hypertension, sleep apnea-hypopnea syndrome, non-alcoholic fatty liver disease, osteoarthritis, and various cancers. It imposes a heavy medical burden on patients and puts enormous pressure on social medical resources.

[0007] Current treatments for obesity mainly include lifestyle interventions, medication, and surgery. Lifestyle interventions, particularly dietary control, aim to reduce weight by adjusting dietary structure and controlling calorie intake. This includes increasing dietary fiber intake, reducing the intake of high-fat, high-sugar, and high-calorie foods, and controlling meal portions and total calorie intake. However, it relies heavily on patient self-discipline, is difficult to maintain, and is slow to take effect in severely obese individuals. Exercise, including aerobic and strength training, increases energy expenditure. However, it is limited by physical condition, time, and environment. Obese individuals are prone to joint injuries during exercise, and developing a regular exercise habit is difficult.

[0008] In terms of drug treatment, appetite suppressants such as phentermine can stimulate the hypothalamic satiety center to reduce appetite, but they have side effects such as dry mouth, insomnia, palpitations, high blood pressure, and addiction. Rebound weight gain is common after discontinuation, and long-term safety is controversial. Fat absorption inhibitors such as orlistat can inhibit gastrointestinal lipase activity, but can cause gastrointestinal adverse reactions such as steatorrhea, fecal incontinence, abdominal pain, and nausea, affecting patients' quality of life and long-term adherence. GLP-1R agonists, such as semaglutide, are currently the most popular weight-loss drugs. However, studies show that these drugs have some problems in the weight-loss process. For example, semaglutide significantly reduces lean body mass, with approximately 40% of weight loss coming from bone and muscle loss. Furthermore, GLP-1R agonists inhibit the reward system, resulting in poor tolerability; after one year, 68% of people no longer tolerate them. Most importantly, most patients experience rapid weight rebound after discontinuing GLP-1R agonists, leading to long-term drug dependence.

[0009] In surgical treatment, gastric bypass surgery reduces stomach volume and food absorption by altering the gastrointestinal structure, but it carries risks such as bleeding, infection, and anastomotic leakage. Long-term nutritional monitoring and supplementation are required post-operatively, and the procedure is expensive. Sleeve gastrectomy, while reducing stomach volume, also carries surgical risks such as gastric leakage and gastroesophageal reflux. Strict dietary management and lifestyle adjustments are necessary post-operatively, and weight rebound is also a concern.

[0010] Therefore, there is an urgent need to find weight loss drugs that are well-tolerated, have no risk of weight rebound, and have no side effects such as muscle atrophy. Summary of the Invention

[0011] This invention designs corresponding siRNA for INHBE and delivers it to the liver effectively by conjugating GalNAc, thereby playing a role in treating obesity.

[0012] The first aspect of this invention discloses an siRNA for inhibiting INHBE gene expression, comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand are at least partially anticomplementary to form a double-stranded region, wherein the sense strand of the siRNA has a nucleotide sequence as shown in SEQ ID NO: 1 to 11, and the antisense strand has a nucleotide sequence as shown in (1) to (11) below:

[0013] UUUUUCUCUGCCUUCCCUCNn (SEQ ID NO:31);

[0014] UAAUUUUUCUCUGCCUUCCNn (SEQ ID NO:32);

[0015] UAUUAAGAAAGUAUAAGCCNn (SEQ ID NO:33);

[0016] UUAUUAAGAAAGUAUAAGCNn (SEQ ID NO:34);

[0017] UUUAUUAAGAAAGUAUAAGNn (SEQ ID NO:35);

[0018] UAACCCUUCUUUAUGACUCNn (SEQ ID NO:36);

[0019] UUGACUUUGUGGACACCCNn (SEQ ID NO:37);

[0020] UAUUAUUAUGAAAAUAGCUNn (SEQ ID NO:38);

[0021] AUAAUGAGAAUUCAAAAGGNn (SEQ ID NO:39);

[0022] UUUAAGAUAAUGAGAAUUCNn (SEQ ID NO: 40);

[0023] UUGAACUUCACCCAGAACCNn (SEQ ID NO:41);

[0024] Where N is any one of G, U, A, C, T, dG, dU, dA, dC, dT; n is the number of N, and n is an integer from 0 to 2.

[0025] Furthermore, N is any one of G, U, A, and C, and n is 2.

[0026] When n is 2, the antisense strand of the siRNA has a nucleotide sequence as shown in SEQ ID NO:13-23.

[0027] Furthermore, n is 0.

[0028] When n is 0, the antisense strand of the siRNA is the nucleotide sequence shown in (1) to (11) below:

[0029] UUUUUCUCUGCCUUCCCUC (SEQ ID NO:42);

[0030] UAAUUUUUCUCUGCCUUCC (SEQ ID NO:43);

[0031] UAUUAAGAAAGUAUAAGCC (SEQ ID NO:44);

[0032] UUAUUAAGAAAGUAUAAGC (SEQ ID NO:45);

[0033] UUUAUUAAGAAAGUAUAAG (SEQ ID NO:46);

[0034] UAACCCUUCUUUAUGACUC(SEQ ID NO:47);

[0035] UUGACUUUGUGGACACCCC (SEQ ID NO: 48);

[0036] UAUUAUUAUGAAAAUAGCU (SEQ ID NO:49);

[0037] AUAAUGAGAAUUCAAAAGG (SEQ ID NO:50);

[0038] UUUAAGAUAAUGAGAAUUC (SEQ ID NO:51);

[0039] UUGAACUUCACCCAGAACC (SEQ ID NO:52).

[0040] Furthermore, the sense strand of the siRNA has a nucleotide sequence as shown in SEQ ID NO:1-11, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO:13-23.

[0041] Furthermore, at least one nucleotide in the siRNA is modified; the modified nucleotide is selected from those with a sugar moiety modified at the 2' position, or at least one phosphate ester group is a phosphate ester group containing a modified group, or one or more nucleotide analogs.

[0042] Furthermore, the nucleotide modified at the sugar portion of the 2' position comprises nucleotides modified with 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethoxyethyl (2'-O-DMAEOE), or 2'-ON-methylacetamido (2'-O-NMA).

[0043] Furthermore, the phosphate ester group containing the modifying group is specifically a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphate diester bond with a sulfur atom.

[0044] Furthermore, the nucleotide analogue is selected from one of the following: isonucleotide, LNA, ENA, cEt-BNA, UNA, or GNA.

[0045] Furthermore, the structure of the sense strand of the modified siRNA molecule is shown in SEQ ID NO: 25, and the structure of the antisense strand of the modified siRNA molecule is shown in SEQ ID NO: 27; or the structure of the sense strand of the modified siRNA molecule is shown in SEQ ID NO: 28, 57, and the structure of the antisense strand of the modified siRNA molecule is shown in SEQ ID NO: 30, 59.

[0046] A second aspect of the present invention discloses an siRNA conjugate containing any of the siRNAs described above and a ligand conjugated to the siRNA; the ligand includes N-acetylgalactosamine, aliphatic, alicyclic, polyalicyclic compounds, cholesterol, biotin, vitamins, galactose, lactose, N-acetylglucosamine, or derivatives thereof.

[0047] These conjugates can help siRNA be delivered to target organs or tissues and enter cells, including monoclonal antibodies, bispecific antibodies, monosaccharides, polysaccharides, cationic polymers, etc.

[0048] Furthermore, the ligand is GalNAc or a derivative thereof.

[0049] Furthermore, the ligand is one or more GalNAc derivatives attached via monovalent, divalent, or trivalent branched junctions, preferably having the following structural formula:

[0050] Furthermore, the ligand is L96, and the structural formula of L96 is as follows:

[0051]

[0052] The structural formula of the conjugate is:

[0053]

[0054] Where X is O or S.

[0055] In some implementations, X is 0.

[0056] The third aspect of this invention discloses biological materials related to the above-mentioned siRNA, which are any of the following:

[0057] 1) A vector containing any of the siRNAs described in the first aspect;

[0058] 2) A reagent or kit containing any of the siRNAs described in the first aspect or the vector described in 1);

[0059] 3) A pharmaceutical composition comprising any of the siRNA molecules described in the first aspect and other pharmaceutically acceptable components.

[0060] The pharmaceutically acceptable other components include, but are not limited to, water, saline, pH buffer, protectant, osmotic pressure regulator, excipient, diluent, disintegrant, binder, lubricant, sweetener, preservative, or combinations thereof. The protectant may be at least one selected from inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose.

[0061] The aforementioned carriers include, but are not limited to, one or more of the following: magnetic nanoparticles (such as Fe2O3), lipid nanoparticles, carbon nanotubes, mesoporous silica, calcium phosphate nanoparticles, polyethyleneimine, polyamide amine dendritic polymers, polylysine, chitosan, poly-D or L-type lactic acid / glycolic acid copolymers, poly(aminoethyl ethylene phosphate), and poly(N,N-dimethylaminoethyl methacrylate) and their derivatives.

[0062] The dosage form of the pharmaceutical composition may be a liquid formulation (e.g., an injection) or a lyophilized powder for injection. When administered, the lyophilized powder for injection is mixed with liquid excipients to form a liquid formulation. The liquid formulation may be administered, but is not limited to, subcutaneous, intramuscular, or intravenous injection, or may be administered via a spray to the lungs, or via a spray to other organs or tissues (e.g., the liver).

[0063] The fourth aspect of this invention discloses the use of siRNA as described in the first aspect, or siRNA conjugates as described in the second aspect, or pharmaceutical compositions as described in the third aspect in the preparation of medicaments for relieving and / or treating obesity.

[0064] The fifth aspect of this invention discloses the use of siRNA as described in the first aspect, or siRNA conjugates as described in the second aspect, or pharmaceutical compositions as described in the third aspect, in combination with smegglutinin; or the use of siRNA conjugates, pharmaceutical compositions, and smegglutinin in combination in the preparation of obesity drugs.

[0065] Beneficial effects: The siRNA of this invention is effectively delivered to the liver by coupling with GalNAc, interfering with INHBE mRNA in the liver, effectively reducing the expression of INHBE protein and promoting healthy fat storage; moreover, the effect is long-lasting, and a single dose can maintain long-term efficacy, which is advantageous for treating chronic metabolic diseases such as obesity. Patient compliance is good and the efficacy is stable. It can effectively increase muscle mass, reduce weight, and the weight will not rebound and does not affect appetite. Attached Figure Description

[0066] Figure 1 The graph shows the inhibition rate of INHBE mRNA in mouse liver by siRNA conjugates.

[0067] Figure 2 The pharmacodynamic activity verification diagrams for YJH-017-m1371 m3-L96, smegglutide, and smegglutide + YJH-017-m1371 m3-L96 are shown.

[0068] Figure 3 This is a comparison chart showing the changes in mouse body weight after drug administration.

[0069] Figure 4This is a graph comparing the rate of change in mouse body weight after drug administration.

[0070] Figure 5 This is a comparison chart showing the changes in fat weight in mice after drug administration.

[0071] Figure 6 This is a comparison chart showing the changes in muscle weight in mice after drug administration.

[0072] Figure 7 This is a comparison chart showing the changes in food intake in mice after drug administration. Detailed Implementation

[0073] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0074] The term "connection" as used in this invention, when referring to a link between two molecules, means that the two molecules are connected by a covalent bond or that the two molecules are associated via a non-covalent bond (e.g., a hydrogen bond or an ionic bond).

[0075] The "oligonucleotide" described in this invention is a nucleotide sequence containing 10-50 nucleotides or nucleotide base pairs. In some embodiments of this invention, the oligonucleotide has a nucleobase sequence that is at least partially complementary to the coding sequence of a target gene expressed in cells. The nucleotide may optionally be modified. In some embodiments of this invention, after delivery of the oligonucleotide to a cell expressing a gene, the oligonucleotide is able to inhibit or block gene expression in vitro or in vivo.

[0076] The term "inhibition" as used in this invention means that, when a given gene is expressed, gene expression is reduced when the cell, cell population, or tissue is treated with the siRNA, pharmaceutical composition, or siRNA conjugate described in this invention, compared to untreated cells, cell populations, or tissues.

[0077] The term "inhibition" as used in this invention is used interchangeably with "reduction," "silence," "downregulation," "suppression," and other similar terms, and includes any level of inhibition. Preferably, inhibition includes statistically significant inhibition or clinically significant inhibition.

[0078] Each nucleotide in the sense and antisense strands is independently a modified or unmodified nucleotide. In the context of this invention, unless otherwise stated, "conjugation" refers to the covalent connection between two or more chemical parts, each with a specific function, also called "coupling"; correspondingly, "conjugate" refers to a compound formed by the covalent connection of these chemical parts, also called "coupling compound". Further, "siRNA conjugate" refers to a compound formed by the covalent attachment of one or more chemical parts with specific functions to siRNA, also called "siRNA conjugate".

[0079] Unless otherwise specified, in the foregoing and hereinafter, “G”, “C”, “A”, “T” and “U” generally represent nucleotides containing guanine, cytosine, adenine, thymine and uracil as bases, respectively. However, it should be understood that the term “ribonucleotide” or “nucleotide” may also refer to modified nucleotides, nucleotide analogues (surrogate replacement moiety), as further detailed below.

[0080] In the context of this invention, the terms "complementary" and "reverse complementary" are used interchangeably and have the meaning known to those skilled in the art: in a double-stranded nucleic acid molecule, the bases of one strand are paired complementaryly with the bases of the other strand. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair comprises one purine and one pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary, and the sequence of the complementary strand can be inferred from its sequence. Correspondingly, "mismatch" in the art means, in a double-stranded nucleic acid, that the bases at corresponding positions are not paired complementaryly.

[0081] Unless otherwise specified, in the preceding and following text, "substantially inversely complementary" means that there are no more than three base mismatches between the two nucleotide sequences involved; "substantially inversely complementary" means that there are no more than one base mismatch between the two nucleotide sequences; and "completely inversely complementary" means that there are no base mismatches between the two nucleotide sequences. In the preceding and following text, a "nucleotide difference" between two nucleotide sequences refers to a change in the type of bases at the same position of the nucleotides compared to the latter. For example, if a nucleotide base in the latter is A, and the corresponding nucleotide base at the same position in the former is U, C, G, or T, then a nucleotide difference is considered to exist between the two nucleotide sequences at that position. In some embodiments, replacing the nucleotide at the original position with a baseless nucleotide or its equivalent can also be considered as a nucleotide difference at that position.

[0082] Unless otherwise specified, the experimental techniques and methods used in this embodiment are conventional techniques and methods. For example, experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in the embodiments can be obtained through legitimate commercial channels.

[0083] Example 1: siRNA Design

[0084] A set of siRNAs targeting the INHBE gene was designed based on the transcriptome sequence: including unmodified siRNAs, as shown in Table 1; the siRNAs in Table 1 were further modified and the modified sequences were conjugated with L96 to obtain the sequences shown in Table 2.

[0085] siRNA sequences were designed and modified targeting the mouse INHBE transcript. The modified siRNAs were then conjugated with ligands to obtain conjugates, as shown in Table 3.

[0086] Table 1

[0087] Name SEQ ID NO: siINHBE sense strand sequence (5'-3') SEQ ID NO: siINHBE antisense strand sequence (5'-3') Position in NM_031479.5 YJH-017-1585 1 GAGGGAAGGCAGAGAAAAA 13 UUUUUCUCUGCCUUCCCUCCC 1585 YJH-017-1588 2 GGAAGGCAGAGAAAAAUUA 14 UAAUUUUUCUCUGCCUUCCCU 1588 YJH-017-2167 3 GGCUUAUACUUUCUUAAUA 15 UAUUAAGAAAGUAUAAGCCAG 2167 YJH-017-2168 4 GCUUAUACUUUCUUAAUAA 16 UUAUUAAGAAAGUAUAAGCCA 2168 YJH-017-2169 5 CUUAUACUUUCUUAAUAAA 17 UUUAUUAAGAAAGUAUAAGCC 2169 YJH-017-2213 6 GAGUCAUAAAGAAGGGUUA 18 UAACCCUUCUUUAUGACUCAC 2213 YJH-017-2297 7 GGGGUGUCCACAAAGUCAA 19 UUGACUUUGUGGACACCCCUG 2297 YJH-017-2316 8 AGCUAUUUUCAUAAUAAUA 20 UAUUAUUAUGAAAAUAGCUUU 2316 YJH-017-2350 9 CCUUUUGAAUUCUCAUUAU 21 AUAAUGAGAAUUCAAAAGGCA 2350 YJH-017-2356 10 GAAUUCUCAUUAUCUUAAA 22 UUUAAGAUAAUGAGAAUUCAA 2356 NC 12 UUCUCCGAACGUGUCACGUTT 24 ACGUGACACGUUCGGAGAATT NA

[0088] Table 2

[0089] Name SEQ IDNO: siINHBE sense strand sequence (5'-3') SEQ IDNO: siINHBE antisense strand sequence (5'-3') YJH-017-2167 m1 25 fG-mG-fC-mU-fU-mA-fU-fA-fC-mU-fU-mU-fC-mU-fU-mA-fA-mU-fA 27 mU-fA-mU-fU-mA-fA-mG-fA-mA-fA-mG-mU-mA-fU-mA-fA-mG-fC-mC-s-fA-s-mG YJH-017-2167 m1-L96 26 fG-mG-fC-mU-fU-mA-fU-fA-fC-mU-fU-mU-fC-mU-fU-mA-fA-mU-fA-L96 27 mU-fA-mU-fU-mA-fA-mG-fA-mA-fA-mG-mU-mA-fU-mA-fA-mG-fC-mC-s-fA-s-mG

[0090] Table 3

[0091] Name SEQ IDNO: siINHBE justice chain sequence (5'-3') SEQ IDNO: siINHBE antisense sequence (5'-3') Position in NM_008382.3 YJH-017-m1371 11 GGUUCUGGGUGAAGUUCAA 23 UUGAACUUCACCCAGAACCUU 1371 YJH-017-m1371 m1 28 fG-mG-fU-mU-fC-mU-fG-fG-fG-mU-fG-mA-fA-mG-fU-mU-fC-mA-fA 30 mU-fU-mG-fA-mA-fC-mU-fU-mC-fA-mC-mC-mC-fA-mG-fA-mA-fC-mC-s-fU-s-mU 1371 YJH-017-m1371 m1-L96 29 fG-mG-fU-mU-fC-mU-fG-fG-fG-mU-fG-mA-fA-mG-fU-mU-fC-mA-fA-L96 30 mU-fU-mG-fA-mA-fC-mU-fU-mC-fA-mC-mC-mC-fA-mG-fA-mA-fC-mC-s-fU-s-mU 1371 YJH-017-m1371 m3 57 mG-s-mG-s-mU-mU-fC-mU-fG-fG-fG-mU-mG-mA-mA-mG-mU-mU-mC-mA-mA 59 mU-s-fU-s-mG-mA-mA-fC-mU-mU-mC-mA-mC-mC-mC-fA-mG-fA-mA-mC-mC-s-mU-s-mU 1371 YJH-017-m1371 m3-L96 58 mG-s-mG-s-mU-mU-fC-mU-fG-fG-fG-mU-mG-mA-mA-mG-mU-mU-mC-mA-mA-L96 59 mU-s-fU-s-mG-mA-mA-fC-mU-mU-mC-mA-mC-mC-mC-fA-mG-fA-mA-mC-mC-s-mU-s-mU 1371

[0092] The abbreviations of nucleotide monomers in Tables 2 and 3 are shown in Table 4.

[0093] Table 4

[0094] abbreviation Nucleotides A Adenosine-3'-phosphate fA 2'-Fluoroadenosine-3'-phosphate mA 2'-O-methyladenosine-3'-phosphate s-mA 2'-O-methyladenosine-3'-thiophosphate s-fA 2'-Fluoroadenosine-3'-Thiophosphate C Cytidine-3'-phosphate fC 2'-Fluorocytidine-3'-phosphate mC 2'-O-methylcytidine-3'-phosphate s-mC 2'-O-methylcytidine-3'-thiophosphate s-fC 2'-Fluorocytidine-3'-Thiophosphate G Guanosine-3'-phosphate fG 2'-Fluoroguanosine-3'-phosphate mG 2'-O-methylguanosine-3'-phosphate s-mG 2'-O-methylguanosine-3'-thiophosphate s-fG 2'-Fluoroguanosine-3'-Thiophosphate U Urate-3'-phosphate fU 2'-Fluorouracil-3'-phosphate mU 2'-O-methyluridine-3'-phosphate s-mU 2'-O-methyluridine-3'-thiophosphate s-fU 2'-Fluorouracil-3'-Thiophosphate

[0095] Example 2: Preparation of siRNA

[0096] All siRNA sequences used in Example 1 were synthesized by Suzhou Ouli Biomedical Technology Co., Ltd.

[0097] Example 3: Screening for the effect of naked sequence knockdown

[0098] 1) Human liver cancer cells Hep-G2 in the logarithmic growth phase were digested with trypsin (purchased from the cell bank of Kunming Institute of Physics, Chinese Academy of Sciences), and digestion was terminated with complete medium supplemented with 10% FBS. Cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, and counted with a hemocytometer. Then, 50,000 cells were added to each 24-well plate for culture.

[0099] 2) Preparation of LipoRNAiMAX (invitrogen) and siRNA mixture: The sequences in Table 1 were used. 10 nM siRNA / well and 1.5 μl LipoRNAiMAX (invitrogen) were diluted in 25 μl serum-free culture medium (Opti-MEM, gibco). The siRNA solution and LipoRNAiMAX solution were then mixed and incubated at room temperature for 5 minutes.

[0100] 3) Add 50 μl of the corresponding group's siRNA and LipoRNAiMAX mixed solution to each well.

[0101] 4) After culturing for 48 hours, discard the culture medium, wash twice with enzyme-free PBS, add lysis buffer to lyse the cells, add chloroform for extraction, vortex to mix, let stand at room temperature for 2-3 minutes, centrifuge, transfer the supernatant after separation to a well plate and bind with binding buffer, and use a nucleic acid extractor to extract RNA according to the kit.

[0102] 5) Prepare the qPCR system and perform it on ice. PCR reaction conditions: 50℃ for 15 minutes of pre-denaturation, 95℃ for 1 minute, 95℃ for 15 seconds of annealing, 60℃ for 1 minute of extension, for 39 cycles.

[0103] PCR primers:

[0104] Target name Sequence (5'-3') INHBE hYJH-017-3P F TGTGTCCCTACTGCCCGAA (SEQ ID NO:53) INHBE hYJH-017 3P R CCATATCTGGCACATCCGTCTT (SEQ ID NO:54)

[0105] The screening results are shown in Table 5.

[0106] Table 5

[0107] sequence name Average inhibition rate at 10 nM (%) YJH-017-1585 57.0 YJH-017-1588 68.0 YJH-017-2167 82.5 YJH-017-2168 76.5 YJH-017-2169 52.0 YJH-017-2213 59.5 YJH-017-2297 68.5 YJH-017-2316 66.0 YJH-017-2350 73.5 YJH-017-2356 73.0

[0108] As shown in the table, YJH-017-2167 had the best inhibition rate, reaching 82.5%, and will be used in the next experiment.

[0109] Example 4: Verification of the knockdown effect of GalNAc coupled modification sequence

[0110] 1) Human liver cancer cells Hep-G2 in the logarithmic growth phase were digested with trypsin (purchased from the cell bank of Kunming Institute of Physics, Chinese Academy of Sciences), and digestion was terminated with complete medium supplemented with 10% FBS. Cells were collected by centrifugation, resuspended in medium supplemented with 10% FBS, and counted with a hemocytometer. Then, 50,000 cells were added to each 24-well plate for culture.

[0111] 2) Preparation of the mixture of LipoRNAiMAX (invitrogen) and siRNA conjugate: YJH-017-2167m1-L96 was used: 10 nM / well of siRNA conjugate and 1.5 μl of LipoRNAiMAX (invitrogen) were diluted in 25 μl of serum-free culture medium (Opti-MEM, gibco). The above siRNA conjugate solution and LipoRNAiMAX solution were then mixed and incubated at room temperature for 5 minutes.

[0112] 3) Add 50 μl of the corresponding group's siRNA conjugate and LipoRNAiMAX mixture to each well.

[0113] 4) After culturing for 48 hours, discard the culture medium, wash twice with enzyme-free PBS, add lysis buffer to lyse the cells, add chloroform for extraction, vortex to mix, let stand at room temperature for 2-3 minutes, centrifuge, transfer the supernatant after separation to a well plate and bind with binding buffer, and use a nucleic acid extractor to extract RNA according to the kit.

[0114] 5) Prepare the qPCR system and perform it on ice. PCR reaction conditions: 50℃ for 15 minutes of pre-denaturation, 95℃ for 1 minute, 95℃ for 15 seconds of annealing, 60℃ for 1 minute of extension, for 39 cycles.

[0115] PCR primers:

[0116] Target name Sequence (5'-3') INHBE hYJH-017 3P F TGTGTCCCTACTGCCCGAA (SEQ ID NO:53) INHBE hYJH-017 3P R CCATATCTGGCACATCCGTCTT (SEQ ID NO:54)

[0117] The inhibition rate was calculated, and the inhibition rate of YJH-017-2167 m1-L96 was 87.3%.

[0118] Example 5: Validation of the knockdown effect of GalNAc-coupled modification sequence in mice

[0119] The pharmacodynamic activity of GalNAc-conjugated siRNA targeting mouse INHBE was analyzed in male C57BL / 6 mice after subcutaneous injection of siRNA. YJH-017-m1371 m1-L96 and YJH-017-m1371 m3-L96 were administered at a single subcutaneous dose of 5 mg / kg. Liver samples were collected on day 4 after the start of administration, and INHBE mRNA levels in all samples were analyzed by RT-qPCR. Mouse liver tissue was lysed using lysis buffer, extracted with chloroform, vortexed, and incubated at room temperature for 2-3 minutes. After centrifugation, the supernatant was transferred to wells and bound with binding buffer. RNA was extracted using a nucleic acid extractor according to the kit.

[0120] Prepare the qPCR system and perform it on ice. PCR reaction conditions: 50℃ for 15 minutes pre-denaturation, 95℃ for 1 minute, 95℃ for 15 seconds annealing, 60℃ for 1 minute extension, for 39 cycles.

[0121] PCR primers:

[0122] Target name Sequence (5'-3') INHBE mYJH-017 1P F CTAACCAGCCGTCCCAGAATA (SEQ ID NO:55) INHBE mYJH-017 1P R GTGCCCGGAAAAGAGGGAG (SEQ ID NO:56)

[0123] The inhibition rate of the sequence on mouse liver INHBE mRNA is shown in the figure. Figure 1 The inhibition rate of YJH-017-m1371 m1-L96 was 44.7%, and the inhibition rate of YJH-017-m1371 m3-L96 was 85.7%.

[0124] Example 6: Validation of drug efficacy in obese mice

[0125] The pharmacodynamic activity of GalNAc-conjugated siRNA targeting INHBE was validated in a mouse obesity model. Twenty male DIO mice were acclimatized for 3 days and then divided into 4 groups: G1. Model control + Vehicle; G2. YJH-017-m1371 m3-L96; G3. Smegglutinin; G4. Smegglutinin + YJH-017-m1371 m3-L96 (n=5 / group). After enrollment, the participants continued to be fed a high-fat diet until the end of the experiment. The dosage for group G2 was 20 mg / kg, administered as a single subcutaneous dose on day 0; the dosage for group G3 was 10 nmol / kg, administered as a single subcutaneous dose daily from day 0 to day 21; and group G4 received a combination of semaglutide and YJH-017-m1371 m3-L96, with YJH-017-m1371 m3-L96 administered as a single subcutaneous dose of 20 mg / kg on day 0, and semaglutide administered as a single subcutaneous dose of 10 nmol / kg daily from day 0 to day 21.

[0126] Animals were weighed and their food intake was measured every 3 days. Body fat percentage was measured on days 1-1, 7, 14, 21, 27, and 34. Liver samples were collected from mice on day 35, and the expression level of INHBE mRNA in the livers of each animal was detected by qPCR.

[0127] The relative expression levels of INHBE mRNA in the livers of mice in each group are shown in the following figures. Figure 2 With group G1 as the control, the inhibition rates of INHBE mRNA in groups G2, G3, and G4 were 76.83%, 23.59%, and 79.83%, respectively, indicating that GalNAc-conjugated siRNA can significantly inhibit the expression of the INHBE gene in mouse liver.

[0128] The weight records of mice in each group are shown below. Figure 3 and Figure 4 Using group G1 as a control, in group G2, administration of YJH-017-m1371 m3-L96 alone resulted in a slow and continuous decrease in mouse weight, with no rebound at the end of the experiment. In group G3, administration of semaglutide alone led to a rapid decrease in mouse weight, reaching a plateau on day 14, but the weight rebounded rapidly after drug withdrawal on day 22. In group G4, combined administration of YJH-017-m1371m3-L96 and semaglutide also resulted in a rapid decrease in mouse weight, with a slightly larger decrease than that of the semaglutide monotherapy group. After withdrawal of semaglutide, the weight of mice in this group began to rebound, reaching the same level as group G2 on day 34, with a smaller rebound magnitude than group G3.

[0129] The results of body fat analysis in each group of mice are shown below. Figure 5 and Figure 6 In group G2, fat mass continued to decrease while muscle mass continued to increase; in group G3, fat mass decreased rapidly, but muscle mass also decreased rapidly at the same time, and both fat and muscle mass rebounded rapidly after drug withdrawal on day 22; the trend of change in group G4 was similar to that of group G3, but fat mass decreased more than that of group G3, while muscle mass was maintained better than that of group G3.

[0130] The food intake statistics for each group of mice are shown below. Figure 7 Food intake in groups G3 and G4 decreased rapidly after administration and then slowly recovered, while food intake in group G2 showed no significant fluctuation and was close to that of group G1. This indicates that semaglutide administration significantly suppresses appetite, while INHBE siRNA has no significant effect on appetite.

[0131] The detailed descriptions listed above are merely specific illustrations of feasible embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Those skilled in the art can devise many other modifications and embodiments, which will fall within the principles and spirit of this application. More specifically, within the scope of this application, the drawings, and the claims, various variations and improvements can be made to the components and / or layout of the subject matter combination layout. Besides variations and improvements to the components and / or layout, other uses will be apparent to those skilled in the art.

Claims

1. A siRNA that inhibits INHBE gene expression, characterized in that, The siRNA comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand are at least partially anticomplementary to form a double-stranded region, the sense strand of the siRNA having a nucleotide sequence as shown in SEQ ID NO:1-11, and the antisense strand having a nucleotide sequence as shown in SEQ ID NO:13-23.

2. The siRNA as described in claim 1, characterized in that, At least one nucleotide in the sense strand or the antisense strand is a modified nucleotide.

3. The siRNA as described in claim 2, characterized in that, At least one nucleotide in the sense strand or the antisense strand is a nucleotide analog or a nucleotide with a hydroxyl group modified at the 2' position of the ribosyl group; the nucleotide analog includes isonucleotides, LNA, ENA, cEt-BNA, UNA, or GNA; the nucleotide with a hydroxyl group modified at the 2' position of the ribosyl group includes nucleotides modified with 2'-O-methyl, 2'-O-methoxyethyl, 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl, 2'-O-dimethylaminoethyl, 2'-O-dimethylaminopropyl, T0-dimethylaminoethoxyethyl, or 2'-ON-methylacetamide.

4. The siRNA as described in claim 2, characterized in that, At least one phosphate ester group in the sense or antisense chain is a phosphate ester group with a modifying group, wherein the phosphate ester group is a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphate diester bond with a sulfur atom.

5. The siRNA according to any one of claims 2 to 4, characterized in that, The modified siRNA molecule has the following structures: the sense strand structure as shown in SEQ ID NO: 25, the antisense strand structure as shown in SEQ ID NO: 27; or the modified siRNA molecule has the following structures: the sense strand structure as shown in SEQ ID NO: 28, the antisense strand structure as shown in SEQ ID NO: 30; or the modified siRNA molecule has the following structures: the sense strand structure as shown in SEQ ID NO: 57, the antisense strand structure as shown in SEQ ID NO:

59.

6. A siRNA conjugate, characterized in that, The siRNA conjugate contains the siRNA as described in any one of claims 1 to 5 and a ligand conjugated to the siRNA.

7. The siRNA conjugate according to claim 6, wherein the ligand comprises N-acetylgalactosamine, aliphatic, alicyclic, polycyclic compounds, cholesterol, biotin, vitamins, galactose, lactose, N-acetylglucosamine, or derivatives thereof.

8. The siRNA conjugate according to claim 7, wherein the ligand is GalNAc or a derivative thereof.

9. The siRNA conjugate according to claim 8, wherein the ligand is one or more GalNAc derivatives attached via a monovalent, divalent, or trivalent branched adapter.

10. The siRNA conjugate according to claim 9, wherein the ligand is L96, and L96 is N-(tris(GalNAc-alkyl)-amide-decanoyl)-4-hydroxyproline.

11. The biological material associated with any of the siRNAs described in claims 1 to 10 is any one of the following: 1) A vector containing any one of the siRNAs described in claims 1 to 10; 2) A reagent or kit containing the siRNA as described in any one of claims 1 to 10 or the vector described in 1); 3) A pharmaceutical composition comprising the siRNA molecule as described in any one of claims 1 to 10 and other pharmaceutically acceptable components.

12. The use of the siRNA of claims 1 to 5, the siRNA conjugate of claims 6 to 10, or the pharmaceutical composition of claim 11 in the preparation of a medicament for relieving and / or treating obesity.

13. The use of the siRNA as described in claims 1 to 5, or the siRNA conjugate as described in claims 6 to 10, or the pharmaceutical composition as described in claim 11, in combination with smegglutinin.