Oligonucleotide aptamer specifically binding to EGFR (epidermal growth factor receptor) protein and application of oligonucleotide aptamer

By developing oligonucleotide aptamers that specifically bind to the intracellular domain of the EGFR protein, the off-target effects and drug resistance of EGFR-targeted drugs have been resolved, enabling highly efficient targeted therapy and diagnosis of EGFR and enhancing the efficacy of chemotherapy and immunotherapy.

CN122012512APending Publication Date: 2026-05-12ACADEMY OF MILITARY MEDICAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
ACADEMY OF MILITARY MEDICAL SCIENCES
Filing Date
2026-02-26
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing EGFR-targeting drugs suffer from off-target effects and EGFR target mutations in tumor cells. Traditional treatments are prone to drug resistance, and the stability of aptamer binding and spatial structural characteristics need to be improved.

Method used

Develop oligonucleotide aptamers that specifically bind to the intracellular segment of the EGFR protein, including EG2, EG3 and their variants, modify them with biotin, and use them to prepare targeted drugs and diagnostic reagents, thereby influencing signaling pathway activation and drug delivery through specific recognition of the EGFR protein.

Benefits of technology

It achieves high affinity binding to EGFR protein, inhibits tumor signaling pathways, enhances chemotherapy efficacy, reduces toxic side effects, and improves the accuracy of tumor diagnosis and the effectiveness of immunotherapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012512A_ABST
    Figure CN122012512A_ABST
Patent Text Reader

Abstract

The invention provides an oligonucleotide aptamer specifically binding to EGFR protein and application, and belongs to the technical field of biological medicine. The invention provides a group of oligonucleotide aptamer sequences capable of specifically recognizing an EGFR protein intracellular fragment, the oligonucleotide aptamer sequences comprise EG2 and EG3 oligonucleotide aptamer sequences and modified sequences thereof, and the oligonucleotide aptamers can specifically recognize the EGFR protein intracellular fragment, especially can be combined with recombinant protein consisting of 668th to 1210th amino acids of the EGFR protein without being combined with other irrelevant proteins, so that the EGFR protein intracellular fragment can be specifically recognized. The polypeptide has a potential target spot closing effect, can be applied to the field of new drug research and development based on the EGFR pathway activation principle, and can be applied to research and development of related drugs targeting EGFR.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to an oligonucleotide aptamer that specifically binds to EGFR protein and its application. Background Technology

[0002] Aptamers are single-stranded DNA / RNA molecules screened through the Systematic Evolution of Ligands Exponential Enrichment (SELEX) technique. They can bind to targets (such as proteins and cells) with high specificity and exhibit advantages such as precise targeting, low immunogenicity, and easy modification in tumor treatment. Their long-term application directions and technological prospects in tumor treatment include (1) Aptamers as guide heads, coupled with chemotherapeutic drugs / nucleic acid drugs to achieve precise enrichment at the tumor site. Existing reports have found that AS1411 aptamer (targeting nucleolin): coupled with doxorubicin (Dox), improved efficacy by 3 times and reduced cardiotoxicity by 60% in a breast cancer model. (2) Directly inhibiting tumor signaling pathways and blocking key receptor-ligand interactions. Existing reports have found that ARC-01 aptamer blocks PD-1 / PD-L1 binding (ICP-L1). 50 =2 nM), activate T cell killing, and the ORR of melanoma treatment in phase I clinical trials reached 40%. (3) Regulate the tumor microenvironment (TME) and relieve immunosuppression. Existing reports have found that the CTLA-4 aptamer selectively binds to Treg cells CTLA-4, reversing immune tolerance (5 times higher penetration than antibody).

[0003] EGFR (epidermal growth factor receptor) is a core target for cancer treatment, and its drug development has expanded from first-generation small molecule inhibitors to multiple technological tracks such as bispecific antibodies, antibody-drug conjugates (ADCs), and cell therapy, achieving breakthroughs in overcoming drug resistance and expanding indications. However, due to EGFR target mutations in tumor cells, off-target effects still exist. Aptamers, after modification, exhibit high structural variability and stable binding, and their three-dimensional binding characteristics hold promise as a breakthrough for next-generation EGFR-based anti-tumor drugs. Aptamer drugs developed targeting EGFR, with their advantages of high affinity, low immunogenicity, and easy tumor penetration, represent a new strategy for overcoming resistance to traditional treatments. Summary of the Invention

[0004] This invention provides an oligonucleotide aptamer that specifically binds to the EGFR protein and its application. The oligonucleotide aptamer can specifically recognize the intracellular segment of the EGFR protein and affect the activation of multiple signaling pathways with EGFR as the initiation site. It can be widely used in the research of drug targets for tumor therapy.

[0005] The present invention provides an oligonucleotide aptamer that specifically binds to the EGFR protein, the oligonucleotide aptamer comprising at least one of the following: EG2, EG3, an allosteric variant of EG2, and an allosteric variant of EG3; The nucleotide sequence of EG2 is shown in SEQ ID No. 1, and the nucleotide sequence of EG3 is shown in SEQ ID No. 2.

[0006] In one specific embodiment of the present invention, the variants of EG2 include EG2S, EG2M and EG2SF; The nucleotide sequence of EG2S is shown in SEQ ID No. 3, the nucleotide sequence of EG2M is shown in SEQ ID No. 4, and the nucleotide sequence of EG2SF is shown in SEQ ID No. 5.

[0007] In one specific embodiment of the present invention, the variant of EG3 includes EG3S; The nucleotide sequence of the EG3S is shown in SEQ ID NO.6.

[0008] In one specific embodiment of the present invention, the oligonucleotide aptamer is further modified.

[0009] In one specific embodiment of the present invention, the modification includes biotin modification at the 5' end.

[0010] This invention also provides the application of the above-mentioned oligonucleotide aptamers in the preparation of drugs for the treatment of EGFR-related diseases.

[0011] In one specific embodiment of the present invention, the drug has at least one of the following effects: inhibiting EGFR signaling pathway activation, mediating targeted drug delivery, and enhancing efficacy in combination with immunotherapy.

[0012] This invention also provides the application of the above-mentioned oligonucleotide aptamers in the preparation of EGFR diagnostic reagents.

[0013] The present invention also provides the application of the above-mentioned oligonucleotide aptamers in the preparation of kits targeting EGFR.

[0014] In one specific embodiment of the present invention, the type of the kit includes at least one of the following: aptamer microplate detection kit, immunoprecipitation detection kit, immunofluorescence detection kit, aptamer-binding EIS impedance sensor detection kit or aptamer-binding nanogold colorimetric detection kit, antitumor drug or tumor treatment drug.

[0015] Beneficial effects: This invention provides a set of oligonucleotide aptamer sequences that specifically recognize the intracellular segment of EGFR protein, including EG2 and EG3 oligonucleotide aptamer sequences and their modified sequences. The oligonucleotide aptamers can specifically recognize the intracellular segment of EGFR protein, especially binding to the recombinant protein composed of amino acids 668-1210 of EGFR protein, without binding to other unrelated proteins. They have the potential to block the target and can be applied to the field of new drug development based on the principle of EGFR pathway activation, and can also be applied to the development of related drugs targeting EGFR. Attached Figure Description

[0016] Figure 1 A comparison of the binding affinity between EG2 and EG3 oligonucleotide aptamers and EGFR protein, as well as other unrelated proteins; Figure 2 A comparison of the binding affinity of EG2 and EG3 oligonucleotide aptamers and their modified sequences EG2S, EG2M, EG2SF, EG2SR, and EG3S to EGFR protein and other unrelated proteins. Figure 3 Dissociation curves of EG2 oligonucleotide aptamers bound to different concentrations of EGFR protein; Figure 4 Figure showing the results of docking analysis between EG2 oligonucleotide aptamers and EGFR protein molecules; Figure 5 The figure shows the results of the docking analysis between the EG3 oligonucleotide aptamer and the EGFR protein molecule. Detailed Implementation

[0017] The present invention provides an oligonucleotide aptamer that specifically binds to the EGFR protein, the oligonucleotide aptamer comprising at least one of the following: EG2, EG3, an allosteric variant of EG2, and an allosteric variant of EG3; The nucleotide sequence of EG2 is shown in SEQ ID No. 1, and the nucleotide sequence of EG3 is shown in SEQ ID No. 2.

[0018] Based on SELEX technology, this invention screened two specific oligonucleotide aptamers, EG2 and EG3, for the EGFR protein. Their sequences and their modified sequences are shown below: EG2 (SEQ ID No. 1): GCAATGGGTACGGTACTTCCGTGGGTTCTTTTAGTCTCACCGTTGGATCGCAAAAGTGCACGCTACTTTGCTAA; EG3 (SEQ ID No. 2): GCAATGGGTACGGTACTTCCGTGGGTCCTTCAGTCTCGCCATGCATCGCGCAAAAGTGCACGCTACTTTGCTAA; EG2S (SEQ ID No. 3): ACGGTACTTCCGTGGGTTCTTTTAGTCTCACCGTTGGATCGCAAAAGTGCACGCT; EG2M (SEQ ID No. 4): CAATGGTACGGTACTTCCGTGGGTTCTTTTAGTCTCACCGTTGTAATTAATAAGCAAAAGTGCACGCTACTTTGC; EG2SF (SEQ ID No. 5): GCAATGGGTACGGTACTTCCGTGGGTTCTTTTAGTCTCACCGTTG; EG3S (SEQ ID No. 6): ACGGTACTTCCGTGGGTCCTTCAGTCTCGCCATGCATCGCGCAAAAGTGCACGCT.

[0019] The oligonucleotide aptamers described in this invention can also be modified, including biotin modification at the 5' end. In the embodiments of this invention, experiments have also demonstrated that the EG2, EG3, EG2S, EG2M, EG2SF, and EG3S sequences can specifically bind to EGFR protein without binding to other proteins; furthermore, at concentrations of 66.218 nM, 99.888 nM, 149.27 nM, and 244.467 nM, the EG2 sequence shows significant binding to EGFR, consistent with the binding pattern of aptamers to target proteins.

[0020] This invention also provides the application of the above-mentioned oligonucleotide aptamers in the preparation of drugs for the treatment of EGFR-related diseases.

[0021] EGFR is overexpressed or mutated in various tumors, such as non-small cell lung cancer, colorectal cancer, and breast cancer, and is a core target for tumor targeted therapy. The oligonucleotide aptamer described in this invention can specifically bind to EGFR. By binding to specific structural domains of the EGFR protein, the oligonucleotide aptamer can interfere with the EGFR signaling pathway, protein function, or molecular interaction, thereby enabling multiple applications in the biomedical field, including diagnosis, treatment, and research.

[0022] The oligonucleotide aptamer described in this invention can bind to the ATP-binding site or tyrosine kinase domain site of the cytoplasmic segment (intracellular segment) of the EGFR protein, thereby blocking the binding of EGFR to ATP or inhibiting EGFR dimerization and autophosphorylation, thereby affecting the activation of downstream proliferation and anti-apoptotic signaling pathways such as Ras / Raf / MEK / ERK and PI3K / Akt / mTOR, inducing tumor cell cycle arrest or apoptosis, thus playing a targeted intervention role in the treatment of EGFR-related diseases.

[0023] In this invention, targeted drug delivery can also be mediated by conjugating chemotherapeutic drugs, toxins, radioisotopes, or immunomodulators to the oligonucleotide aptamers to construct a targeted drug delivery system; the oligonucleotide aptamers can serve as targeting ligands to guide the precise enrichment of drugs in tumor cells with high EGFR expression, reducing toxic side effects on normal cells.

[0024] The oligonucleotide aptamers described in this invention can enhance the efficacy of immunotherapy. Some oligonucleotides (such as CpG oligonucleotides) have the dual function of targeting EGFR and activating immune cells: on the one hand, they bind to EGFR to inhibit tumor proliferation, and on the other hand, they activate the immune response of dendritic cells or macrophages. When used in combination with PD-1 / PD-L1 inhibitors, they can enhance the effect of tumor immunotherapy.

[0025] This invention also provides the application of the above-mentioned oligonucleotide aptamers in the preparation of EGFR diagnostic reagents.

[0026] The present invention can also use the oligonucleotide aptamers as molecular probes for qualitative / quantitative detection of EGFR protein in tissues and body fluids, assisting in disease diagnosis and classification. For example, after labeling the oligonucleotide aptamers with fluorescein, enzymes or nanoparticles for pathological histological examination, they can be used as an alternative to immunohistochemistry (IHC) or fluorescence in situ hybridization (FISH) to detect the expression level and localization of EGFR protein in tumor tissues, providing a basis for clinical selection of EGFR-targeted drugs.

[0027] The oligonucleotide aptamer described in this invention can also be used for non-invasive detection of oligonucleotide-based enzyme-linked oligonucleotide adsorption assay (ELONA) or electrochemical sensors in body fluid samples to detect soluble EGFR (sEGFR) in body fluids such as blood, pleural effusion, and cerebrospinal fluid, for early screening, efficacy monitoring, and prognostic assessment of tumors.

[0028] The present invention also provides the application of the above-mentioned oligonucleotide aptamers in the preparation of kits targeting EGFR.

[0029] The types of kits described in this invention include at least one of the following: aptamer microplate detection kit, immunoprecipitation detection kit, immunofluorescence detection kit, aptamer-binding EIS impedance sensor detection kit or aptamer-binding nanogold colorimetric detection kit, antitumor drugs or tumor treatment drugs.

[0030] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, of an oligonucleotide aptamer that specifically binds to EGFR protein and its applications, should not be construed as limiting the scope of protection of the present invention.

[0031] Example 1 (1) Synthesize 5'Biotin-labeled EG2 (SEQ ID No.1), EG3 (SEQ ID No.2), and PLONG-1 (control sequence, SEQ ID No.7: GCATGGTACGGTACTTCC).

[0032] (2) The negative control proteins p21 (Abcam, ab56278), PIG3 (Abcam, ab95857), AKt2 (Sino Biological, 10764-H20B), EGFR-Extracellular protein (Sino Biological, 10001-H08H, Met 1-Ser 645) and the target protein EGFR-Intracellular protein (Sino Biological, 10001-H20B2, Met 668-Ala 1210) were mixed in PBS-MgCl2 buffer (final concentration of 1 ng / μL for all proteins) and added to microplates at 100 μL / well. The plates were then coated overnight at 4°C. The proteins were divided into three treatments: Blank control; p21, PIG3, and AKt2 were negative controls; and EGFR protein was used in the experimental group.

[0033] (3) Discard the coating solution and add 200 μL of blocking solution to each well. Block at room temperature for 30 min.

[0034] (4) The biotin-labeled EG2, EG3 and PLONG-1 sequences were dissolved in the incubation solution at a final concentration of 0.166 nM, and denatured at 100 °C for 5 min. Then, they were immediately placed on ice to cool completely.

[0035] (5) Take 100 μL of the denatured sequence solution and add it to the microplate. Incubate the nucleic acid sequence and the coated protein together at room temperature for 30 min.

[0036] (6) Discard the liquid in the wells and wash each well with 200 μL of PBS-MgCl2 buffer. Repeat the washing 5 times. After the last wash, completely aspirate the liquid from the wells.

[0037] (7) Add 100 μL of streptavidin-conjugated HRP reagent diluted 1:500 to each well, incubate at room temperature for 30 min, discard the liquid in the well, wash the plate 5 times, and repeat the above method.

[0038] (8) Add 100 μL of TMB chromogenic solution to each well and develop the color at room temperature in the dark. When there is a significant color change, add 100 μL of stop solution and read the OD450 nm wavelength of the enzyme-linked immunosorbent assay (ELISA) instrument.

[0039] Statistical analysis was performed on the OD450 readings of different aptamers, and the results are as follows: Figure 1 As shown, EG2 and EG3 can specifically bind to EGFR-Intracellular proteins, but do not bind to EGFR-Extracellular or other proteins.

[0040] Example 2 Comparison of binding affinity between EG2, EG3 oligonucleotide aptamers and their modified sequences EG2S (SEQ ID No. 3), EG2M (SEQ ID No. 4), EG2SF (SEQ ID No. 5), EG2SR (SEQ ID No. 8: GCAAAAGTGCACGCTACTTTGCTAA), and EG3S (SEQ ID No. 6) and EGFR protein and other unrelated proteins. (1) Synthesize 5'Biotin-labeled EG2, EG3, EG2S, EG2M, EG2SF, EG2SR, EG3S, and PLONG-1 sequences.

[0041] (2) Mix the test proteins (experimental group protein EGFR protein and control protein Akt2 protein) in PBS-MgCl2 buffer (final concentration of 1 ng / μL for both), add 100 μL / well to the microplate, and coat overnight at 4°C; The proteins were divided into three treatments: Blank control; Akt2 control protein group; and EGFR protein experimental group.

[0042] (3) Discard the coating solution and add 200 μL of blocking solution to each well. Block at room temperature for 30 min.

[0043] (4) Dissolve the EG2, EG3, EG2S, EG2M, EG2SF, EG2SR, EG3S and PLONG-1 sequences in the incubation solution at a final concentration of 0.166 nM, denature at 100 °C for 5 min and then immediately place them on ice to cool completely.

[0044] (5) Take 100 μL of the denatured sequence solution and add it to the microplate. Incubate the nucleic acid sequence and the coated protein together at room temperature for 30 min.

[0045] (6) Discard the liquid in the wells and wash each well with 200 μL of PBS-MgCl2 buffer. Repeat the washing 5 times. After the last wash, completely aspirate the liquid from the wells.

[0046] (7) Add 100 μL of streptavidin-conjugated HRP reagent diluted 1:1000 to each well, incubate at room temperature for 30 min, discard the liquid in the well, wash the plate 5 times, and repeat the above steps.

[0047] (8) Add 100 μL of TMB chromogenic solution to each well and develop the color at room temperature in the dark. When there is a significant color change, add 100 μL of stop solution and read the OD450 nm wavelength of the enzyme-linked immunosorbent assay (ELISA) instrument.

[0048] Statistical analysis was performed on the OD450 readings of different aptamers, and the results are as follows: Figure 2 As shown, the sequences EG2, EG3, EG2S, EG2M, EG2SF, and EG3S can specifically bind to EGFR-Intracellular proteins, but do not bind to other proteins.

[0049] Example 3 Dissociation curves of EG2 oligonucleotide aptamers binding to different concentrations of EGFR protein (1) Prepare a 50 nM EG2 (5'Biotin modified) solution and EGFR-Intracellular protein solutions with concentration gradients of 0 nM, 29.181 nM, 66.218 nM, 99.888 nM, 149.27 nM and 244.467 nM.

[0050] (2) The GATOR device is configured with a test procedure including prewetting for 600 s, 1000 rpm, baseline for 120 s, 1000 rpm, loading for 300 s, 400 rpm, baseline for 120 s, 1000 rpm, association for 800 s, 1000 rpm, dissociation for 500 s, and 1000 rpm.

[0051] (3) By binding the streptavidin probe to the EG2 sequence and binding the EGFR protein, the binding and dissociation curves are plotted to reflect its affinity.

[0052] like Figure 3 As shown, the EG2 sequence binds significantly to EGFR-Intracellular proteins at concentrations of 66.218 nM, 99.888 nM, 149.27 nM, and 244.467 nM, consistent with the binding pattern of aptamers to target proteins.

[0053] Example 4 EG2 and EG3 oligonucleotide aptamers docking with EGFR protein molecules The 3D structure of the EGFR protein was obtained from the RCSB database based on its full-length amino acid sequence (uniport, P00533). The DNA 3D structures of EG2 and EG3 oligonucleotides were constructed using AlphaFold. Then, molecular docking of the protein and DNA was performed using Hdock software, and the docking results were visualized using Maestro 11.5.

[0054] like Figure 4 The protein LYS846 interacts with DA46 of EG2 via a salt bridge; LYS823 interacts with DA4 of EG2 via a salt bridge and hydrogen bond; ARG986 interacts with DC18 of EG2 via a salt bridge; ARG973 interacts with DA38 of EG2 via a salt bridge and hydrogen bond; and LYS970 interacts with DC37 of EG2 via a salt bridge. Figure 5 The protein shown interacts with EG3 at LYS737 via a salt bridge; ASN700 and TYR764 interact with EG3 at DG55 via hydrogen bonds; LYS860 interacts with EG3 at DG12 via a salt bridge and hydrogen bonds; ARG836 interacts with EG3 at DG12 via a salt bridge and hydrogen bonds with EG3 at DG11; and ARG889 interacts with EG3 at DT63 via a salt bridge. All the amino acid sites described above are within the intracellular region of amino acids 668-1210 of the EGFR protein.

[0055] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An oligonucleotide aptamer that specifically binds to EGFR protein, characterized in that, The oligonucleotide aptamer includes at least one of the following: EG2, EG3, an allosteric variant of EG2, and an allosteric variant of EG3; The nucleotide sequence of EG2 is shown in SEQ ID No. 1, and the nucleotide sequence of EG3 is shown in SEQ ID No.

2.

2. The oligonucleotide aptamer according to claim 1, characterized in that, The variants of EG2 include EG2S, EG2M and EG2SF; The nucleotide sequence of EG2S is shown in SEQ ID No. 3, the nucleotide sequence of EG2M is shown in SEQ ID No. 4, and the nucleotide sequence of EG2SF is shown in SEQ ID No.

5.

3. The oligonucleotide aptamer according to claim 1, characterized in that, The variants of EG3 include EG3S; The nucleotide sequence of the EG3S is shown in SEQ ID NO.

6.

4. The oligonucleotide aptamer according to any one of claims 1 to 3, characterized in that, It also includes modifying the oligonucleotide aptamer.

5. The oligonucleotide aptamer according to claim 4, characterized in that, The modification includes biotin modification at the 5' end.

6. The use of the oligonucleotide aptamer according to any one of claims 1 to 5 in the preparation of a medicament for treating EGFR-related diseases.

7. The application according to claim 6, characterized in that, The drug's effects include at least one of the following: inhibiting EGFR signaling pathway activation, mediating targeted drug delivery, and enhancing efficacy in combination with immunotherapy.

8. The use of the oligonucleotide aptamer according to any one of claims 1 to 5 in the preparation of EGFR diagnostic reagents.

9. The use of the oligonucleotide aptamer according to any one of claims 1 to 5 in the preparation of a kit for targeting EGFR.

10. The application according to claim 9, characterized in that, The kit types include at least one of the following: aptamer microplate detection kit, immunoprecipitation detection kit, immunofluorescence detection kit, aptamer-binding EIS impedance sensor detection kit or aptamer-binding nanogold colorimetric detection kit, antitumor drugs or tumor treatment drugs.