CsBCH1 gene for regulating formation of light yellow petals of cucumber and InDel marker and application of CsBCH1 gene

Abstract

The invention provides a CsBCH1 gene for regulating formation of light yellow petals of cucumber and an InDel marker and application of the CsBCH1 gene, the CsBCH1 gene is a key gene for regulating formation of light yellow petals of cucumber, the function relates to petal carotenoid metabolism, and a new target is provided for research on flower color of cucurbitaceae. The co-dominant InDel marker in the gene can directly and accurately distinguish a homozygous wild type, a homozygous mutant type and a heterozygous type, and the detection method only needs conventional PCR and electrophoresis, and is simple, convenient, rapid and low in cost.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular genetics and breeding technology, specifically involving a CsBCH1 gene that regulates the formation of light yellow petals in cucumbers, an InDel molecular marker developed based on this gene, related primer pairs, and their application in cucumber petal color identification and assisted breeding. Background Technology

[0002] Cucumber (Cucumis sativus L.) is an important vegetable crop of the Cucurbitaceae family. Its crisp, refreshing fruit, rich in nutrients, is highly popular with consumers. Petal color, as an important trait and primary visual signal in plants, plays a crucial role in plant reproduction, directly influencing the flower-visiting preferences and efficiency of pollinating insects, thus affecting pollination efficiency and fruit and seed yield. Generally, cucumber petals are yellow, and their color gradually lightens as the flowering period progresses. Currently, research on the molecular genetic mechanisms of cucumber petal color formation is limited, and the lack of practical molecular markers for breeding restricts the targeted improvement of this trait.

[0003] The inventors discovered a cucumber petal color mutant material, TJ8-3, whose petals consistently exhibit a stable light yellow color throughout its growth period, while its wild-type control, TJ8-11-1, displays a normal yellow color. Genetic analysis indicates that this light yellow petal trait is a single-gene recessive inheritance. To clone the gene controlling this trait and develop markers for molecular breeding, the inventors conducted in-depth research. Summary of the Invention

[0004] The purpose of this invention is to provide a CsBCH1 gene that regulates the formation of light yellow cucumber petals, a molecular marker developed based on key mutation sites of this gene and its specific primer pairs, and its application in rapid identification of cucumber petal color and molecular breeding.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] In a first aspect, the present invention provides a CsBCH1 gene that regulates the formation of light yellow petals in cucumbers. This gene is located on chromosome 5 of the cucumber reference genome CLv4.0, with the gene annotation number CsaV4_5G000248, and encodes β-carotene 3-hydroxylase. The gene contains a 2 bp InDel site in its coding region. The coding sequence (CDS) of the CsBCH1 gene for yellow petals is shown in SEQ ID NO.1, and the CDS sequence for light yellow petals is shown in SEQ ID NO.2.

[0007] SEQ ID NO.1:ATGACGACGGTGATTTCGGCCGTTGCAACCGCCGGGCCGTACCGGTATGATTACGGGAGGTTGTTTCAACGCCCGGCCGCCGGAGCTCCGAGTCCAGGTTTTCCATGGCGGTGTTTTGCGAAACAGAGGTGGAGAAGGAGAAGATTGATGGTTGTGAAGATGAAGAAGAAGAAAAGTGAAGAAGATGAAATGGTTAAGGAATTGAAAATGAGTGTGGAGGAGAAAATGGGGAAGAAGAAAGCAGAAAGAGAGGGTTATTTGATAGCTGCAATTGTTTCGAGCTTTGGGATCACTTCAATGGCCGCCATCGCTGTTTATTACCGTTTCTCTTCCCAAATAATGGAGGGCGGAGAATTTCCACTTTTAGAAATGTTCGGCACTTTTGTACTATCTATTGGTTCTGCTGTGGGCATGGAATTTTGGGCGAGATGGGCTCACAAAGAGCTATGGCATGCTTCGTTATGGGATATGCATGAGTCTCATCACAAGCCGAGGGTTGGAGCATTTGAAAAGAACGATGTGTTTGCAATTATAAACGCGATTCCAGCCATTGCTCTTCTTTCTTTCGGCCTCTTCAATCAAGGCTTCTTTCCCGGCCTTTGTTTTGGTGCCGGTTTGGGAATTACGGTGTTTGGGATGGCCTACATGTTCGTCCACGATGGCCTCGTTCACCGTCGTTTCCCCGTGGGTCCGATAGCCGCTGTCCCCTACTTACGACGTGTCGCTGCTGCTCATCATATCCATCATACGGATAAATTTGACGGAGTTCCATATGGGTTGTTTTTAGGACCCAAGGAACTGGAAGAAGTGGATGGCGAGGAAGAGCTGCAGAAGGAAATTAGGAGGAGAAAGGTTTACAGAAATTAA。

[0008] SEQ ID NO.2:ATGACGACGGTGATTTCGGCCGTTGCAACCGCCGGGCCGTACCGGTATGATTACGGGAGGTTGTTTCAACGCCCGGCCGCCGGAGCTCCGAGTCCAGGTTTTTTCCATGGCGGTGTTTTGCGAAACAGAGGTGGAGAAGGAGAAGATTGATGGTTGTGAAGATGAAGAAGAAGAAAAGTGAAGAAGATGAAATGGTTAAGGAATTGAAAATGAGTGTGGAGGAGAAAATGGGGAAGAAGAAAGCAGAAAGAGAGGGTTATTTGATAGCTGCAATTGTTTCGAGCTTTGGGATCACTTCAATGGCCGCCATCGCTGTTTATTACCGTTTCTCTTCCCAAATAATGGAGGGCGGAGAATTTCCACTTTTAGAAATGTTCGGCACTTTTGTACTATCTATTGGTTCTGCTGTGGGCATGGAATTTTGGGCGAGATGGGCTCACAAAGAGCTATGGCATGCTTCGTTATGGGATATGCATGAGTCTCATCACAAGCCGAGGGTTGGAGCATTTGAAAAGAACGATGTGTTTGCAATTATAAACGCGATTCCAGCCATTGCTCTTCTTTCTTTCGGCCTCTTCAATCAAGGCTTCTTTCCCGGCCTTTGTTTTGGTGCCGGTTTGGGAATTACGGTGTTTGGGATGGCCTACATGTTCGTCCACGATGGCCTCGTTCACCGTCGTTTCCCCGTGGGTCCGATAGCCGCTGTCCCCTACTTACGACGTGTCGCTGCTGCTCATCATATCCATCATACGGATAAATTTGACGGAGTTCCATATGGGTTGTTTTTAGGACCCAAGGAACTGGAAGAAGTGGATGGCGAGGAAGAGCTGCAGAAGGAAATTAGGAGGAGAAAGGTTTACAGAAATTAA。

[0009] Secondly, the present invention provides an InDel molecular marker for identifying the CsBCH1 genotype, named CsBCH1-InDel. This marker corresponds to a 2 bp InDel site in the coding region of the aforementioned gene. Specifically, the InDel molecular marker corresponds to a TT double-base insertion / deletion on the first exon of the coding region of the CsBCH1 gene.

[0010] Thirdly, the present invention provides a specific primer pair for amplifying the CsBCH1-InDel molecular marker, the nucleotide sequence of which is as follows:

[0011] Forward primer CsBCH1-F: 5'-AGGTTGTTTCAACGCCCGGC-3' (SEQ ID NO.3);

[0012] Reverse primer CsBCH1-R: 5'-TCGCAAAACACCGCCATGG-3' (SEQ ID NO.4).

[0013] Fourthly, the present invention provides a kit for identifying the genotype of cucumber petal color, characterized by containing the aforementioned primer pairs. Optionally, the kit may also contain conventional components such as polymerase, dNTPs, and buffer required for PCR reactions.

[0014] Fifthly, the present invention provides the application of the CsBCH1 gene, CsBCH1-InDel marker or primer pair in the following aspects: (1) identifying cucumber petal color; (2) screening cucumber germplasm resources; (3) molecular marker-assisted selection breeding of cucumber petal color.

[0015] In a sixth aspect, the present invention provides a method for identifying the genotype of cucumber petal color, including detecting the status of the CsBCH1-InDel marker. A preferred method includes: extracting DNA, PCR amplification using the primer pair, electrophoresis detection, and genotyping based on fragment size (light yellow petals specifically amplify the DNA sequence shown in SEQ ID NO. 5, with a fragment length of 66 bp; yellow petals specifically amplify the sequence shown in SEQ ID NO. 6, with a fragment length of 64 bp; double bands indicate heterozygosity).

[0016] SEQ ID NO. 5: AGGTTGTTTCAACGCCCGGCCGCCGGAGCTCCGAGTCCAGGTTTTTCCATGGCGGTGTTTTGCGA;

[0017] SEQ ID NO. 6: AGGTTGTTTCAACGCCCGGCCGCCGGAGCTCCGAGTCCAGGTTTTTCCATGGCGGTGTTTTGCGA.

[0018] In a seventh aspect, the present invention provides an application of altering the color of cucumber petals by regulating the expression or function of the CsBCH1 gene (such as through gene editing).

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] 1. Gene Resource Innovation: CsBCH1 was confirmed to be a key gene regulating the formation of light yellow petals in cucumbers, and its function is involved in the metabolism of petal carotenoids, providing a new target for the study of flower color in cucurbitaceous crops.

[0021] 2. Highly efficient and practical markers: The developed markers are intragenic codominant InDel markers, which can directly and accurately distinguish between homozygous wild type, homozygous mutant type and heterozygous type. The detection method only requires routine PCR and electrophoresis, which is simple, fast and inexpensive.

[0022] 3. Significant breeding value: This marker allows for non-destructive screening during the seedling stage, greatly improving selection efficiency, shortening the breeding cycle, and providing a core tool for targeted breeding of cucumber petal color. Attached Figure Description

[0023] Figure 1 This is a comparison of the petal phenotypes of the parental lines TJ8-3 (light yellow) and TJ8-11-1 (yellow) in the examples;

[0024] Figure 2 This is a fine localization of the CsBCH1 gene in the examples;

[0025] Figure 3 This is a schematic diagram of the CsBCH1 gene structure in the example;

[0026] Figure 4 This is a graph showing the relative expression levels of the CsBCH1 gene in different cucumber tissues.

[0027] Figure 5 Electrophoresis diagram of genotyping of some F2 individual plants using CsBCH1-InDel markers. Detailed Implementation

[0028] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0029] In this document, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0030] In this document, when values ​​are described as ranges, it should be understood that such disclosure includes disclosure of all possible subranges within that range, as well as the specific numerical values ​​falling within that range, regardless of whether the specific numerical value or specific subrange is explicitly specified.

[0031] In this article, the terms "multiple" or "more than" are used unless otherwise specified, referring to a quantity greater than or equal to 2. For example, "one or more" means one or more types.

[0032] In this document, the terms "preferred" and "more preferred" are used only to describe implementation methods or embodiments with better effects, and should be understood as not constituting a limitation on the scope of protection of this invention.

[0033] In this document, terms such as "further" are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of protection of this invention.

[0034] In this article, the term "and / or" describes an association between objects, indicating that three relationships can exist. For example, A and / or B means: A or B, or A and B.

[0035] In this document, the term "about" means a specified value of + / - 10%, preferably + / - 5%, and more preferably + / - 1%.

[0036] In this article, the terms “include,” “including,” “have,” “contain,” etc., are all open-ended terms, meaning that they include but are not limited to.

[0037] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar to or equivalent to those described herein may be used in the implementation or testing of this invention.

[0038] The present invention will be described in detail below with reference to embodiments.

[0039] Example 1: Genetic analysis and fine mapping of the light yellow petal trait in cucumber

[0040] Using the light yellow petal self-pollinated line TJ8-3 as the female parent (P1) and the yellow petal self-pollinated line TJ8-11-1 as the male parent (P2), F1 was bred. Figure 1 F1 cells were self-crossed to obtain the F2 population. P1 and P2 cells were backcrossed with F1 cells to obtain BC1P1 and BC1P2, respectively. The phenotypic identification results of the populations are shown in the table below:

[0041] Group Name Number of individual plants Light yellow: Yellow Separation ratio <![CDATA[χ 2 Value <![CDATA[TJ8-3 (P1)]]> 35 35: 0 - <![CDATA[TJ8-11-1 (P2)]]> 30 0: 30 - <![CDATA[F1 (P1 × P2)]]> 62 0: 62 - <![CDATA[BC1P2]]> 96 0: 96 - <![CDATA[BC1P1]]> 103 53: 50 1: 1 0.087 <![CDATA[F2]]> 351 259: 92 3: 1 0.274

[0042] Both F1 and BC1P2 had yellow petals, and the segregation ratio of yellow to light yellow petals in the F2 population was 3:1 (χ²). 2 =0.274), the segregation ratio of the BC1P1 population conforms to 1:1 (χ² = 0.274). 2 = 0.087). Therefore, pale yellow petals are a recessive trait controlled by a single gene.

[0043] Example 2: Genetic mapping and candidate gene identification

[0044] 1. BSA-seq initial localization and fine localization

[0045] Thirty typical light yellow-petaled plants and 30 typical yellow-petaled plants were selected from the F2 population, and whole-genome DNA was extracted to construct a pool of extreme traits and their corresponding parental DNA. High-throughput sequencing was then performed on both. SNP-index analysis located the gene controlling petal color within a 3.02 Mb region on chromosome 5. Figure 2 ).

[0046] Within the initially mapped 3.02 Mb region, six polymorphic InDel sites (HInDel-1 to HInDel-6) were initially selected, and specific primers were designed. These markers were used to genotype 351 F2 monoclonal plants, and 83 recombinant monoclonal plants within the mapped region were screened. Based on phenotypic data analysis, the mapped region was narrowed down to between HInDel-4 and HInDel-5, with a region of 805.2 kb.

[0047] To further narrow down the mapping interval, the applicant developed three additional InDel markers (HInDel-7 to HInDel-9) between HInDel-4 and HInDel-5. Through genotyping and phenotypic identification of key recombinant singles, the target gene was finally precisely mapped to the interval between markers HInDel-7 and HInDel-8. Figure 2 The interval size is 184.0 kb (1,884,322-2,068,351 bp).

[0048]

[0049] 2. Candidate gene analysis

[0050] Combining parental genome resequencing data and annotated genes within the region, a 2 bp InDel ( Figure 3This gene encodes β-carotene 3-hydroxylase, which catalyzes the conversion of cryptoxanthin to lutein. It is speculated that a 2bp insertion in the coding region of the CsBCH1 gene in TJ8-3 caused a frameshift mutation, resulting in an abnormal structure of the β-carotene 3-hydroxylase protein. This affected the enzyme's function, preventing the successful conversion of cryptoxanthin to lutein, thus causing the cucumber petals to become lighter in color.

[0051] 3. Tissue-specific differential expression analysis of the CsBCH1 gene

[0052] To investigate the tissue-specific expression of the CsBCH1 gene, roots, stems, leaves, unpollinated ovaries, petals, and pulp of commercially viable fruits from both parents were collected at the mature stage. The relative expression levels of the CsBCH1 gene were analyzed using qRT-PCR. The results showed that ( Figure 4 In cucumber roots, stems, ovaries, pulp, and leaves, the expression level of the CsBCH1 gene was extremely low or almost non-existent; however, it was significantly highly expressed in cucumber petals, indicating that CsBCH1 is a petal-specific gene. Furthermore, in the yellow-petaled TJ8-11-1 material, the expression level of the CsBCH1 gene was significantly higher than that in the light yellow-petaled TJ8-3 material, indicating a positive correlation between the gene's expression level and petal color. Therefore, this study demonstrates that CsBCH1 is a candidate gene for lighter-colored cucumber flowers.

[0053] Example 3: Development and application of CsBCH1-InDel molecular markers

[0054] Marker and primer design: Codominant PCR primers were designed targeting the 2 bp InDel site in the coding region of the CsBCH1 gene. The forward and reverse primer sequences are SEQ ID NO.3 and NO.4, respectively.

[0055] PCR amplification and detection:

[0056] DNA extraction: Genomic DNA was extracted from the leaves of the parent plants and the samples to be tested using the CTAB method.

[0057] PCR system (20 µL): 10 µL of 2×Taq PCR MasterMix, 0.8 µL each of 10 µM forward and reverse primers, 2 µL of template DNA (~100 ng), and 6.4 µL of ddH2O.

[0058] PCR program: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 53 °C annealing for 30 s, 72 °C extension for 30 s, for a total of 35 cycles; final extension at 72 °C for 5 min.

[0059] Electrophoresis detection: Take 4 µL of PCR product and separate the target band using 8% non-denaturing polyacrylamide gel electrophoresis. After electrophoresis, rinse with pure water for 2 minutes. -1 Stain with AgNO3 solution for 5-7 minutes, then develop with 15 g·L⁻¹ solution. -1 NaOH + 5 mL·L -1 After developing the cucumber with formaldehyde until the bands are clear, the developing reaction is stopped by washing with water, the cucumber is fixed and photographed, and the electrophoresis results are saved. The genotype of the cucumber variety to be tested is determined based on the band pattern.

[0060] Genotype determination: such as Figure 5 As shown, the parent TJ8-11-1 amplified a 64 bp band (allele A), while the light yellow parent TJ8-3 amplified a 66 bp band (allele a). Three genotypes can be clearly distinguished in the F2 population: a 64 bp single band (homozygous yellow petals), a 66 bp single band (homozygous light yellow petals), and a 66 / 64 bp double band (heterozygous, with yellow petals).

[0061] Marker validation: The F2 population was tested using the marker, and the genotype segregation ratio conformed to the Mendelian ratio of 1:2:1, and the genotype and phenotype completely co-segregated, which proved the accuracy and reliability of the marker.

[0062] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A gene CsBCH1 that regulates the formation of light yellow petals in cucumbers, characterized in that, The coding region sequence of the CsBCH1 gene is shown in SEQ ID NO.1 or SEQ ID NO.

2.

2. An InDel molecular marker for identifying the CsBCH1 genotype of claim 1, characterized in that, The InDel molecular marker corresponds to the TT double base insertion / deletion on the first exon of the CsBCH1 gene coding region.

3. A primer pair for amplifying the InDel molecular marker of claim 2, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO.3 and SEQ ID NO.

4.

4. A kit for identifying the genotype of cucumber petal color, characterized in that, It includes the primer pair as described in claim 3.

5. The application of the gene CsBCH1 according to claim 1, the InDel molecular marker according to claim 2, or the primer according to claim 3, characterized in that, The application includes, but is not limited to, any one of the following: (1) Identifying the color phenotype of cucumber petals; (2) Screening and evaluation of petal color-related genotypes in cucumber germplasm resources; (3) Assist in the breeding of cucumber varieties with specific petal colors.

6. A method for identifying the genotype of cucumber petal color, characterized in that, This includes detecting the insertion / deletion status of the CsBCH1-InDel marker as described in claim 2 in the cucumber genome.

7. The method as described in claim 6, characterized in that, Includes the following steps: (1) Extract genomic DNA from the cucumber sample to be tested; (2) Using the genomic DNA obtained in step (1) as a template, perform PCR amplification using the primer pair described in claim 3; (3) The PCR products obtained in step (2) are separated by electrophoresis, and the CsBCH1 genotype is determined according to the size of the amplified fragment.

8. The method as described in claim 7, characterized in that, In step (3): If a single 66 bp band is amplified that is identical to the light yellow petal parent TJ8-3, it is determined to be a homozygous genotype of cucumber with light yellow petals; If a single 64 bp band is amplified, it is determined to be a homozygous genotype with yellow petals; If two bands of 64 bp and 66 bp are amplified simultaneously, it is determined to be a heterozygous genotype.

9. The method according to claim 7, characterized in that, The PCR reaction system consisted of: 0.8 µL each of 10 µM forward and reverse primers, 2 µL template DNA, 10 µL 2×Taq PCRMasterMix, and 6.4 µL ddH2O. The PCR program was as follows: 94 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 53 °C annealing for 30 s, 72 °C extension for 30 s, for a total of 35 cycles; and finally 72 °C extension for 5 min.

10. The application of the CsBCH1 gene as described in claim 1 in regulating cucumber petal color through gene editing, transgenic technology, or molecular marker-assisted selection.

Images