Proteus mirabilis homologous recombination system expression plasmid, expression system, application and gene knockout / knockin method
By constructing expression plasmids for the homologous recombination system of Proteus mirabilis, the problem of genome editing of Proteus mirabilis was solved, achieving efficient gene knockout and heterologous gene knock-in, which promoted the development of vaccine vectors and recombinant oncolytic chassis bacteria.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SOUTH CHINA AGRICULTURAL UNIVERSITY
- Filing Date
- 2025-12-31
- Publication Date
- 2026-05-12
Smart Images

Figure CN122012561A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biology, and more particularly to an expression plasmid for the homologous recombination system of Proteus mirabilis, an expression system, applications, and a method for gene knockout / knock-in. Background Technology
[0002] The homologous recombination processes mediated by the RecET and Redαβγ systems are collectively referred to as Red / ET homologous recombination engineering. This is a genetic manipulation tool derived from bacteriophages. The RecE and RecT homologous recombination proteins originate from Rac prophage, while the Redα, Redβ, and Redγ homologous recombination proteins originate from Lambda phage. There are also similar homologous recombination proteins, Plu2936, Plu2935, and Plu2934, derived from luminescent bacteriophages. This system was initially used for precise knock-in, knock-out, or replacement of target genes at arbitrary locations in the *E. coli* genome. When used in conjunction with site-specific recombinases (Cre / loxP, Flp / FRT) or CRISPR-Cas systems, it can achieve multi-site modifications of the bacterial genome. The successful application of Red / ET recombination engineering has propelled the development of genetic engineering technology as a whole, providing an effective means for gene modification.
[0003] RecE, Redα, and Plu2936 possess 5'–3' exonuclease activity, which degrades the 5' end of dsDNA (Double Strand DNA), turning the 3' end of the DNA molecule into a single-stranded overhang. RecT, Redβ, and Plu2935 are ssDNA (Single Strand DNA) annealing proteins that can stably bind to ssDNA longer than 35 bp and seek homologous sequences for gene recombination through strand invasion, strand annealing, and Beta recombination mechanisms. Redγ and Plu2934 can inhibit the exonuclease activity of RecBCD in E. coli, protecting exogenous linear DNA molecules from degradation, thereby improving homologous recombination efficiency.
[0004] Because phage recombinases have a certain host specificity, the Red / ET system has very low recombination efficiency or even no recombination function in distantly related bacteria. Therefore, it is necessary to explore efficient homologous recombination systems applicable to different strains. Currently, many strains have successfully constructed recombination systems using phage recombination operons, such as *Pseudomonas syringae* pv. Syringae, *Lactobacillus reuteri*, *Photorhabdus*, *Burkholderiales* strain, *Mycobacterium tuberculosis*, *Bacillus subtilis*, and *Agrobacterium*.
[0005] *Proteus mirabilis* is an opportunistic pathogen belonging to the genus *Proteus*. Gustav Hauser first isolated a group of morphologically variable, migratory, facultative anaerobic Gram-negative bacteria from decaying meat in the late 19th century, naming it the genus *Proteus*. Further research revealed a special category within this group that produces various enzymes and unique metabolites, exhibiting gregarious migration and differentiation capabilities; this was named *Proteus mirabilis*.
[0006] Under specific environmental conditions, *Proteus mirabilis* enters a colony migration state, in which cell morphology undergoes extreme elongation, transforming from ordinary short rods (1-2 μm) to long filaments (10-100 μm), an increase in length of approximately 20-40 times. Secondly, the number of flagella surges dramatically, with the density of flagella per unit cell surface increasing more than 50 times, reaching thousands in total, and exhibiting a dense periclinal arrangement, covering the entire cell surface. Multiple studies have shown that bacterial flagella are excellent immune adjuvants, effectively activating the body's immune response. However, current bacterial vaccines often suffer from poor efficacy due to insufficient short-term immune activation. Therefore, the hyperflagellated state of *Proteus mirabilis* gives it strong potential as a vaccine carrier. Furthermore, recent research in the field of anti-tumor studies indicates that migrating *Proteus mirabilis* can be homogeneously distributed in the tumor microenvironment and widely form microthrombi, effectively disrupting the vascular system of tumor cells and blocking their nutrient supply, thus exerting an effective tumor-killing effect. However, the lack of efficient, precise, and convenient genome editing technology severely hinders its application as a vaccine carrier and recombinant oncolytic chassis bacteria. Therefore, it is essential to establish an efficient and simple homologous recombination system in Proteus mirabilis. A search revealed no literature reports on the Red / ET homologous recombination system in Proteus mirabilis, its construction, and its applications. Summary of the Invention
[0007] The purpose of this invention is to provide an expression plasmid for homologous recombination system of Proteus mirabilis. This expression plasmid has a high recombination efficiency in Proteus mirabilis GDMCC 66325 and can also play a recombination role in the standard strain of Proteus mirabilis ATCC35659. The effectiveness of this expression plasmid in recombination operations for Proteus mirabilis was verified by knocking out the hemolysin-related gene hpmA and the biofilm formation-related gene bcsB in Proteus mirabilis GDMCC 66325 and by knocking in heterologous genes directly after the flagellar regulation-related gene cluster.
[0008] In addition, this invention also discloses a homologous recombination system for Proteus mirabilis, its application, and a method for gene knockout / knock-in.
[0009] To achieve the above objectives, this application discloses:
[0010] A homologous recombination system expression plasmid for Proteus mirabilis includes a pBR322 origin of replication, a resistance gene, an arabinose inducible promoter, and a homologous recombination operon derived from Proteus mirabilis.
[0011] The homologous recombination operon is used to encode the T_PM66325 protein, the E_PM66325 protein, the single-chain binding protein SSB, and a pseudorelease protein; the homologous recombination operon is 1115822~119369bp of the genome sequence of Proteus mirabilis GDMCC 66325.
[0012] In the above-mentioned Proteus mirabilis homologous recombination system expression plasmid, the nucleotide sequence of the expression plasmid is shown in SEQ ID No. 1.
[0013] Meanwhile, the present invention also discloses a Proteus mirabilis homologous recombination system, comprising Proteus mirabilis carrying the expression plasmid as described above and an exogenous target gene; the exogenous target gene has a homologous arm matching the gene to be knocked out or replaced; the exogenous target gene achieves the knockout or replacement of a specific gene in Proteus mirabilis by electrotransfer.
[0014] In the above-mentioned Proteus mirabilis homologous recombination system, the length of the homologous arm is not less than 75 bp.
[0015] In the above-mentioned Proteus mirabilis homologous recombination system, the Proteus mirabilis has the accession number GDMCC66325 or ATCC35659.
[0016] Furthermore, this invention also discloses a method for preparing the expression plasmid as described above, comprising the following steps:
[0017] Step 1: Using pBR322 -P BAD -GFP was used as the initial plasmid. The target linear fragment pBR322-P was recovered via reverse PCR. BAD The linear segment pBR322-P BAD A linear fragment containing the pBR322 origin of replication, resistance gene, and arabinose inducible promoter.
[0018] Step 2: The linear fragment pBR322-P obtained in Step 1 for gel recovery BAD The recombinase fragment recET_PM66325, which contains a vector homologous arm, was subjected to in vitro homologous recombination and then co-transformed into DH5α for overnight culture to obtain recombinants.
[0019] The recombinase fragment recET_PM66325 includes a homologous recombination operon and a vector homologous arm;
[0020] After the recombinant was verified to be correct by sequencing, the expression plasmid of the Proteus mirabilis homologous recombination system was obtained.
[0021] Furthermore, this invention also discloses the application of using the *Proteus mirabilis* homologous recombination system as described above to perform gene knockout / knock-in at one or more sites in *Proteus mirabilis*.
[0022] Finally, the present invention also discloses a method for gene knockout / knock-in of Proteus mirabilis, using any of the above-described Proteus mirabilis homologous recombination systems.
[0023] In the above method, the method specifically refers to:
[0024] Competent cells were prepared using Proteus mirabilis carrying the expression plasmids described above;
[0025] The exogenous target gene was electrotransferred into competent cells.
[0026] In the above method, the preparation conditions for competent cells are as follows: initial OD 600 =0.1, 37℃ for 2 h, 37℃ for 1 h, competent cells were prepared at room temperature using 10% glycerol at room temperature;
[0027] The electroporation process conditions for the exogenous target gene into competent cells are as follows: the amount of exogenous target gene is 800–1000 ng, the electroporation voltage is 1350 V / mm, the electroporation buffer is a 10 wt% glycerol solution, the electroporation temperature is room temperature, and the recovery time is 1 h.
[0028] This application has at least the following beneficial effects:
[0029] This invention discloses a *Proteus mirabilis* homologous recombination system composed of an expression plasmid, which has not been reported in the current literature. Furthermore, this invention is the first to describe the expression plasmid pBR322-P of this recombination system. BAD The recombination efficiency of pBR322-P-recET_PM66325 was optimized and applied in Proteus mirabilis. Experimental results showed that pBR322-P BAD The recombination system -recET_PM66325 exhibits high recombination efficiency in *Proteus mirabilis* GDMCC 66325 and also functions in the *Proteus mirabilis* standard strain ATCC35659, indicating a broad-spectrum recombination effect. This invention utilizes the constructed recombination system to achieve the knockout of the hemolysin-related gene hpmA and the biofilm formation-related gene bcsB in *Proteus mirabilis* GDMCC No:66325, as well as the direct knock-in of heterologous genes after flagellar regulation-related gene clusters. The *Proteus mirabilis* recombination system described in this invention can significantly promote genome modification in *Proteus mirabilis*, showing great promise for constructing bacterial vaccines carrying multivalent antigens and for constructing potentiated and attenuated oncolytic bacteria. Attached Figure Description
[0030] Figure 1 The diagram shows the structures of the Redαβγ and RecET operons from Escherichia coli, the plu operon from luminescent bacteria, and the homologous recombination operon from Proteus mirabilis.
[0031] Figure 2 A schematic diagram illustrating the construction of expression plasmids for the Proteus mirabilis recombinant system.
[0032] Figures 3A to 3D The experimental results show the optimization of electroporation conditions for Proteus mirabilis GDMCC 66325; among them,
[0033] Figure 3A One-step growth curve of Proteus mirabilis GDMCC 66325;
[0034] Figure 3B The effect of competent cells prepared at different culture times and temperatures on the electroporation efficiency of *Proteus mirabilis* GDMCC66325. Each experimental group had three parallel samples, n=3;
[0035] Figure 3C The effect of different electroporation buffers and different temperatures on the electroporation efficiency of Proteus mirabilis GDMCC66325. Each experimental group had three parallel samples, n=3;
[0036] Figure 3DThe effect of different amounts of DNA electroporated on the electroporation efficiency of Proteus mirabilis GDMCC 66325. Each experimental group had three replicates, n=3;
[0037] Figure 4A Schematic diagram of the recombination function detection of the Proteus mirabilis recombination system in Proteus mirabilis GDMCC 66325 and Proteus mirabilis standard strain ATCC35659;
[0038] Figure 4B Recombinant expression plasmid pBR322-P BAD -recET_PM66325 was genetically modified in Proteus mirabilis GDMCC 66325 and Proteus mirabilis standard strain ATCC35659, and the correctness of the recombination modification was verified by colony PCR.
[0039] Figure 5A To investigate the effect of different culture times on the recombination efficiency of Proteus mirabilis GDMCC 66325. Each experimental group had three replicates, n=3;
[0040] Figure 5B The effect of different induction times on the recombination efficiency of Proteus mirabilis GDMCC 66325 was investigated. Each experimental group had three parallel samples, n=3.
[0041] Figure 5C The effect of competent cells prepared with different electroporation buffers and at different temperatures on the recombination efficiency of Proteus mirabilis GDMCC66325 was investigated. Each experimental group had three replicates, n=3.
[0042] Figure 5D The effect of different amounts of electroporated DNA on the recombination efficiency of Proteus mirabilis GDMCC 66325 was investigated. Each experimental group had three replicates, n=3.
[0043] Figure 5E The effect of different electroporation temperatures on the recombination efficiency of Proteus mirabilis GDMCC 66325 was investigated. Each experimental group had three parallel samples, n=3.
[0044] Figure 5F The effect of different homologous arm lengths on the recombination efficiency of Proteus mirabilis GDMCC 66325 was investigated. Each experimental group had three parallel samples, n=3.
[0045] Figure 6A The bar chart shows the application verification of knocking out the hemolysin-related gene hpmA and the biofilm formation-related gene bcsB in Proteus mirabilis GDMCC 66325 using the Proteus mirabilis homologous recombination system, as well as the application verification of knocking in the flagellar regulation-related gene cluster.
[0046] Figure 6B The image shows the PCR verification results of knocking out the hemolysin-related gene hpmA and the biofilm formation-related gene bcsB in Proteus mirabilis GDMCC 66325 using the Proteus mirabilis homologous recombination system, as well as the heterologous gene knock-in after knocking into the flagellar regulation-related gene cluster. Detailed Implementation
[0047] The present invention will now be clearly and completely described in conjunction with embodiments thereof. It should be noted that, unless otherwise specified in the embodiments, conditions are performed under conventional conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products. Unless otherwise specified, all parts used in the embodiments of the present invention are parts by weight.
[0048] General notes:
[0049] The *Proteus mirabilis* GDMCC 66325 strain used in the following examples was obtained from South China Agricultural University, and the *Proteus mirabilis* standard strain ATCC35659 was obtained from Oujiang Laboratory; plasmid pBR322-kan-P BAD -GFP, pBR322-amp-P BAD -GFP was obtained from the Shandong University-Helmholtz Institute of Biotechnology.
[0050] pBR322-amp-P BAD -GFP: Based on the pBAD plasmid vector, it consists of the replicon pBR322, an arabinose inducible promoter, and the GFP-RBS-Luc detection gene element from pBRR1 inserted after the inducible promoter (Source: Development and application of an efficient recombineering system for Burkholderia glumae and Burkholderia plantarii), as well as the resistance marker amp (ampicillin resistance gene). The sequence is detailed in SEQ ID No. 2; pBR322-kan-P BAD -GFP: in pBR322-amp-P BAD -The GFP plasmid was obtained by replacing the amp resistance gene with the kanamycin resistance gene.
[0051] pBR322-P BAD -GFP: in pBR322-amp-P BADThe GFP plasmid was obtained by replacing the amp resistance gene with the cm resistance gene (chloramphenicol resistance gene);
[0052] The genome sequence of the standard strain of Proteus mirabilis ATCC35659 is a known sequence; please refer to the genome sequence in the ATCC database. Proteus mirabilis GDMCC 66325 was isolated, sequenced, and deposited in the Guangdong Provincial Center for Microbial Culture Collection; please refer to the genome sequence uploaded by the Guangdong Provincial Center for Microbial Culture Collection.
[0053] Proteus mirabilis GDMCC No:66325 was deposited at the Guangdong Provincial Center for Microbial Culture Collection on May 13, 2025. Its taxonomic name is Proteus mirabilis, its accession number is GDMCC No:66325, and its deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province.
[0054] The standard strain of Proteus mirabilis is ATCC35659.
[0055] Gene sequencing for plasmid construction was performed by Kangwei Century Co., Ltd. Gene synthesis was performed by Genewiz Co., Ltd. Other plasmids not mentioned were commercially available standard plasmids, and the electroporation method used to transform them into recipient bacteria was a standard method. All other reagents and consumables involved were domestically produced. Unless otherwise specified, the experimental methods and reagents used in the examples are standard methods and commercially available reagents in the art.
[0056] Example 1: Construction of homologous recombination expression plasmid for Proteus mirabilis
[0057] Using the amino acid sequences of red β, RecT, and plu 2935 as references, PSI-BLAST analysis was performed on related genes from the genomes of *Proteus mirabilis* and its bacteriophages to search for proteins with potential recombination functions. In *Proteus mirabilis* GDMCC 66325, the exonuclease-recombinase operon recET_PM66325 (1115822~119369 bp of the whole genome of GDMCC66325) was found to be homologous to plu 2935 (reference). Figure 1 It encodes four proteins, including T_PM66325, which contains 294 amino acids and has 46.5% sequence homology with plu 2935; E_PM66325, which contains 232 amino acids and has 59.2% sequence homology with plu2936; and also encodes a single-chain binding protein SSB containing 194 amino acids and a pseudorelease protein.
[0058] refer to Figure 2The recombinant expression plasmid for the *Proteus mirabilis* homologous recombination system was constructed based on the high-copy replicon pBR322, and the recombinant functional protein was induced to express using an arabinose promoter. The homologous recombination system expression plasmid pBR322-P BAD The steps to construct -recET_PM66325 are as follows:
[0059] (1) pBR322-P BAD -GFP was the initial plasmid. The target linear fragment pBR322-P was recovered via reverse PCR (primer R: CCGACCCATTTGCTGTCCA, primer F: GCTTGGCTGTTTTGGCGG). BAD The final recombination of this fragment is located at 1~388bp and 2800~6246bp in SEQ ID No. 1;
[0060] (2) The linear fragment pBR322-P obtained in step (1) for glue recovery BAD The recombinase fragment recET_PM66325, which contains a vector homologous arm (homological arm F is located at 369~388 bp in SEQ ID No. 1, and homologous arm R is located at 2800~2819 bp in SEQ ID No. 1), was then co-transformed into DH5α and cultured overnight.
[0061] (3) The recombinants obtained in step (2) were verified by PCR and whole plasmid sequencing to obtain the expression plasmids of the Proteus mirabilis homologous recombination system. The series of expression plasmids were named pBR322-P BAD -recET_PM66325, its nucleotide sequence is shown in SEQ ID No. 1.
[0062] The PCR procedure is shown in Table 1.
[0063] Table 1 PCR Procedure
[0064]
[0065] Example 2: Optimization of electroporation conditions for Proteus mirabilis GDMCC 66325
[0066] (1) Determination of the growth curve of Proteus mirabilis GDMCC 66325
[0067] First, the growth curve of Proteus mirabilis GDMCC 66325 needs to be determined to identify the optimal duration for preparing competent cell culture.
[0068] Three single clones of Proteus mirabilis GDMCC 66325 were picked and inoculated into 2 ml EP tubes containing 0.5 ml LB liquid medium. The tubes were incubated at 37°C with shaking at 950 rpm for 18–24 h. 100 μl of the seed culture was then added to 900 μl of liquid LB, and the mixture was thoroughly mixed. The OD was then measured. 600 Take an appropriate amount of seed culture and inoculate it into 50 ml of LB liquid medium containing tetracycline (4 μg / ml) to initiate OD. 600 =0.1, 37℃, shake at 200 rpm, and measure OD every 0.5 hours by taking 1 ml of bacterial culture. 600 According to OD at each time point 600 Growth curves of Proteus mirabilis GDMCC 66325 were plotted. The experimental results are shown in [link to experimental results]. Figure 3A Displays when OD starts. 600 When the value is 0.1, the bacteria enter the logarithmic growth phase 2 hours after the adaptation period.
[0069] (2) Effects of different culture times and temperatures on the electroporation efficiency of Proteus mirabilis GDMCC 66325
[0070] Based on the growth curve of Proteus mirabilis GDMCC 66325, the electroporation and recombination culture times were optimized by taking 2-3 time points before and after the logarithmic growth phase.
[0071] 1 ml of *Proteus mirabilis* GDMCC 66325 bacterial culture was taken after 1 h, 1.5 h, 2 h, 2.5 h, and 3 h of incubation, and the OD was measured. 600 The lowest OD in the bacterial culture after 1 hour 600 For standard uniform OD 600 After washing three times with sterile water, competent cells were prepared at room temperature and 4°C, respectively. 1 μg of the test plasmid pBR322-amp-P was added. BAD -GFP was electroporated at 1350 V, recovered at 37°C and 950 rpm for 1 h, and then plated onto MacConkey agar plates containing 100 μg / ml ampicillin and incubated upside down at 37°C. Experimental results are shown below. Figure 3B The results showed that competent cells prepared by culturing for 2.5 h at room temperature had a high OD... 600 The highest electrostatic efficiency is 0.314.
[0072] (3) Effects of different electroporation buffers and temperatures on the electroporation efficiency of Proteus mirabilis GDMCC 66325
[0073] After culturing *Proteus mirabilis* GDMCC 66325 for 2.5 h, each experimental group was washed three times with 10% sucrose solution, 10% glycerol solution, 10% sucrose + HEPES (SH), 10% glycerol + HEPES (GH), and sterile water, respectively. Competent cells were prepared at room temperature and 4℃, respectively, and 1 μg of the test plasmid pBR322-amp-P was added. BAD -GFP was electroporated at 1350 V, recovered at 37°C and 950 rpm for 1 h, and then plated onto MacConkey agar plates containing 100 μg / ml ampicillin and incubated upside down at 37°C. Experimental results are shown below. Figure 3C The results showed that the electroporation efficiency was highest when competent cells were prepared using a 10% glycerol solution.
[0074] (4) Effect of different DNA amounts on the electroporation efficiency of Proteus mirabilis GDMCC 66325
[0075] After culturing *Proteus mirabilis* GDMCC 66325 for 2.5 h, the cells were washed three times with 10% glycerol solution, leaving a 30-50 μl suspension of bacterial cells. The test plasmid pBR322-amp-P was then added at concentrations of 150 ng, 500 ng, 800 ng, 1000 ng, 1500 ng, and 2000 ng, respectively. BAD -GFP, electroporated at 1350 V, recovered at 37℃ and 950 rpm for 1 h, then plated onto MacConkey agar plates containing 100 μg / ml ampicillin and incubated upside down at 37℃. Results are shown below. Figure 3D The results showed that the number of recombinants obtained increased with the increase of DNA amount, but the electroporation efficiency decreased when the amount of DNA was too large. The electroporation efficiency was the highest when the amount of exogenous DNA was 800 ng.
[0076] Based on the above optimization results of electroconversion efficiency, this invention has determined the optimal electroconversion conditions for *Proteus mirabilis* GDMCC 66325: initial OD... 600 The bacterial culture was incubated at 0.1 g / mL at 37 °C with shaking at 950 rpm for 2.5 h. Competent cells were prepared at room temperature using 10% glycerol solution with 800 ng of exogenous DNA.
[0077] Example 3: Detection of recombination function of recombinant system expression plasmids in Proteus mirabilis GDMCC 66325 and Proteus mirabilis standard strain ATCC35659
[0078] The recombinant expression plasmid pBR322-P BAD -recET_PM66325 was electroporated into Proteus mirabilis GDMCC66325 and Proteus mirabilis standard strain ATCC35659, respectively, using the same electroporation protocol as in Example 2.
[0079] pBR322-kan-P BAD Using GFP as a template and HA-del amp-inter kanr-HA F and HA-del amp-inter kanr-HA R as primers, the PCR procedure was as described in Example 1. This yielded a product fragment HA-50 bp-DEL Amp-inter kanr-HA carrying the homologous arm of the replaced amp resistance gene, which was then recovered via gel extraction. The purified PCR fragment HA-50 bp-DEL Amp-inter kanr-HA carrying the homologous arm was electroporated into *Proteus mirabilis* GDMCC 66325 and *Proteus mirabilis* standard strain ATCC35659 containing the recombinant expression plasmid for linear circular recombination.
[0080] HA-del amp-inter kan r -HA F:
[0081] tgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacaggGTCTGACAGTTAGAAAAACTCATCG
[0082] HA-del amp-inter kan r -HA R:
[0083] agcagaaggccatcctgacggatggcctttttgcgtttctacaaactcttGCGCGGAACCCCTATTTGT (Lowercase letters in primers represent homologous arms, and uppercase letters represent primers)
[0084] Three plasmids carrying the recombinant system expression plasmid pBR322-P were selected. BAD Single clones of *Proteus mirabilis* GDMCC 66325 (recET_PM66325) and the standard strain ATCC35659 were inserted into 2 ml EP tubes containing 0.5 ml of liquid LB medium. Ampicillin was used at a concentration of 100 μg / ml. The culture was incubated at 37°C with shaking at 950 rpm for 18–24 h. 40 μl of the seed culture was then inoculated into 1.3 ml of LB liquid medium containing ampicillin (100 μg / ml). The culture was incubated at 37°C with shaking at 950 rpm for 2.5 h. Then, 35 μl of 100 mg / ml arabinose was added, and the culture was incubated at 37°C with shaking at 950 rpm for 40 min to induce recombinase expression. (Uniform OD) 600Afterwards, at room temperature, wash the bacterial cells three times with 1 ml of 10% glycerol, leaving 30-50 μl of suspended bacterial cells. Add 1 μg of purified PCR product to each experimental group, mix well, transfer to a 1 mm Bio-Rad electrode cup, electroporate at 1350V, add 1 ml of LB liquid medium to the electrode cup, pipette twice, and transfer to the previously prepared EP tube. Recover and incubate at 37℃ and 950 rpm for 1 h. After recovery, plate onto MacConkey agar plates containing kanamycin (30 μg / ml), and incubate upside down at 37℃ for 18-24 h. Count the colonies, and compare the recombination efficiency of each recombination system. See [link to table]. Figure 4A .
[0085] After recombination modification using the detection primer intkan check F / R, the correctness of the recombination modification was verified by colony PCR. A correctly replaced band was 1226 bp, while the original plasmid with incorrect replacement showed no band. (See [link to relevant documentation]). Figure 4B Recombinants that were correctly identified by colony PCR were sent for sequencing verification.
[0086] Experimental results showed that colony PCR verification confirmed the correctness of all randomly selected single clones. This indicates that the recombinant expression plasmid pBR322-P in *Proteus mirabilis* GDMCC 66325 and the standard strain ATCC35659 was valid. BAD -recET_PM66325 both showed good recombination activity and were significantly higher in Proteus mirabilis GDMCC 66325.
[0087] intkan check R:GCGATTCCGACTCGTCCAACATC;
[0088] intkan check F:GCAGGACGCCCGCCATAAACTGC.
[0089] Example 4: Optimization of recombination working conditions for recombinant system expression plasmids in Proteus mirabilis GDMCC 66325 to improve recombination efficiency.
[0090] The absorption rate of exogenous DNA by bacteria varies greatly under different growth states. To ensure that the recombination efficiency meets the requirements for genetic modification of microbial DNA molecules, it is necessary to optimize the operating conditions of the recombination system. Based on the study of the optimal transformation conditions of *Proteus mirabilis* GDMCC 66325 in Example 2, this example focuses on the expression plasmid pBR322-P of the recombination system. BADThe recombination working conditions of -recET_PM66325 will be optimized in the following aspects: culture time, induction time, induction temperature, electroporation buffer used to prepare competent cells, temperature for preparing competent cells, amount of DNA used, and length of homologous arms.
[0091] Optimization of incubation time:
[0092] Add 500 µl of LB medium resistant to ampicillin (50 µg / ml) to a 2 ml EP tube, pick *Proteus mirabilis* GDMCC 66325 carrying the pBR322-PBAD-recET_PM66325 plasmid, and incubate at 950 rpm for 18–24 h. Add 1.3 ml of LB medium resistant to ampicillin (50 µg / ml) to a 2 ml EP tube, and inoculate with 40 µl of seed culture (OD). 600 (The value was 0.1). After culturing for 1.0 h, 1.5 h, 2.0 h, 2.5 h, and 3.0 h, the OD values of the bacterial culture at different incubation times were measured. 600 The values were normalized to the lowest value. 35 µl of Ara (100 mg / ml) was added to each tube, and the cells were induced at 37°C for 60 min. Competent cells were then prepared at room temperature using 10% glycerol. 800 ng of the desalted plasmid HA-50 bp-DEL Amp-inter kanr-HA was added, and electroporation was performed at room temperature. After electroporation and rejuvenation for 1 h, the cells were plated onto MacConkey agar plates resistant to kanamycin (30 µg / ml), incubated overnight, and colonies were counted and analyzed. The results are as follows: Figure 5A .
[0093] Induction time optimization:
[0094] Add 500 µl of LB medium resistant to ampicillin (50 µg / ml) to a 2 ml EP tube, pick *Proteus mirabilis* GDMCC 66325 carrying the pBR322-PBAD-recET_PM66325 plasmid, and incubate at 950 rpm for 18–24 h. Add 1.3 ml of LB medium resistant to ampicillin (50 µg / ml) to a 2 ml EP tube, and inoculate with 40 µl of seed culture (OD). 600 After incubation for 2.0 h, 35 µl of Ara (100 mg / ml) was added to each tube, and the culture was induced at 37℃ for 0, 20, 40, 60, and 80 min, respectively. The OD of the bacterial culture was then measured. 600The lowest value (at 20 min) was normalized, and competent cells were prepared at room temperature using 10% glycerol. 800 ng of the desalted plasmid HA-50 bp-DEL Amp-inter kanr-HA was added, and electroporation was performed at room temperature. After electroporation and rejuvenation for 1 h, the cells were plated onto MacConkey agar plates resistant to kanamycin (30 µg / ml), incubated overnight, and colony counts were determined. The results are as follows: Figure 5B .
[0095] Electroporation buffer and temperature optimization
[0096] Add 500 µl of LB medium resistant to ampicillin (50 µg / ml) to a 2 ml EP tube, pick *Proteus mirabilis* GDMCC 66325 carrying the pBR322-PBAD-recET_PM66325 plasmid, and incubate at 950 rpm for 18–24 h. Add 1.3 ml of LB medium resistant to ampicillin (50 µg / ml) to a 2 ml EP tube, and inoculate with 40 µl of seed culture (OD). 600 After incubation for 2.0 h, 35 µl of Ara (100 mg / ml) was added to each tube. Induction was performed at 37℃ for 60 min. Competent cells were then prepared using 10% glycerol, 10% sucrose, 10% glycerol + HEPES, 10% sucrose + HEPES, and distilled water at room temperature and in an ice-water bath. 800 ng of the desalted plasmid HA-50 bp-DEL Amp-inter kanr-HA was added, and electroporation was performed at room temperature. After 1 h of rejuvenation, the cells were plated onto MacConkey agar plates resistant to kanamycin (30 µg / ml), incubated overnight, and colony counts were determined. Results are as follows: Figure 5C .
[0097] The solutions of 10% glycerol, 10% sucrose, 10% glycerol + HEPES, and 10% sucrose + HEPES mentioned herein are water, and the solutes are glycerol, sucrose, glycerol + HEPES, and sucrose + HEPES, with a mass fraction of 10%.
[0098] Optimization of electroporation DNA quantity:
[0099] Add 500 µl of LB medium resistant to ampicillin (50 µg / ml) to a 2 ml EP tube, pick *Proteus mirabilis* GDMCC 66325 carrying the pBR322-PBAD-recET_PM66325 plasmid, and incubate at 950 rpm for 18–24 h. Add 1.3 ml of LB medium resistant to ampicillin (50 µg / ml) to a 2 ml EP tube, and inoculate with 40 µl of seed culture (OD). 600After incubation for 2.0 h, 35 µl of Ara (100 mg / ml) was added to each tube. Induction was performed at 37℃ for 60 min. Competent cells were then prepared using 10% glycerol solution and electroporated at room temperature. Desalted plasmid of HA-50 bp-DEL Amp-inter kanr-HA (200 ng / µl) was added in amounts of 0.5 µl (100 ng), 2.5 µl (500 ng), 4 µl (800 ng), 5 µl (1000 ng), 7.5 µl (1500 ng), and 10 µl (2000 ng), respectively. After electroporation and rejuvenation for 1 h, the cells were plated onto MacConkey agar plates resistant to kanamycin (30 µg / ml), incubated overnight, and colonies were counted and analyzed. The results are as follows: Figure 5D .
[0100] Induction temperature optimization:
[0101] Add 500 µl of LB medium resistant to ampicillin (50 µg / ml) to a 2 ml EP tube, pick *Proteus mirabilis* GDMCC 66325 carrying the pBR322-PBAD-recET_PM66325 plasmid, and incubate at 950 rpm for 18–24 h. Add 1.3 ml of LB medium resistant to ampicillin (50 µg / ml) to a 2 ml EP tube, and inoculate with 40 µl of seed culture (OD). 600 After incubating for 2.0 h, 35 µl of Ara (100 mg / ml) was added to each tube, and the culture was induced at 30℃ and 37℃ for 60 min, respectively. The OD of the bacterial culture was then measured. 600 After normalization, competent cells were prepared using 10% glycerol at room temperature. 800 ng of the desalted plasmid HA-50 bp-DEL Amp-inter kanr-HA was added, and electroporation was performed at room temperature. After 1 h of rejuvenation, the cells were plated onto MacConkey agar plates resistant to kanamycin (30 µg / ml), incubated overnight, and colony counts were determined. Results are as follows: Figure 5E .
[0102] Homologous arm length optimization:
[0103] Add 500 µl of LB medium resistant to ampicillin (50 µg / ml) to a 2 ml EP tube, pick *Proteus mirabilis* GDMCC 66325 carrying the pBR322-PBAD-recET_PM66325 plasmid, and incubate at 950 rpm for 18–24 h. Add 1.3 ml of LB medium resistant to ampicillin (50 µg / ml) to a 2 ml EP tube, and inoculate with 40 µl of seed culture (OD). 600After incubation for 2.0 h, 35 µl of Ara (100 mg / mL) was added to each tube. Induction was performed at 37℃ for 60 min. Competent cells were then prepared using 10% glycerol solution. Electroporation was performed at room temperature, with µl (800 ng) of desalted plasmids of HA-25 bp-DEL Amp-inter kanr-HA (200 ng / µl), HA-50 bp-DELAmp-inter kanr-HA (200 ng / µl), HA-75 bp-DEL Amp-inter kanr-HA (200 ng / µl), and HA-100 bp-DEL Amp-inter kanr-HA (200 ng / µl) added respectively. After 1 h of rejuvenation following electroporation, the cells were plated onto MacConkey agar plates resistant to kan (30 µg / mL), incubated overnight, and colonies were counted and analyzed. The results are as follows: Figure 5F .
[0104] The PCR product of HA-25 bp-DEL Amp-inter kanr-HA was obtained by PCR amplification using pBR322-kan as a template and HA-25bp-delAmp-intkan R and HA-25bp-delAmp-intkan F as primers; pBR322-kan was the pUC plasmid vector.
[0105] The PCR product of HA-75 bp-DEL Amp-inter kanr-HA was obtained by PCR amplification using pBR322-kan as a template and HA-75bp-delAmp-intkan R and HA-75bp-delAmp-intkan F as primers.
[0106] The PCR product of HA-100 bp-DEL Amp-inter kanr-HA was obtained by PCR amplification using pBR322-kan as a template and HA-100bp-delAmp-intkan R and HA-100bp-delAmp-intkan F as primers.
[0107] HA-25bp-delAmp-intkan F:
[0108] cctttttgcgtttctacaaactcttGCGCGGAACCCCTATTTGT
[0109] HA-25bp-delAmp-intkan R:
[0110] tatatgagtaaacttggtctgacagg GTCTGACAGTTAGAAAAACTCATCG
[0111] HA-75bp-delAmp-intkan F:
[0112] ccataaactgccaggcatcaaattaagcagaaggccatcctgacggatggcctttttgcgtttctacaaactcttGCGCGGAACCCCTATTTGT
[0113] HA-75bp-delAmp-intkan R:
[0114] cacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacaggGTCTGACAGTTAGAAAAACTCATCG
[0115] HA-100bp-delAmp-intkan F:
[0116] cggagggtggcgggcaggacgccccgccataaactgccaggcatcaaattaagcagaaggccatcctgacggatggcctttttgcgtttctacaaactcttGCGCGGAACCCCTATTTGT
[0117] HA-100bp-delAmp-intkan R:
[0118] tcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacaggGTCTGACAGTTAGAAAAACTCATCG
[0119] (Lowercase letters in primers represent homologous arms, and uppercase letters represent primers.)
[0120] Recombinant system expression plasmid pBR322-P BAD After recombination modification of -recET_PM66325 in Proteus mirabilis GDMCC 66325, the correctness of the recombination modification was verified by colony PCR as described above.
[0121] The experimental results show that:
[0122] Recombinant system expression plasmid pBR322-P BAD Optimal recombination conditions for -recET_PM66325 in Proteus mirabilis GDMCC 66325: Initial OD 600 =0.1, transfer for 2 h, induction time at 37℃ for 60 min, competent cells were prepared using 10% glycerol solution at room temperature, the amount of exogenous DNA was around 1000 ng, and the length of homologous arms was 75 bp or more.
[0123] Example 5: Application of the novel recombination system of Proteus mirabilis for genetic modification of the genome
[0124] Using the recombinant system to express plasmid pBR322-P BAD -recET_PM66325 genetically modifies the genome in Proteus mirabilis GDMCC 66325.
[0125] The hpmA gene, located at 2728151–2732884 bp in the genome of *Proteus mirabilis* GDMCC 66325, is a gene associated with the expression of hemolysin and is 4734 bp in length. Knocking out the hpmA gene not only simplifies the genome but also weakens the bacteria's hemolytic ability, effectively reducing its virulence and resulting in a safer bacterial chassis.
[0126] The gene bcsB is located at 2784625~2786916 bp in the genome of Proteus mirabilis GDMCC 66325. It is involved in the synthesis and secretion of biofilms and is a key member of the gene cluster related to biofilm formation. The deletion of bcsB will lead to a 30%-40% reduction in biofilm thickness, decreased intercellular adhesion, loose "cell raft" structure during colony migration, and a significant reduction in the colonization efficiency of host epithelial cells. Knocking out this gene can directly affect bacterial biofilm formation and colony migration ability.
[0127] The gene flhDC is located at 2319040~2319390 bp in the genome of Proteus mirabilis GDMCC 66325. It is a regulatory gene cluster related to flagella expression. The application of heterologous gene knock-in was validated by directly following this gene cluster using a homologous recombination system.
[0128] Gene knockout / knock-in of *Proteus mirabilis* was achieved by replacing the target gene with an AmpR PCR fragment containing homologous arms using recombinase. The homologous arms, 80 bp in length, were loaded onto both ends of the AmpR gene via primer synthesis combined with PCR. (See below) Figure 6A and Figure 6B; The AmpR gene is from the CARD database, with the accession number ARO:3000637 (gb|AJ437107.1|209-1069|TEM-30 [Escherichia coli]).
[0129] HA-PM-del bcsB::AmpR F:
[0130] cgtcgtcaaaaagtaaaagcaccggtaaaaagaacaaaaacctctctctctgtgcaatctattaatggggatgactaggtGCGTTTCTACAAACTCTTTTTGTTTATTTTTC
[0131] HA-PM-del bcsB::AmpR R:
[0132] aatgggtaacgcctaataagcaactggcataaatcactttaacaatcatattaagtgtctgttttttcattttattccccTTACCAATGCTTAATCAGTGAGGCAC
[0133] HA-PM-del hmpA::AmpR F:
[0134] ccaaagatcctactcaactactggttaaattttcatacttattttgatctacattcatagcaacaaatggagataactctGCGTTTCTACAAACTCTTTTTGTTTATTTTTC
[0135] HA-PM-del hmpA::AmpR R:
[0136] aaaaagcccacttgtaataatgacaatcaagtgggcttagcttacaaaaaataggcagttactcttttatgaagtatcgaTTACCAATGCTTAATCAGTGAGGCAC
[0137] HA-PM-flhDC::AmpR F:
[0138] ggagataggaggggaagaggaaacaactcaggttatagagtctttaatctataacctgatatttaactttcaatctcgaaTTACCAATGCTTAATCAGTGAGGCAC
[0139] HA-PM-flhDC::AmpR R:
[0140] taaaaaaacgtaaactttccgccaatcctgccgatattaacttacaactgttggatggtcttgaacagtttgcaatgtgaGCGTTTCTACAAACTCTTTTTGTTTATTTTTC
[0141] (Lowercase letters in primers represent homologous arms, and uppercase letters represent primers.)
[0142] Single colonies of genetically manipulated mutant strains were selected for colony PCR verification, see [link to relevant documentation]. Figure 6A and Figure 6B The PCR band length of successfully knocked-out hpmA was 1486 bp, while the PCR band length of wild-type was 5249 bp; the PCR band length of successfully knocked-out bcsB was 2028 bp, while the PCR band length of wild-type was 3349 bp; the PCR band length of successfully knocked-in flhDC was 2329 bp, while the PCR band length of wild-type was 1358 bp.
[0143] hpmA check F:caaggtggttacggcctaagc
[0144] hpmA check R:cttctacaggtaagctcagccta
[0145] bcsB check F:gctgaattacgccagcgtactg
[0146] bcsB check R:catcaggacgtacattaagccatag
[0147] flhDC check F:cgccgcaggtacttcactttc
[0148] flhDC check R:ccggtttgaagacagcgaaac.
[0149] Summarize:
[0150] 1. This invention prepares a Proteus mirabilis homologous recombination system composed of expression plasmids from the Proteus mirabilis homologous recombination system, and this invention is the first to express the recombinant system plasmid pBR322-P. BAD The recombination efficiency of pBR322-P-recET_PM66325 was optimized and applied in Proteus mirabilis. Experimental results showed that pBR322-PBAD -recET_PM66325 exhibits high recombination efficiency in Proteus mirabilis GDMCC 66325 and can also play a recombination role in the Proteus mirabilis standard strain ATCC35659, indicating that this recombination system has a certain broad-spectrum effect.
[0151] 2. This invention utilizes a constructed recombinant system to achieve the knockout of the hemolysin-related gene hpmA and the biofilm formation-related gene bcsB from *Proteus mirabilis* GDMCC 66325, and the direct knock-in of heterologous genes after flagellar regulation-related gene clusters. The *Proteus mirabilis* recombinant system described in this invention can greatly promote genome modification of *Proteus mirabilis*, and has great application potential in constructing bacterial vaccines carrying multivalent antigens and constructing potentiated and attenuated oncolytic bacteria.
Claims
1. An expression plasmid for a homologous recombination system of Proteus mirabilis, characterized in that, This includes the pBR322 origin of replication, resistance gene, arabinose inducible promoter, and homologous recombination operon derived from Proteus mirabilis; The homologous recombination operon is used to encode the T_PM66325 protein, the E_PM66325 protein, the single-chain binding protein SSB, and a pseudorelease protein; the homologous recombination operon is 1115822~119369bp of the genome sequence of Proteus mirabilis GDMCC No:66325.
2. The expression plasmid for the *Proteus mirabilis* homologous recombination system according to claim 1, characterized in that, The nucleotide sequence of the expression plasmid is shown in SEQ ID No.
1.
3. A homologous recombination system for Proteus mirabilis, characterized in that, The invention includes *Proteus mirabilis* carrying an expression plasmid as described in claim 1 or 2 and an exogenous target gene; the exogenous target gene has a homologous arm matching the gene to be knocked out or replaced; the exogenous target gene is used to knock out or replace a specific gene in *Proteus mirabilis* via electrotransfer.
4. The Proteus mirabilis homologous recombination system according to claim 3, characterized in that, The length of the homologous arm is not less than 75 bp.
5. The Proteus mirabilis homologous recombination system according to claim 3, characterized in that, The preservation number of the *Proteus mirabilis* is GDMCC No:66325 or ATCC35659.
6. The method for preparing the expression plasmid as described in claim 1 or 2, characterized in that, Includes the following steps: Step 1: Using pBR322 -P BAD -GFP was used as the initial plasmid. The target linear fragment pBR322-P was recovered via reverse PCR. BAD ; The linear segment pBR322-P BAD It is a linear fragment containing the pBR322 origin of replication, the resistance gene, and the arabinose inducible promoter; Step 2: The linear fragment pBR322-P obtained in Step 1 for gel recovery BAD The recombinase fragment recET_PM66325, which contains a vector homologous arm, was subjected to in vitro homologous recombination and then co-transformed into DH5α for overnight culture to obtain recombinants. The recombinase fragment recET_PM66325 includes a homologous recombination operon and a vector homologous arm; After the recombinant was verified to be correct by sequencing, the expression plasmid of the Proteus mirabilis homologous recombination system was obtained.
7. The application of the Proteus mirabilis homologous recombination system as described in any one of claims 3 to 5 for gene knockout / knock-in at one or more sites in Proteus mirabilis.
8. A method for gene knockout / knock-in targeting Proteus mirabilis, characterized in that, The homologous recombination system of Proteus mirabilis as described in any one of claims 3 to 5 was used.
9. The method according to claim 8, characterized in that, The method is specifically as follows: Competent cells were prepared using Proteus mirabilis carrying the expression plasmid as described in claim 1 or 2; The exogenous target gene was electrotransferred into competent cells.
10. The method according to claim 8, characterized in that, The preparation process conditions for the competent cells are as follows: initial OD 600 =0.1, 37℃ for 2 h, 37℃ for 1 h, competent cells were prepared at room temperature using 10% glycerol at room temperature; The electroporation conditions for the exogenous target gene into competent cells are as follows: the amount of exogenous target gene is 800–1000 ng, the electroporation voltage is 1350 V / mm, the electroporation buffer is a 10 wt% glycerol solution, the electroporation temperature is room temperature, and the recovery time is 1 h.