Tongue swab sample preserving fluid and application thereof

By using a tongue swab sample preservation solution and a nucleic acid extraction method combined with ultrasonic magnetic beads enrichment, the problem of low pathogen count in tongue swab samples has been solved, achieving efficient nucleic acid extraction and detection, which is suitable for rapid diagnosis of tuberculosis.

CN122012671APending Publication Date: 2026-05-12SANSURE BIOTECH INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SANSURE BIOTECH INC
Filing Date
2025-10-11
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

The low number and insufficient abundance of pathogens in tongue swab samples make it difficult to detect Mycobacterium tuberculosis.

Method used

The method employs a tongue swab sample preservation solution and its associated nucleic acid extraction and detection method, including a preservation solution with a specific composition, magnetic beads, and nucleic acid detection reagents. Nucleic acid is extracted by a combination of ultrasound and magnetic bead enrichment, and then detected using Taqman quantitative real-time PCR technology.

Benefits of technology

It improves the extraction efficiency and detection sensitivity of Mycobacterium tuberculosis nucleic acid in tongue swab samples, simplifies the operation process, and is suitable for tuberculosis diagnosis in various patient groups.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012671A_ABST
    Figure CN122012671A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of nucleic acid detection, and particularly relates to a tongue swab sample preserving fluid and application thereof. Comprising 20 mM to 100 mM of Tris-HCl or HEPES, 0.3% to 0.6% (v / v) of Tween 20, 0.04% to 0.08% (v / v) of Triton X-100, 0.03% to 0.05% (w / v) of guanidine isothiocyanate, 0.1 mM to 0.3 mM of EDTA-2Na (Ethylene Diamine Tetraacetic Acid), 0.1 wt% to 0.2 wt% of cane sugar and 20 mM to 25 mM of NaOH. The pH value of the tongue swab sample preserving fluid is 7-8, and the tongue swab sample preserving fluid can adapt to enriched magnetic beads, so that effective extraction of low-abundance mycobacterium tuberculosis nucleic acid in a tongue swab sample is realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of nucleic acid detection technology, specifically relating to a tongue swab sample preservation solution and its application. Background Technology

[0002] The Mycobacterium tuberculosis complex (TBC) is a group of pathogens that can cause tuberculosis, mainly including Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium africanum, and Mycobacterium villiforme. Among them, Mycobacterium tuberculosis, Mycobacterium bovis, and Mycobacterium africanum are all pathogenic to humans and can invade organs throughout the body through the respiratory tract, digestive tract, and broken skin and mucous membranes, with pulmonary tuberculosis being the most common.

[0003] Rapid and accurate diagnostic techniques are crucial in tuberculosis prevention and control. These techniques not only expedite patient treatment and reduce suffering, but also effectively curb the spread of the disease, protecting more people from its harm. Currently, the Xpert MTB / RIF Ultra sputum test holds a significant position in tuberculosis diagnosis due to its superior sensitivity and specificity. However, the limitations of this method cannot be ignored—it requires patients to provide sputum samples, a requirement that poses a considerable challenge for special groups such as children, HIV-co-infected individuals, and severely ill patients.

[0004] Therefore, exploring and developing novel, more convenient, and easier-to-operate diagnostic technologies is particularly urgent. Among these, molecular nucleic acid detection has become a superior diagnostic method due to its timeliness, high specificity, and sensitivity. In recent years, non-invasive PCR nucleic acid detection methods using tongue swab samples have gradually attracted attention. This method greatly simplifies the sample collection process, providing patients with a more comfortable testing experience, especially suitable for those who cannot provide sputum samples. Preliminary studies have shown that tongue swab PCR testing is comparable to existing sputum benchmark tests in terms of sensitivity and specificity, demonstrating its great potential for application in tuberculosis diagnosis. Real-time fluorescence PCR technology, through the design of specific primers and probes, dynamically monitors changes in fluorescence signals in real time and automatically analyzes the results, thus providing a specific, time-saving, and convenient detection method that can accurately and efficiently detect Mycobacterium tuberculosis.

[0005] The current limitations of qPCR technology for tuberculosis via tongue swabs are mainly reflected in the low number and insufficient abundance of pathogens in tongue swab samples, making detection difficult. Therefore, this application is hereby submitted. Summary of the Invention

[0006] Based on this, one or more embodiments of this application provide a tongue swab sample preservation solution and its application. The technical solutions include the following:

[0007] One or more embodiments of this application provide a tongue swab sample preservation solution, comprising 20mM-100mM Tris-HCl or HEPES, and 0.3%-0.6% (v / v) Tween 20, 0.04%-0.08% (v / v) Triton X-100, 0.03%-0.05% (w / v) guanidine isothiocyanate, 0.1mM-0.3mM EDTA-2Na, 0.1wt%-0.2wt% sucrose and 20mM-25mM NaOH.

[0008] In some embodiments of this application, the tongue swab sample preservation solution comprises 45mM-55mM Tris-HCl, 0.3%-0.4% (v / v) Tween 20, 0.04%-0.06% (v / v) Triton X-100, 0.03%-0.05% (w / v) guanidine isothiocyanate, 0.1mM-0.2mM EDTA-2Na, 0.1wt%-0.2wt% sucrose, and 20mM-25mM NaOH.

[0009] One or more embodiments of this application provide a nucleic acid extraction product of Mycobacterium tuberculosis, comprising: the tongue swab sample preservation solution; or, one or more of magnetic beads and swabs, and the tongue swab sample preservation solution.

[0010] In some embodiments of this application, the nucleic acid extraction product satisfies one or more of the following conditions:

[0011] (1) The magnetic beads include one or more of silanol-modified magnetic beads and amino-modified magnetic beads; optionally, the magnetic beads include amino-modified magnetic beads; and,

[0012] (2) The swab includes one or more of the following: sponge swab, flocked swab and swab with different break points; optionally, the swab includes swab with different break points.

[0013] One or more embodiments of this application provide a detection kit for Mycobacterium tuberculosis, the detection kit comprising: 1) the tongue swab sample preservation solution or the nucleic acid extraction product; and 2) a nucleic acid detection reagent; optionally, the nucleic acid detection reagent is a lyophilized reagent.

[0014] In some embodiments of this application, the nucleic acid detection reagent includes a PCR detection reagent; optionally, the nucleic acid detection reagent includes one or more of primers, probes, PCR buffers, dNTPs, hot-start enzymes, and UDG enzymes.

[0015] In some embodiments of this application, the nucleic acid detection reagent detects the IS6110 gene and / or the IS1081 gene; optionally, the nucleic acid detection reagent includes one or more sets of the following primer probes: primer probes shown in SEQ ID NO.2 to SEQ ID NO.4, primer probes shown in SEQ ID NO.5 to SEQ ID NO.7, primer probes shown in SEQ ID NO.8 to SEQ ID NO.10, primer probes shown in SEQ ID NO.12 to SEQ ID NO.14, primer probes shown in SEQ ID NO.15 to SEQ ID NO.17, primer probes shown in SEQ ID NO.18 to SEQ ID NO.20, and primer probes shown in SEQ ID NO.22 to SEQ ID NO.24.

[0016] One or more embodiments of this application provide a method for processing a Mycobacterium tuberculosis tongue swab sample, the method comprising: placing the tongue swab sample to be tested in the tongue swab sample preservation solution to prepare the sample solution to be tested.

[0017] In some embodiments of this application, the processing method uses the aforementioned nucleic acid extraction product;

[0018] Optionally, the processing method further includes: sonicating the sample solution to be tested, adding the magnetic beads for nucleic acid enrichment, collecting the magnetic beads adsorbed with nucleic acid, and preparing the nucleic acid to be tested; optionally, the sonication conditions include: frequency of 35-38kHz, power of 80%-90%, pressure of 170kPa-190kPa, or / and, and time of 1.5-3min; optionally, 1μL-2μL of magnetic bead suspension with a concentration of 2.5mg / mL-5mg / mL is added to each 1mL of the sample solution to be tested.

[0019] One or more embodiments of this application provide a method for detecting Mycobacterium tuberculosis in tongue swab samples, the detection method comprising:

[0020] The tongue swab sample to be tested is processed using the aforementioned processing method; optionally, the nucleic acid detection reagent as defined above is used for detection.

[0021] Details of one or more embodiments of this application are set forth in the following description, and other features, objects, and advantages of this application will become apparent from the specification and its claims. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of this application and to more completely understand this application and its beneficial effects, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 The primer and probe screening results are for the IS6110 and IS1081 genes in Example 1.

[0024] Figure 2 The image shows the amplification and detection effect of the dual-target gene primer-probe combination in Example 1; the blue curve represents the FAM channel, indicating the target; the red curve represents the CY5 channel, indicating the internal standard.

[0025] Figure 3 The image shows the anti-interference QC amplification detection effect of Manufacturer 1 Magnetic Bead-1 (silicone hydroxyl magnetic beads) in Example 2; Left image: Control; Right image: With magnetic beads.

[0026] Figure 4 The image shows the anti-interference QC amplification detection effect of the manufacturer's magnetic bead-2 (amino-modified magnetic bead) in Example 2; left image: control; right image: with magnetic beads.

[0027] Figure 5 The image shows the QC amplification detection effect of the manufacturer's two magnetic beads (ammonium salt functional groups) in Example 2, which exhibits anti-interference properties. Left image: Control; Right image: Magnetic beads added.

[0028] Figure 6 The results of QC amplification of 0.5 μL 2.5 mg / mL magnetic beads in Example 2 are shown; left: control; right: 0.5 μL.

[0029] Figure 7 The results of QC amplification of 1 μL 2.5 mg / mL magnetic beads in Example 2 are shown; left: control; right: 1 μL.

[0030] Figure 8 The results of QC amplification of 2 μL 2.5 mg / mL magnetic beads in Example 2 are shown; left: control; right: 2 μL.

[0031] Figure 9 The results of QC amplification of 1 μL 5 mg / mL magnetic beads against interference in Example 2 are shown; left: control; right: 1 μL.

[0032] Figure 10 The results of QC amplification of the interference resistance of 2μL 5mg / mL magnetic beads in Example 2 are shown; left: control; right: 2μL.

[0033] Figure 11 The results of QC amplification of the interference resistance of 3μL 5mg / mL magnetic beads in Example 2 are shown; left: control; right: 3μL.

[0034] Figure 12 The image shows the QC plasmid enrichment results of the manufacturer's magnetic bead-1 (silicone hydroxyl magnetic beads) in Example 2; first row left: not enriched; first row right: supernatant; second row: enriched.

[0035] Figure 13 The image shows the enrichment results of the QC plasmid from Manufacturer 1 (Magnetic Bead-2) in Example 2; first row left: not enriched; first row right: supernatant; second row: enriched.

[0036] Figure 14 The results of QC enrichment of the 25 mg / mL magnetic beads from the manufacturer in Example 2 are shown below; first row left: no enrichment; first row right: supernatant; second row: enrichment.

[0037] Figure 15 The enrichment results for the manufacturer's magnetic beads - 2 5mg / mL magnetic bead quality control material - 0.5cfu in Example 2; first row left: no enrichment; first row right: supernatant; second row: enrichment.

[0038] Figure 16 The enrichment results of the manufacturer's magnetic beads - 2 5mg / mL magnetic bead quality control material - 0.1cfu in Example 2; first row left: no enrichment; first row right: supernatant; second row: enrichment.

[0039] Figure 17 The results of QC enrichment of 2.5 mg / mL magnetic beads from Manufacturer 1 in Example 2 are shown below; first row left: no enrichment; first row right: supernatant; second row: enriched.

[0040] Figure 18 The enrichment results of the 2.5 mg / mL magnetic bead quality control material (0.5 CFU) from the manufacturer in Example 2 are shown below; first row left: no enrichment; first row right: supernatant; second row: enriched.

[0041] Figure 19 The enrichment results of the 2.5 mg / mL magnetic bead quality control material (0.1 CFU) from the manufacturer in Example 2 are shown below; first row left: no enrichment; first row right: supernatant; second row: enriched.

[0042] Figure 20 The enrichment results of sample 2-1 of manufacturer-1 magnetic bead-2 (amino-modified magnetic bead) in Example 2 are shown; first row left: supernatant; first row right: enrichment.

[0043] Figure 21The enrichment results of sample 2-2 of manufacturer-1 magnetic bead-2 (amino-modified magnetic bead) in Example 2 are shown; first row left: supernatant; first row right: enrichment.

[0044] Figure 22 The enrichment results of sample 2-3 of the manufacturer's magnetic bead-2 (amino-modified magnetic bead) in Example 2 are shown; first row left: supernatant; first row right: enrichment.

[0045] Figure 23 The results of sample detection using different extraction methods in Example 2 are shown below; first row left: ultrasound; first row right: ultrasound + magnetic bead extraction; second row: ultrasound + magnetic bead enrichment.

[0046] Figure 24 The results show the compatibility test results between the preservation solution-1 and the magnetic beads in Example 3; Left: 50 CFU / mL-1000X; Right: 10 CFU / mL-1000X.

[0047] Figure 25 The results show the compatibility test results between the preservation solution-2 and the magnetic beads in Example 3; Left: 50 CFU / mL-1000X; Right: 10 CFU / mL-1000X.

[0048] Figure 26 The results show the compatibility test results between the preservation solution-3 and the magnetic beads in Example 3; Left: 50 CFU / mL-1000X; Right: 10 CFU / mL-1000X.

[0049] Figure 27 The results of sample collection using different types of swabs in Example 4 are shown below; first row left: swab-1; first row right: swab-2; second row: swab-3.

[0050] Figure 28 The results are the target detection limit test results in Example 6.

[0051] Figure 29 The result is the precision detection result in Example 6.

[0052] Figure 30 This is the specific detection result in Example 6. Detailed Implementation

[0053] The present application will be further described in detail below with reference to the accompanying drawings, embodiments, and examples. It should be understood that these embodiments and examples are for illustrative purposes only and are not intended to limit the scope of the present application. The purpose of providing these embodiments and examples is to enable a more thorough and comprehensive understanding of the disclosure of the present application. It should also be understood that the present application can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various modifications or alterations without departing from the spirit of the present application, and the equivalent forms obtained also fall within the protection scope of the present application. Furthermore, numerous specific details are set forth in the following description to provide a fuller understanding of the present application. It should be understood that the present application can be implemented without one or more of these details.

[0054] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein in the specification of this application is for descriptive purposes only and is not intended to be limiting of the application.

[0055] the term

[0056] Unless otherwise stated or in case of contradiction, the terms or phrases used herein shall have the following meanings:

[0057] The terms "and / or," "or / and," and "and / or" as used herein include any one of two or more of the related listed items, as well as any and all combinations of the related listed items. These arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or," "or / and," and "and / or," it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical AND," and also undoubtedly includes technical solutions connected by "logical OR." For example, "A and / or B" includes three parallel solutions: A, B, and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, a technical solution that is connected by "logical OR"), as well as any and all combinations of A, B, C, and D, that is, combinations of any two or three of A, B, C, and D, and also combinations of all four of A, B, C, and D (that is, a technical solution that is connected by "logical AND").

[0058] In this application, the terms "multiple", "various", "multiple times", "multi-dimensional", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0059] The terms “combinations of,” “any combination of,” and “any combination of” used in this article include all suitable combinations of any two or more of the listed items.

[0060] In this document, the term "suitable" as used in phrases such as "suitable combination," "suitable method," and "any suitable method" refers to the ability to implement the technical solution of this application, solve the technical problem of this application, and achieve the expected technical effect of this application.

[0061] In this document, terms such as “preferred,” “better,” “more suitable,” and “ideal” are merely used to describe implementation methods or examples that achieve better results, and should be understood not to limit the scope of protection of this application.

[0062] In this application, terms such as "further," "even further," and "particularly" are used to describe purposes and indicate differences in content, but should not be construed as limiting the scope of protection of this application.

[0063] In this application, "optionally," "optionally," and "optional" mean that something is optional, that is, it means that it is selected from either "with" or "without." If there are multiple "optional" entries in a technical solution, unless otherwise specified, and there are no contradictions or mutual constraints, each "optional" entry shall be independent.

[0064] In this application, the terms "first aspect," "second aspect," "third aspect," "fourth aspect," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first," "second," "third," "fourth," etc., serve only as a non-exhaustive enumeration and should be understood not to constitute a closed limitation on quantity.

[0065] In this application, the technical features described in an open-ended manner include both closed technical solutions consisting of the listed features and open technical solutions that include the listed features.

[0066] In this application, numerical intervals (i.e., numerical ranges) are involved. Unless otherwise specified, the selected numerical distributions within the aforementioned numerical intervals are considered continuous and include the two endpoints (i.e., the minimum and maximum values) of the numerical range, as well as every value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints. In this document, this is equivalent to directly listing every integer. For example, if t is an integer selected from 1 to 10, it means that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Furthermore, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges to which they are included.

[0067] Unless otherwise specified, the temperature parameters in this application are permitted to be either constant-temperature treatment or variations within a certain temperature range. It should be understood that the constant-temperature treatment allows temperature fluctuations within the precision range of the instrument control, such as ±5℃, ±4℃, ±3℃, ±2℃, or ±1℃.

[0068] In this application, %(w / w) and wt% both represent weight percentage, %(v / v) refers to volume percentage, and %(w / v) refers to mass-volume percentage.

[0069] All references to this application are incorporated herein by reference as if each document were individually incorporated herein by reference. Unless they conflict with the purpose and / or technical solution of this application, all cited references are incorporated herein by reference in their entirety and for all purposes. When references are cited in this application, the definitions of relevant technical features, terms, nouns, phrases, etc., are also incorporated herein by reference. Examples and preferred embodiments of the cited technical features may also be incorporated herein by reference, but only to the extent that they enable the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, this application shall prevail or modifications shall be made adaptably to the description in this application.

[0070] A first aspect of this application provides a tongue swab sample preservation solution, comprising 20mM-100mM Tris-HCl or HEPES, and 0.3%-0.6% (v / v) Tween 20, 0.04%-0.08% (v / v) Triton X-100, 0.03%-0.05% (w / v) guanidine isothiocyanate, 0.1mM-0.3mM EDTA-2Na, 0.1wt%-0.2wt% sucrose, and 20mM-25mM NaOH. The tongue swab sample preservation solution of this application has a pH of 7-8, is compatible with enrichment magnetic beads, and enables effective extraction of low-abundance Mycobacterium tuberculosis nucleic acid from tongue swab samples.

[0071] In the embodiments of this application, the concentrations of Tris-HCl are, for example, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, and 100 mM; the concentrations of Tween 20 are, for example, 0.3%, 0.4%, 0.56%, and 0.6%; the concentrations of Triton X-100 are, for example, 0.04%, 0.05%, 0.06%, 0.07%, and 0.08%; the concentrations of guanidine isothiocyanate are, for example, 0.03%, 0.04%, and 0.05%; the concentrations of EDTA-2Na are, for example, 0.1%, 0.15, 0.2, 0.25, and 0.3 mM; the concentrations of sucrose are, for example, 0.1%, 0.12%, 0.14%, 0.16%, 0.18%, and 0.2%; and the concentrations of NaOH are, for example, 20, 21, 22, 23, 24, and 25 mM.

[0072] In some embodiments of this application, the tongue swab sample preservation solution comprises 45mM-55mM Tris-HCl, 0.3%-0.4% (v / v) Tween 20, 0.04%-0.06% (v / v) Triton X-100, 0.03%-0.05% (w / v) guanidine isothiocyanate, 0.1mM-0.2mM EDTA-2Na, 0.1wt%-0.2wt% sucrose, and 20mM-25mM NaOH. Examples include preservation solution-2 and preservation solution-3 mentioned in the embodiments.

[0073] A second aspect of this application provides a nucleic acid extraction product of Mycobacterium tuberculosis, comprising: the swab sample preservation solution; or, one or more of magnetic beads and swabs, and the swab sample preservation solution.

[0074] In some embodiments of this application, the nucleic acid extraction product satisfies one or more of the following conditions:

[0075] (1) The magnetic beads include one or more of silanol-modified magnetic beads and amino-modified magnetic beads; optionally, the magnetic beads include amino-modified magnetic beads; and,

[0076] (2) The swab includes one or more of the following: sponge swab, flocked swab and swab with different break points; optionally, the swab includes swab with different break points.

[0077] In this embodiment, the magnetic beads used are amino-modified magnetic beads. The amino functional groups (pI 9.5-9.9) on the surface of the amino magnetic beads are protonated (-NH3) at pH < 9.5. + The positively charged nucleic acid phosphate backbone carries a strong negative charge (isoelectric point pH 4.0). Within a certain pH range, the two generate a strong electrostatic attraction, which can achieve efficient binding.

[0078] A third aspect of this application provides a detection kit for Mycobacterium tuberculosis, the detection kit comprising: 1) the swab sample preservation solution or the nucleic acid extraction product described above; and 2) a nucleic acid detection reagent; optionally, the nucleic acid detection reagent is a lyophilized reagent. In some embodiments of this application, the nucleic acid detection reagent includes a PCR detection reagent; optionally, the nucleic acid detection reagent includes one or more of primers, probes, PCR buffer, dNTPs, hot-start enzymes, and UDG enzymes.

[0079] In some embodiments of this application, the nucleic acid detection reagent detects the IS6110 gene and / or the IS1081 gene; optionally, the nucleic acid detection reagent includes one or more sets of the following primer probes: primer probes shown in SEQ ID NO.2 to SEQ ID NO.4, primer probes shown in SEQ ID NO.5 to SEQ ID NO.7, primer probes shown in SEQ ID NO.8 to SEQ ID NO.10, primer probes shown in SEQ ID NO.12 to SEQ ID NO.14, primer probes shown in SEQ ID NO.15 to SEQ ID NO.17, primer probes shown in SEQ ID NO.18 to SEQ ID NO.20, and primer probes shown in SEQ ID NO.22 to SEQ ID NO.24.

[0080] In the nucleic acid detection reagent of this application, the probe is a Taqman fluorescently labeled probe. One end of each probe is labeled with fluorescent reporter groups such as FAM, HEX, VIC, ROX, and CY5, and the other end is labeled with a quencher group.

[0081] A fourth aspect of this application provides a method for processing a Mycobacterium tuberculosis tongue swab sample, the method comprising: placing the tongue swab sample to be tested in the swab sample preservation solution to prepare a sample solution to be tested.

[0082] In some embodiments of this application, the processing method uses the nucleic acid extraction product described above; optionally, the processing method further includes: sonicating the sample solution to be tested, adding the magnetic beads for nucleic acid enrichment, collecting the magnetic beads adsorbed with nucleic acid, and preparing the nucleic acid to be tested.

[0083] The ability to extract high-quality nucleic acids is crucial for molecular nucleic acid detection, and the sensitivity and specificity of the extraction method directly affect the success of subsequent experiments. Traditional nucleic acid extraction methods include ultrasonic lysis, which uses single high-frequency ultrasound (>30kHz) to destroy bacterial cells, but the nucleic acid fragmentation rate is low, resulting in low sensitivity. Magnetic bead extraction is suitable for scenarios with high sensitivity requirements, such as disease control centers, and performs particularly well in low-load samples such as those from HIV co-infection, childhood tuberculosis, and community screening of latent individuals. Magnetic bead extraction utilizes modified magnetic nanoparticles to adsorb nucleic acid or virus particles to complete the entire process of virus enrichment and concentration and nucleic acid extraction. Nucleic acid extraction using magnetic beads involves the binding of magnetic nanoparticles to nucleic acids, achieving separation and purification under the influence of an external magnetic field. Surface-modified magnetic nanoparticles, as novel functional materials, possess magnetic responsiveness and biosafety, and have been widely used in biomedicine. Furthermore, this method is highly automated and theoretically can achieve better stability and sensitivity. Combining ultrasound with magnetic bead enrichment to process samples and capture nucleic acids can theoretically overcome the low sensitivity problem caused by ultrasound alone. The sample processing involves fewer steps, shorter processing time, higher lysis efficiency, and the target nucleic acid capture amount is significantly higher than that of ultrasound or magnetic bead methods alone. This application employs an ultrasound-plus-magnetic-bead enrichment method, and the processing does not require transfer, reducing the risk of sample contamination. This nucleic acid extraction technology has fewer processing steps, can use large sample volumes, increases the recovery rate of nucleic acids in the sample, and reduces the risk of operator contact with the sample during processing.

[0084] Optionally, the ultrasound conditions include: a frequency of 35-38 kHz (e.g., 35, 35.5, 36, 36.5, 37, 37.5, 38 kHz), a power of 80%-90% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%), a pressure of 170 kPa-190 kPa (e.g., 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190 kPa), and / or a duration of 1.5-3 min (e.g., 1.5, 2, 2.5, 3 min);

[0085] Optionally, 0.5 μL to 3 μL (e.g., 0.5, 1, 1.5, 2, 2.5, 3 μL) of magnetic bead suspension with a concentration of 2.5 mg / mL to 5 mg / mL (e.g., 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5 mg / mL) is added to each 1 mL of the test sample solution.

[0086] A fifth aspect of this application provides a method for detecting Mycobacterium tuberculosis in tongue swab samples, the method comprising: preparing a nucleic acid detection sample using the preparation method described above; and detecting the nucleic acid detection sample; optionally, using a nucleic acid detection reagent as defined above for detection.

[0087] The method described in this application employs Taqman quantitative real-time PCR technology for nucleic acid detection. A fluorescent group is added to the PCR reaction system, and the entire PCR process is monitored in real time by accumulating fluorescence signals. Finally, a standard curve is used to quantitatively analyze unknown templates.

[0088] TaqMan quantitative PCR technology is based on TaqMan fluorescent probes, which are specific oligonucleotide sequences labeled with a reporter fluorescent group and a quencher fluorescent group at both ends. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group. If the target sequence is present in the reaction system, the probe binds to the template during the PCR reaction. DNA polymerase uses the 5'-3' exonuclease activity of Taq polymerase to cleave and degrade the probe along the template, separating the reporter group from the quencher group. Thus, the fluorescence monitoring system can receive the fluorescent signal; that is, one fluorescent molecule is generated for each DNA strand amplified. The quantitative PCR instrument can monitor the number of cycles (Ct value) at which fluorescence reaches a preset threshold, which is related to the nucleic acid concentration; the higher the nucleic acid concentration, the lower the Ct value.

[0089] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this application, or follow experimental manuals or conventional conditions in the art, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0090] In the specific embodiments described below, the measurement parameters involving raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.

[0091] Example 1: Design and screening of primers and probes

[0092] Here, MAFFT v7.450 was used to perform comparative analysis on the target genes. Then, with the assistance of Primer Express 3.0 and Primer Premier 5.0 software, and through NCBI Blast specific analysis, primers and probes with better performance were manually screened as candidate primers and probes based on experience. The 5' end of the probe was labeled with a fluorescent reporter group (FAM, HEX, or VIC, ROX, CY5), and the 3' end was labeled with a non-fluorescent quencher to reduce background interference.

[0093] 1. Primer and probe design

[0094] IS6110 gene (SEQ ID NO.1):

[0095] AGCCCGCAGGACCACGATCGCTGATCCGGCCACAGCCCGTCCCGCCGATCTCGTCCAGCGCCGCTTCGGACCACCAGCACCTAACCGGCTGTGGGTAGCAGACCTCACCTATGTGTCGACCTGGGCAGGGTTCGCCTACGTGGCCTTTGTCACCGACGCCTACGTCGCAGGATCCTGGGCTGGCGGGTCGCTTCCACGATGGCCACCTCCATGGTCCTCGACGCGATC GAGCAAGCCATCTGGACCCGCCAACAAGAAGGCGTACTCGACCTGAAAGACGTTATCCACCATACGGATAGGGGATCTCAGTACACATCGATCCGGTTCAGCGAGCGGCTCGCCGAGGCAGGCATCCAACCGTCGGTCGGAGCGGTCGGAAGCTCCTATGACAATGCACTAGCCGAGACGATCAACGGCCTATACAAGACCGAGCTGATCAAACCCGGCAAGCCCTG.

[0096] Table 1

[0097]

[0098] IS1081 gene (SEQ ID NO.11):

[0099] CCGGCTGGCTGGCGTTCTTCCGCGACCTGGTCGCCCGCGGCCTGTCCGGGGTCGCGCTGGTCACCAGCGACGCCCACGCCGGCCTGGTGGCCGCGATCGGCCACCCTGCCCGCAGCGGCCTGGCAGCGCTGCAGAACCCACTACGCAGCCAATCTGATGGCAGCCACCCCGAAGCCCTCCTGGCCGTGGGTGCGCACCCTGCTGCACTCCATCTACGACCAGCCCGACGCCGAATCAGTTGTT GCCCAATATGATCGGGTACTCGACGCTCTGACCGACAAACTCCCCGCGGTGGCCGAGCACCTCGACACCGCCCGCACCGACCTGCTGGCGTTCACCGCTTCCCCCAAGCAGATCTGGCGCCAAATCTGGTCCAACAACCCCCAGGAACGCCTCAACCGAGAGGTACGACGCCGAACCGACGTCGTGGGCATCTTCCCCGACCGCGCCTCGATCATCCGCCTCGTCGGAGCCGTCCTCGCCGAACA.

[0100] Table 2

[0101]

[0102] The primers and probes are designed based on the IS6110 fragment (SEQ ID NO.1) and IS1081 fragment (SEQ ID NO.11) of Mycobacterium tuberculosis. The detection of two target genes and sites can effectively reduce the probability of missed and false detections and improve the accuracy of the kit.

[0103] Internal reference gene RNaseP (SEQ ID NO.21):

[0104] ATTATTGTCTCGGATCCATCTCACTGCAATGTTTTGAGAGCAACTTCTTCAAGGGCCCGGCTCTATGATGTTGTTGCAGTTTTTCCAAAGACAGAAAAGCTTTTTCATATTGCTTGCACACATTTAGATGTGGATTTAGTCTGCATAACTGTAACAGAGAAACTACCATTTTACTTCAAAAGACCTCCTATTAATGTGGCGATTGACCGAGGCCTGGCTTTTGAA.

[0105] Table 3

[0106]

[0107] 2. Establishment of the amplification system

[0108] Real-time fluorescence PCR reaction solution lyophilized beads: Contains enzyme mix, buffer mix, lyophilization protectant, primer and probe mix, etc., as follows:

[0109] Table 4. PCR Reaction Solution

[0110]

[0111] The primer-probe mix is ​​prepared as shown in the table below:

[0112] Table 5. Primer-probe mix

[0113]

[0114] The PCR reaction solution was freeze-dried to prepare lyophilized droplets. The lyophilized droplets of the PCR reaction solution were then mixed with the nucleic acid sample to be tested to prepare the amplification system.

[0115] The PCR amplification program should be set up as follows:

[0116] Table 6

[0117]

[0118] 3. Results Analysis and Judgment

[0119] After the reaction is complete, the results are automatically saved, and the amplification curves of the target genes are analyzed separately. Based on the analyzed images, adjust the Start, End, and Threshold values ​​of the Baseline (users can adjust these values ​​according to their actual situation; the Start value can be set between 3 and 15, and the End value between 5 and 20; adjust the amplification curve of the negative control to make it flat or below the threshold line), click Analyze to perform analysis, and ensure that all parameters meet the requirements in the "Quality Control" section below. Then, record the qualitative results in the Plate window.

[0120] 3.1 Quality Control

[0121] Negative control: No Ct value or Ct > 40 in both FAM and CY5 channels; Positive control: Ct ≤ 35 in both FAM and CY5 channels;

[0122] All of the above requirements must be met simultaneously in the same experiment; otherwise, the experiment is invalid and must be repeated.

[0123] 3.2 Positive cutoff value

[0124] Based on the study of reference values, the reference value for Ct of the target gene detected by this kit is determined to be 40, and the reference value for Ct of the internal standard is also 40.

[0125] 3.3 Interpretation of Test Results

[0126] Clinical specimen test results should be evaluated after positive and negative controls have been tested and determined to be valid and acceptable. If quality controls are ineffective, patient results cannot be interpreted. The table below describes the interpretation of results regarding the use of the above quality controls. End users need to examine the fluorescence curves before final interpretation. For weakly positive samples, all curves are typical S-shaped amplification curves or have no plateau phase (38 ≤ Ct ≤ 40).

[0127] Table 7

[0128]

[0129] For positive samples, the internal standard test result is not required; for negative samples, the internal standard test should be positive. If the internal standard is negative (Ct>35 or no amplification curve (No Ct)), the test result of the sample is invalid. The cause should be investigated and eliminated, and the sample should be resampled and the experiment repeated. For non-human samples, if the endogenous internal standard test of a negative sample is negative, the result is normal and no retest is required.

[0130] 4. Selection of primers and probes

[0131] Based on the highly conserved regions of Mycobacterium tuberculosis, the IS6110 gene (SEQ ID NO.1) and IS1081 gene (SEQ ID NO.11), target plasmid 1 and target plasmid 2 were synthesized, respectively. The target plasmids were diluted with TE-SDS to E5 copies / μL as the nucleic acid to be tested.

[0132] Using the primers and probes listed in Tables 1 to 3, different PCR reaction solutions were prepared according to Table 4. Lyophilized beads were then prepared, and 25 μL of the nucleic acid to be tested was added to each lyophilized bead to prepare different PCR amplification systems. PCR detection was performed on the Hongshi Real-Time PCR instrument using the amplification program shown in Table 6. The results are as follows: Figure 1 As shown: According to Figure 1 The test results showed that the second set of primers and probes for the IS6110 gene and the first set of primers and probes for the IS1081 gene were the most effective. To prevent false negatives, the second set of primers and probes for the IS6110 gene, the first set of primers and probes for the IS1081 gene, and the internal standard primers and probes were selected for combined amplification experiments. In the combined amplification experiments, the working concentrations of IS6110-F2, IS6110-R2, IS6110-P2, IS1081-F1, IS1081-R1, and IS1081-P1 in the amplification system were all 100 pmol / μL. The results are as follows. Figure 2 As shown.

[0133] Subsequent combined amplification experiments were conducted using the primer-probe combination and working concentration determined in this embodiment.

[0134] Example 2: Screening of Magnetic Bead Types and Dosage

[0135] 2.1 Selection of Magnetic Bead Types

[0136] First, the following three types of magnetic beads were selected for anti-interference testing. The first type from Manufacturer 1 (denoted as "Manufacturer 1-1") is a polydisperse magnetic microsphere for direct amplification without washing, with silanol groups on its surface. The second type from Manufacturer 1 (denoted as "Manufacturer 1-2") is an amino-based magnetic microsphere; the polymer shell on the surface of the microsphere provides a large number of cationic groups, and cations have a strong adsorption capacity for nucleic acids. The virus enrichment magnetic bead from Manufacturer 2 is a specialized magnetic polymer bead. Its surface is rich in quaternary ammonium salt functional groups and exhibits superparamagnetism, enabling rapid and reversible binding of negatively charged biomolecules (such as proteins / peptides, enzymes, antibodies, DNA or RNA, viruses, or bacteria) in solution. The main information of the magnetic beads is shown in the table below:

[0137] Table 8

[0138]

[0139] PCR reaction solution was prepared using primers and probes selected in Example 1 above. 5 μL of prepared QC (positive control: target gene plasmid and internal standard gene plasmid both at E5 concentration, mixed in a 1:1 volume ratio) was added to lyophilized beads to prepare the PCR amplification system. 1 μL of 5 mg / mL magnetic beads was added to each test PCR amplification system. PCR detection was performed on the Hongshi Real-Time PCR instrument according to the PCR amplification procedure described in Example 1 above. The results are shown in the table below. Figure 3 , Figure 4 and Figure 5 As shown:

[0140] Table 9

[0141]

[0142] Conclusion: For the detection of QC plasmids, the two magnetic beads (polydisperse magnetic microspheres and amino magnetic microspheres) from Manufacturer 1 are compatible with the reaction system, while the magnetic beads (virus enrichment magnetic beads) from Manufacturer 2 are incompatible with the reaction system and have an inhibitory effect.

[0143] 2.2 Screening of magnetic bead concentration and dosage

[0144] For this amino magnetic microsphere (manufacturer 1-2) which has good anti-interference properties, this application further explored the concentration and dosage. Based on the primers and probes screened in Example 1 above, PCR reaction solutions were prepared. Different concentrations and volumes of magnetic beads were added to each test, while the control group received the same volume of DEPC H2O. The total volume of QC and magnetic beads (DEPC H2O) was 5 μL. QC was detected (same as in section 2.1). PCR amplification was performed on the Hongshi fluorescence quantitative PCR instrument according to the above procedure. The results are shown in the table below. Figure 6 , Figure 7 , Figure 8 , Figure 9 , Figure 10 , Figure 11 As shown:

[0145] Table 10

[0146]

[0147] Conclusion: When different volumes of magnetic beads were added (1.25 μg / test-15 μg / test), the QC Ct value did not change significantly compared with the control (without magnetic beads). However, the absolute fluorescence intensity results showed that the fluorescence intensity began to decrease significantly with the addition of 5 μg / test. The higher the amount added, the lower the fluorescence intensity. Therefore, considering all factors, the final concentration and amount of magnetic beads used were 5 mg / mL and 1.5 μL.

[0148] 2.3 Enrichment capacity test of magnetic beads

[0149] 2.3.1 Manufacturer's Magnetic Beads-1 (Polydispersed Magnetic Microspheres)

[0150] The primers and probes obtained from the previous screening were used to prepare a reaction solution (20 μL), which was then lyophilized to obtain lyophilized droplets. Kobi quality control preservation solution-2 (see Example 3) was diluted to 100 CFU / mL and 50 CFU / mL, respectively, and sonicated using a Sansure sonicator. The sonication parameters were set as follows: sonication time 3 min, power 90%, pressure 180 kPa. 1 mL of the sonicated quality control solution or QC (same as in section 2.1) and 1.5 μL of [unclear text] were added to each 2 mL EP tube. After allowing 5 mg / mL magnetic beads to stand for 3-5 minutes, place them on a magnetic rack. Transfer 975 μL of supernatant to another EP tube. Add 25 μL each of the unenriched nucleic acid, supernatant, and enriched nucleic acid (including magnetic beads) to lyophilized droplets. Set up two replicates. Perform PCR amplification on a Hongshi real-time PCR instrument according to the amplification procedure described in Example 1. Note: This is a manual operation (the subsequent magnetic bead enrichment process is also manual). Instrument operation can also be used, where sonication and magnetic bead enrichment are integrated. The results are shown below:

[0151] Table 11

[0152]

[0153] Conclusion: Based on Table 11 and Figure 12 The results show that there was no significant difference in Ct values ​​between the unenriched QC or quality control samples and the supernatant and enriched nucleic acids, indicating that the manufacturer's magnetic beads-1 (polydisperse magnetic microspheres) had no enrichment effect on this reaction system.

[0154] 2.3.2 Manufacturer's Magnetic Beads-2 (Amino Magnetic Microspheres)

[0155] (1) The enrichment effect of the manufacturer's magnetic bead-2 was tested according to the operation in section 2.3.1, and the results are as follows. Figure 13 As shown. According to Figure 13 As shown, the manufacturer's magnetic bead-2 has an enrichment effect.

[0156] (2) The enrichment effect of the manufacturer's magnetic beads-2 was tested according to the procedure in section 2.3.1. During the test, the quality control sample was set to two dilution levels: 0.5 CFU / mL and 0.1 CFU / mL. Simultaneously, the magnetic bead dosage was set to two dosage levels: 1.5 μL (5 mg / mL) and 1.5 μL (2.5 mg / mL). Two replicates were set up, and all other procedures were the same as in section 2.3.1. The results are shown in Table 12. Figures 14 to 19 As shown:

[0157] Table 12

[0158]

[0159] Conclusion: According to Table 12, Figure 15 The results showed that after sonicating QC and quality control samples, magnetic beads were used for enrichment. After removing the supernatant, the magnetic beads were added together with the enriched samples to lyophilized droplets for PCR reaction. Compared with the detection of unenriched nucleic acids and supernatant, the target Ct value appeared significantly earlier when detecting enriched nucleic acids. The internal standard CY5 channel could also be detected in the unenriched and supernatant channels because the concentration of human tongue swabs was very high. The manufacturer's magnetic beads-2 have amino-modified groups on their surface, which selectively capture MTB nucleic acids and have high adsorption efficiency, showing a significant enrichment effect on this reaction system. This magnetic bead was used to complete the subsequent tests.

[0160] 2.3.3 Sample

[0161] The primers and probes obtained from the previous screening were used to prepare PCR reaction solution (20 μL), which was then lyophilized to obtain lyophilized droplets. Tongue swab samples from the hospital (the patient was diagnosed with tuberculosis positive, and subsequent samples were from the same source and were all tuberculosis positive) were placed in the preservation solution-2 mentioned in Example 3 to prepare the test sample solution. 1 mL of the test sample solution was placed in a 2 mL EP tube and sonicated using a Sansure sonicator. The sonication parameters were set as follows: sonication time of 3 min, power of 90%, and pressure of 180 kPa. Then, 1.5 μL of 5 mg / mL magnetic beads (manufacturer-1 magnetic beads-2) was added. After standing for 3-5 min, the tube was placed on a magnetic rack. 975 μL of supernatant was aspirated into another EP tube. 25 μL of supernatant and enriched nucleic acid (including magnetic beads) were aspirated and added to the lyophilized droplets. Two replicates were set up, and PCR amplification was performed on the Hongshi Real-Time PCR instrument according to the above procedure.

[0162] Table 13

[0163]

[0164] Conclusion: Based on Table 13, Figures 20 to 22 The samples were sonicated and then enriched with magnetic beads. After removing the supernatant, the samples were added to the lyophilized droplet reaction solution (along with the magnetic beads) for detection. Compared with the detection of the supernatant, the enriched nucleic acid, target and internal standard Ct values ​​were significantly earlier.

[0165] 2.3.4 Comparison of Extraction Methods

[0166] The magnetic bead enrichment method was compared with the ultrasound and ultrasound + magnetic bead extraction methods. Among them, samples 2-4 were tongue swab samples from the hospital (the patients were diagnosed with tuberculosis and the subsequent samples came from the same source and were all tuberculosis positive samples). The pretreatment was the same as in section 2.3.3.

[0167] The ultrasound protocol is as follows: Take 1 mL of sample and perform ultrasound using a Sansure ultrasound machine. The ultrasound parameters are set as follows: ultrasound time is 3 min, amplitude is 90%, and pressure is 180 kPa.

[0168] The ultrasonic + magnetic bead extraction protocol is as follows: take 1 mL of sample, centrifuge at 12000 rpm for 3 min, remove 700 μL of supernatant, and then perform ultrasonication under the same conditions as the previous ultrasonic detection protocol. Take 300 μL of nucleic acid after ultrasonication and extract it using nucleic acid extraction reagent (Xiangchang Medical Equipment Registration No. 20150021) (requires 16 min) to obtain nucleic acid for detection.

[0169] The ultrasound + magnetic bead enrichment scheme is as described in section 2.3.3 above.

[0170] The nucleic acids prepared by the above methods were each added in 25 μL to lyophilized PCR reaction solution droplets and tested according to the description in Example 1.

[0171] The results are shown in the table below. Figure 23 As shown:

[0172] Table 14

[0173]

[0174] Conclusion: Based on Table 14 and Figure 17 The test results show that the ultrasound + magnetic bead enrichment method is superior to ultrasound, with the Ct value being 2 points earlier. Compared with the ultrasound + magnetic bead extraction method, there is no significant difference in amplification effect, but the operation steps are simpler and the sample pretreatment is more convenient, with the entire processing time plus detection time being less than 90 minutes.

[0175] Example 3 Screening of different types of preservation solutions

[0176] Three different preservation solutions were prepared to screen the compatibility between the different preservation solutions and magnetic beads. The composition of the different preservation solutions is shown in the table below:

[0177] Table 15

[0178]

[0179] The pH values ​​of preservation solutions 1, 2, and 3 are all between 7.5 and 8.

[0180] Different concentrations of Kobi quality control samples were obtained by diluting with different preservation solutions containing matrix swabs (using Medico swab-2 scraping) (as described in section 2.3.1). The samples were sonicated for 3 min with the same sonication parameters as described in section 2.3.3. Then, 1.5 μL of 5 mg / mL magnetic beads (manufacturer-1 magnetic bead-2) was added. After standing for 3-5 min, the samples were placed on a magnetic rack. 975 μL of supernatant was transferred to another EP tube. 25 μL of supernatant and enriched nucleic acid (including magnetic beads) were then added to lyophilized droplets. Two replicates were prepared, and PCR amplification was performed on a Hongshi real-time PCR instrument according to the above procedure. The results are shown in the table below. Figure 24 , Figure 25 and Figure 26 As shown:

[0181] Table 16

[0182]

[0183] Conclusion: Preservative solution-1 is incompatible with magnetic beads and significantly affects the enrichment of magnetic beads, namely manufacturer-1 magnetic bead-2 (amino-modified magnetic beads). Preservative solution-2 and preservative solution-3 do not affect the enrichment of magnetic beads. After enrichment by preservative solution-2, the Ct value is slightly earlier than that of preservative solution-3.

[0184] Example 4: Screening of different types of swabs

[0185] This embodiment involves the selection of swab types, including several swabs from Medico. The main information is shown in the table below:

[0186] Table 17

[0187]

[0188] The PCR reaction solution was prepared according to Example 1, and after lyophilization, lyophilized droplets were obtained. Tongue swab samples (patients diagnosed with tuberculosis) were collected from the hospital using the three types of swabs mentioned above, and then placed in 1 mL of each of the preservation solutions listed in Table 15 to prepare the sample solution to be tested. The sample was then sonicated using the same parameters as described in section 2.3.4 to prepare the nucleic acid to be tested. 25 μL of the nucleic acid to be tested was added to the lyophilized droplets, and PCR amplification was performed on the Hongshi Real-Time PCR instrument according to the procedure described in Example 1. The results are shown in the table below. Figure 27 As shown:

[0189] Table 18

[0190]

[0191] Conclusion: Swab-2 has a larger sampling area, so the Ct value is higher after swabbing the same sample, making it suitable for taking low-load tongue swab samples.

[0192] Example 5: Optimization of the extraction method

[0193] Because Mycobacterium tuberculosis has a multi-layered cell wall structure, cell wall disruption is very difficult. Therefore, rapid and efficient nucleic acid extraction is crucial for the molecular detection of Mycobacterium tuberculosis. Currently, common methods include glass bead shaking, which may cause fragmentation of long DNA fragments due to high-speed shaking, and poor cell wall disruption due to short shaking time. Another method is nucleic acid extraction or purification reagents, which involve complex procedures and are time-consuming.

[0194] This application attempts to develop a novel nucleic acid extraction method—an ultrasound-magnetic bead enrichment method—for Mycobacterium tuberculosis tongue swab samples. Through multiple comparative tests, the optimal ultrasound parameters were found to be: 90% power, 180 kPa pressure, and continuous operation for 3 minutes.

[0195] For 10 clinical tongue swab samples (patients diagnosed with tuberculosis), the sample solution to be tested was prepared in 1 mL of preservation solution-2 from Example 3. Then, four extraction methods were used to prepare the nucleic acid to be tested: glass bead shaking method, ultrasound + magnetic beads (Xiangchang Medical Device Registration Certificate 20150021), ultrasound, and ultrasound + magnetic beads enrichment. The test results were compared to determine the extraction efficiency.

[0196] The glass bead oscillation method was performed using a TIANGEN grinder. 1 mL of the sample solution to be tested was taken into an EP tube, and an equal amount (equal volume) of glass beads were added. The mixture was vortexed and ground. The grinding program was: 6.0 m / s; grind for 30 s, pause for 30 s, for 6 cycles to prepare the nucleic acid to be tested.

[0197] Other extraction methods are the same as described above (see section 2.3.4).

[0198] The nucleic acids prepared by each extraction method were added in 25 μL to the lyophilized beads from Example 1 to prepare a PCR amplification system. Two replicates were set up, and PCR amplification was performed on the Hongshi Real-Time PCR instrument according to the PCR amplification program of Example 1. The test results are shown in Table 19.

[0199] Table 19 Test results of different extraction methods

[0200]

[0201] Conclusion: The ultrasonic-magnetic bead enrichment method is superior to the glass bead shaking method and ultrasonic method for nucleic acid extraction. The operation steps are simplified to "ultrasonication → sample addition → detection", and the entire extraction and detection process takes ≤90 minutes.

[0202] Example 6 Performance Testing

[0203] 6.1 Sensitivity Test

[0204] Sensitivity (LOD) testing was performed on each target using the following method: The pre-defined rifampicin resistance detection limit reference sample was serially diluted to 20 CFU / mL, 1.5 CFU / mL, 1 CFU / mL, and 0.5 CFU / mL. Then, 1 mL of the reference sample was sonicated using a Sansure sonicator with the same parameters as before (2.3.3). Next, 1.5 μL of 5 mg / mL magnetic beads (amino magnetic microspheres) was added, and the sample was allowed to stand before being placed on a magnetic rack. 975 μL of supernatant was removed, and the remaining nucleic acid (including the magnetic beads) was added to the lyophilized droplets from Example 1. PCR amplification was then performed on the Hongshi Real-Time PCR instrument according to the PCR amplification procedure described in the previous example. Specific detection results (Ct values) are detailed in Table 20 and... Figure 28 .

[0205] Table 20 Target Detection Limit Determination Results

[0206]

[0207] Conclusion: The method in this embodiment has high sensitivity and can detect concentrations up to 1 CFU / mL.

[0208] 6.2 Precision Test

[0209] Strongly positive and weakly positive simulated samples of Mycobacterium tuberculosis were repeatedly tested, with each sample tested 10 times. The strongly positive simulated sample (denoted as R1) was a 1500 CFU / mL target sequence solution prepared by diluting the Kobi quality control sample (as described in section 2.3.1) with preservation solution 2 containing the matrix swab from Example 3; the weakly positive simulated sample (denoted as R2) was a 15 CFU / mL target sequence solution prepared by diluting the Kobi quality control sample with preservation solution 2 containing the matrix swab. Then, 1 mL of the simulated sample was sonicated using a Sansure sonicator with the same sonication parameters as before (2.3.3). Then, 1.5 μL of 5 mg / mL magnetic beads (amino magnetic microspheres) was added, and after standing, the sample was placed on a magnetic rack. 975 μL of supernatant was removed, and the remaining nucleic acid (including the magnetic beads) was added to the lyophilized droplets from Example 1. PCR amplification was performed on a Hongshi real-time PCR instrument according to the PCR amplification procedure described in Example 1. The results are as follows: Figure 29 .

[0210] Conclusion: The results showed that the detection rate of both strong positive and weak positive reference samples was 100%, and the coefficient of variation (CV) of the detection Ct values ​​within and between batches was less than 5%, which indicates that this kit has good detection precision within and between batches.

[0211] 6.3 Specificity analysis

[0212] Using the PCR amplification system and procedure described in Example 1, no nonspecific amplification was observed in *Mycobacterium kansasense*, *Mycobacterium marineum*, *Mycobacterium terrestris*, minor mycobacteria, *Mycobacterium ulcerativeum*, *Mycobacterium Gordonum*, *Mycobacterium avium*, *Mycobacterium scrofula*, *Mycobacterium sugaense*, *Mycobacterium guilloché*, *Mycobacterium abscessum*, *Mycobacterium smegmatis*, *Mycobacterium gastritis*, intracellular mycobacteria, *Mycobacterium spp.*, *Streptococcus pneumoniae*, *Haemophilus influenzae*, *Cryptococcus*, *Nocardia*, and *Pseudomonas aeruginosa*, demonstrating high specificity. The results are as follows: Figure 30 .

[0213] The technical features of the above-described embodiments and examples can be combined in any suitable manner. For the sake of brevity, not all possible combinations of the technical features in the above-described embodiments and examples are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0214] The embodiments described above are merely illustrative of several implementation methods of this application, intended to facilitate a detailed understanding of the technical solutions of this application, but should not be construed as limiting the scope of protection of the patent application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the scope of protection of this application. Furthermore, it should be understood that after reading the above teachings of this application, those skilled in the art can make various alterations or modifications to this application, and the equivalent forms obtained also fall within the scope of protection of this application. It should also be understood that technical solutions obtained by those skilled in the art based on the technical solutions provided in this application through logical analysis, reasoning, or limited experimentation are all within the scope of protection of the appended claims. Therefore, the scope of protection of this patent application should be determined by the content of the appended claims, and the specification and drawings can be used to interpret the content of the claims.

Claims

1. A tongue swab sample preservation solution, characterized in that, It includes 20mM-100mM Tris-HCl or HEPES, as well as 0.3%-0.6% (v / v) Tween 20, 0.04%-0.08% (v / v) Triton X-100, 0.03%-0.05% (w / v) Guanidine isothiocyanate, 0.1mM-0.3mM EDTA-2Na, 0.1wt%-0.2wt% sucrose, and 20mM-25mM NaOH.

2. The tongue swab sample preservation solution according to claim 1, characterized in that, It includes 45mM-55mM Tris-HCl, 0.3%-0.4% (v / v) Tween 20, 0.04%-0.06% (v / v) Triton X-100, 0.03%-0.05% (w / v) Guanidine isothiocyanate, 0.1mM-0.2mM EDTA-2Na, 0.1wt%-0.2wt% sucrose, and 20mM-25mM NaOH.

3. A nucleic acid extract product from Mycobacterium tuberculosis, characterized in that, include: Tongue swab sample preservation solution as described in any one of claims 1 to 2; or, One or more of magnetic beads and swabs, as well as the tongue swab sample preservation solution.

4. The nucleic acid extraction product of Mycobacterium tuberculosis according to claim 3, characterized in that, The nucleic acid extraction product meets one or more of the following conditions: (1) The magnetic beads include one or more of silanol-modified magnetic beads and amino-modified magnetic beads; optionally, the magnetic beads include amino-modified magnetic beads; and, (2) The swab includes one or more of the following: sponge swab, flocked swab and swab with different break points; optionally, the swab includes swab with different break points.

5. A detection kit for Mycobacterium tuberculosis, characterized in that, The detection kit includes: 1) The tongue swab sample preservation solution according to any one of claims 1 to 2 or the nucleic acid extraction product according to any one of claims 3 to 4; and 2) Nucleic acid testing reagents; Optionally, the nucleic acid detection reagent is a lyophilized reagent.

6. The detection kit for Mycobacterium tuberculosis according to claim 5, characterized in that, The nucleic acid detection reagents include PCR detection reagents; Optionally, the nucleic acid detection reagent includes one or more of primers, probes, PCR buffer, dNTPs, hot-start enzymes, and UDG enzymes.

7. The detection kit for Mycobacterium tuberculosis according to claim 6, characterized in that, The nucleic acid detection reagent detects the IS6110 gene and / or the IS1081 gene; Optionally, the nucleic acid detection reagent includes one or more sets of the following primers and probes: The primers and probes shown in SEQ ID NO.2 to SEQ ID NO.4 The primers and probes shown in SEQ ID NO.5 to SEQ ID NO.7 The primers and probes shown in SEQ ID NO.8 to SEQ ID NO.10 The primers and probes shown in SEQ ID NO.12 to SEQ ID NO.14 The primers and probes shown in SEQ ID NO.15 to SEQ ID NO.17 The primers and probes shown in SEQ ID NO.18 to SEQ ID NO.20, and The primers and probes shown in SEQ ID NO.22 to SEQ ID NO.

24.

8. A method for processing tongue swab samples containing Mycobacterium tuberculosis, characterized in that, The processing method includes: The tongue swab sample to be tested is placed in the tongue swab sample preservation solution according to any one of claims 1 to 2 to prepare the sample solution to be tested.

9. The method for processing Mycobacterium tuberculosis tongue swab samples according to claim 8, characterized in that, The processing method uses the nucleic acid extraction product as described in any one of claims 3 to 4; Optionally, the processing method further includes: sonicating the sample solution to be tested, adding the magnetic beads for nucleic acid enrichment, collecting the magnetic beads adsorbed with nucleic acid, and preparing the nucleic acid to be tested; Optionally, the ultrasound conditions include: a frequency of 35-38 kHz, a power of 80%-90%, a pressure of 170 kPa-190 kPa, or / and a duration of 1.5-3 min; Optionally, 1 μL to 2 μL of a magnetic bead suspension with a concentration of 2.5 mg / mL to 5 mg / mL is added to each 1 mL of the sample solution to be tested.

10. A method for detecting Mycobacterium tuberculosis in tongue swab samples, characterized in that, The detection method includes: The tongue swab sample to be tested is processed using the processing method described in any one of claims 8 to 9, and then detected. Optionally, the nucleic acid detection reagent as defined in any one of claims 5 to 7 may be used for detection.