SNP molecular marker related to ancherythroculter nigrocauda hypoxia character and application

By developing a T/G mutation-type SNP molecular marker at base 18588931 on chromosome 23 of the black-tailed culter, and designing primer sets for PCR amplification, the problem of lacking hypoxia-related markers in the existing technology for black-tailed culter was solved, enabling the identification of hypoxia-tolerant individuals and early breeding support.

CN122012739APending Publication Date: 2026-05-12WUHAN ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
WUHAN ACADEMY OF AGRI SCI
Filing Date
2026-03-06
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

The existing technology lacks effective SNP molecular markers related to hypoxia in Culter alburnus, making it difficult to cultivate new hypoxia-tolerant varieties of Culter alburnus through marker-assisted breeding.

Method used

We developed a T/G mutation-type SNP molecular marker at base 18588931 on chromosome 23 of the black-tailed culter fish, and designed a corresponding primer set for PCR amplification and fluorescence signal scanning to determine the fish's hypoxia tolerance.

Benefits of technology

This study provides an effective method for identifying and selecting individuals of the Black-tailed Culter alburnus with strong tolerance to low oxygen levels, supporting early breeding and improving breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012739A_ABST
    Figure CN122012739A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of molecular breeding of aquatic animals, and discloses an ancherythroculter nigrocauda hypoxia character related SNP molecular marker and application, the sequence of the SNP molecular marker is as shown in SEQ ID NO.1, the SNP molecular marker is located at the 653rd site of the nucleotide sequence of SEQ ID NO.1, and the basic group of the SNP molecular marker is T or G. Technical support is provided for early breeding of ancherythroculter nigrocauda, and the molecular marker has application prospects in ancherythroculter nigrocauda low-oxygen character molecular marker-assisted breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular breeding technology for aquatic animals, and in particular to a SNP molecular marker related to the hypoxia trait of the black-tailed culter and its application. Background Technology

[0002] Adequate dissolved oxygen levels in water are crucial for maintaining the normal physiological activities of fish. A sudden drop in dissolved oxygen often leads to "pond overflow" in aquaculture ponds, causing mass fish deaths. This creates an urgent need for the cultivation of new low-oxygen-tolerant commercial fish species. The Black-tailed Culter nigrocauda, ​​also known as the High-shouldered Culter, is a species endemic to China, belonging to the Cyprinidae family, class Cypriniformes. In its natural habitat, the Black-tailed Culter nigrocauda is carnivorous, primarily feeding on small fish, shrimp, aquatic insects, and zooplankton. It is distributed in the upper reaches of the Yangtze River in Sichuan and Chongqing, and also found in Yichang; it is farmed in Hubei and Jiangxi provinces. The Black-tailed Culter nigrocauda is a mid-to-upper-level fish, preferring clean water with high dissolved oxygen levels and abundant plankton.

[0003] Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by a single nucleotide variation at the genomic level. It is typically a dimorphic marker and is the most widely distributed type of genetic polymorphism marker within the genome. With the rapid development of nucleic acid detection technology and the extensive discovery of genomic sequence resources, SNP markers have become a major type of molecular marker used in population genetic analysis, germplasm resource assessment, economic trait association analysis, and molecular design breeding.

[0004] Existing technologies for developing hypoxia-related SNP markers in fish are limited to certain growth-related functional genes, covering a very small range of the genome and involving a limited number of genes, making the development of effective molecular markers extremely difficult. Furthermore, there are currently no reports on hypoxia-related SNP molecular markers in the black-tailed culter (Culter alburnus). Therefore, marker-assisted breeding of hypoxia-tolerant black-tailed culter is of great significance. Summary of the Invention

[0005] Purpose of the invention: To address the problems existing in the prior art, this invention provides an SNP molecular marker related to the hypoxia trait of the black-tailed culter and its application.

[0006] Technical solution: This invention provides a SNP molecular marker associated with the hypoxia trait in the black-tailed culter Culter alburnus. The SNP molecular marker is located at base 18588931 on chromosome 23 of the black-tailed culter Culter alburnus, and the mutation type is T / G. The SNP molecular marker located at base 18588931 on chromosome 23 of the black-tailed culter is the base sequence shown in SEQ ID NO. 1.

[0007] SEQ ID NO.1: TGAGTGCTGGGATGGCAAAAACAGAGGAGAGCTCAGCCACATCTCATGCATAAAATCATGAGGTGCCTCTTTGATCTCTTCATGGGTAAAAGCCTGAACTATAGTGCCACACTTTTTTGCGTCCTTCTCTAACTATTTTCATAATCGCTCGAGTAGCATAAGCCTGAATTTGGTAAATGATAATTCTGTTGATACAAGGAAGATCCTGG AGGGGATGCTGTGTTTAAAGGGTTAGTTCCCCAAAATTAAAAAATGTCATTAATTACTCACCTTTGTGTCGTTTCAAACTCGTAAGACTTTTGTTCATCTTCAAAACACAAATGAAGATATTTTAATGAAATCTGAGAGATGTCTCTTCCTCCATTGACTGCCTTTGCAATAACCACTTTGATGCTTCAAAAAGTTCATAAAGAGAA TGTAATCCATATTAAGAATCGAGCGGTTTAGTCCAAATTTTCTAAAGAGACTCGACCGCTTTTTGTGATGAAAAGATTTAATTTATGCTTTACTCACATGTAAACATTGATTAGCAAACATAAGCAGAAGCTCAACCGAACCTGAATAATGCACAAGAACAAACCTCTTCCAGAAGCTCAAACGTGCTGTGTAACCAATGAGGTTCA TTCTTGTGTGTTACGCAGCACGTTTGATCTTCCAGAAGAGGTTTTCAGAGAGTATATCTTGATATACATATTTAGTTTGAAACTTACTTTGTGTTCTGTGTAGTATGAAATTCGGATGTACTACATCTGCCATGTTGTCACTGTCATGTGACCTACGATGTCAGTTGCGTCGCTTCACCTCCATTCATAAATCCCCTCCCGTTGCCTCA Furthermore, when the SNP locus genotype is TT, the black-tailed culter has the strongest tolerance to low oxygen.

[0008] A primer set for detecting SNP molecular markers associated with the hypoxia trait of the black-tailed Culter alburnus as described above, wherein the primer set is as follows: SEQ ID NO.2: F: TGAGTGCTGGGATGG; SEQ ID NO. 3: R: TGAGGCAACGGGAG.

[0009] Furthermore, the primer set is used in the preparation of products for detecting the hypoxia tolerance of Culter alburnus.

[0010] Furthermore, the primer set is applied in the detection of hypoxia tolerance in the black-tailed culter.

[0011] Furthermore, the primer set is applied in the molecular genetic breeding of the black-tailed culter for tolerance to hypoxia.

[0012] Application of a SNP molecular marker associated with hypoxia trait in Culter alburnus as described above in molecular genetic breeding for hypoxia tolerance in Culter alburnus.

[0013] A method for detecting the hypoxia tolerance of the black-tailed culter fish includes the following steps: (1) Take the fin rays of the black-tailed bream and extract its genomic DNA; (2) Using genomic DNA as a template, PCR amplification was performed using the primer set described above, and the resulting amplification products were scanned for fluorescence signals. (3) Determine the genotype of the SNP site based on the fluorescence signal to determine the hypoxia tolerance of the black-tailed culter.

[0014] Furthermore, in step (3), when the SNP genotype is TT, the black-tailed culter has a stronger tolerance to low oxygen; when the SNP genotype is other types, the black-tailed culter has a weaker tolerance to low oxygen.

[0015] Beneficial effects: Compared with the prior art, the specific beneficial effects of this invention are as follows: This invention overcomes the shortcomings of existing candidate gene methods and provides an effective method for developing hypoxia-related SNP markers in Culter alburnus, providing technical support for early breeding of Culter alburnus and showing promise for application in marker-assisted breeding of hypoxia traits in Culter alburnus. Attached Figure Description

[0016] Figure 1 Manhattan plot of GWAS analysis of hypoxia trait in Blacktail Culter alburnus according to Embodiment 1 of the present invention; Figure 2 This is a genotype distribution map of different genotypes at the Chr23: 18588931T>G locus in the low-oxygen Culter albopictus of Embodiment 1 of the present invention. Figure 3 This is a sequencing peak diagram of different genotypes at the Chr23: 18588931T>G locus in the black-tailed culter fish of Embodiment 3 of the present invention. Detailed Implementation

[0017] The present invention will now be described in detail with reference to the embodiments.

[0018] Implementation method 1: Identification of molecular markers for hypoxia tolerance in Culter albopictus includes the following steps: (1) Hypoxia stress experiment of black-tailed culter Two hundred and fifty black-tailed red bream were purchased from Wuhan Xianfeng Aquatic Technology Co., Ltd., with an average weight of 40.50 g and an average total length of 15.58 cm. During the hypoxic stress experiment, the water temperature was controlled at 21 ± 1℃, and the water was covered with a plastic film to reduce dissolved oxygen. The fish's behavior when losing balance was observed, the time of loss of balance for each fish was recorded, and fin tissue samples were taken.

[0019] (2) Genome-wide association analysis (GWAS) 195 samples of Culter alburnus with good growth and similar weight were selected from the above-mentioned Culter alburnus species and their fin DNA was extracted. Genome resequencing was performed using the BIG platform. The sequencing depth for each sample was 15 Gb. The raw sequencing sequences were filtered using Fastp (v 0.23.4), and the filtered sequences were compared with the Culter alburnus reference genome. Each sample was identified using GATK (v 3.8), with high-quality SNPs selected based on minimum allele frequency (MAF) > 5% and missing data < 20%. Genome-wide association analysis (GLM) was performed using a generalized linear model. Bonferroni correction was used to perform multiple validation on the selected candidate marker sites to control the false positive rate. Figure 1 ).

[0020] (3) Discovery of molecular marker sites for hypoxia tolerance in black-tailed culter SNP loci obtained from genome-wide association analysis were arranged according to p-values ​​to screen for SNP loci significantly associated with hypoxia tolerance in *Culter alburnus*. The results showed that base 18588931 on chromosome 23 (Chr23: 18588931T>G) was significantly associated with hypoxia tolerance, with a p-value of 1.5E-06. The Chr23: 18588931T>G locus and its upstream and downstream sequences are shown in SEQ ID NO.1, where [T / G] represents the molecularly marked SNP locus. SEQ ID NO.1 represents bases 18587932-18589931 on chromosome 23.

[0021] SEQ ID NO.1: TGAGTGCTGGGATGGCAAAAACAGAGGAGAGCTCAGCCACATCTCATGCATAAAATCATGAGGTGCCTCTTTGATCTCTTCATGGGTAAAAGCCTGAACTATAGTGCCACACTTTTTTGCGTCCTTCTCTAACTATTTTCATAATCGCTCGAGTAGCATAAGCCTGAATTTGGTAAATGATAATTCTGTTGATACAAGGAAGATCCTGG AGGGGATGCTGTGTTTAAAGGGTTAGTTCCCCAAAATTAAAAAATGTCATTAATTACTCACCTTTGTGTCGTTTCAAACTCGTAAGACTTTTGTTCATCTTCAAAACACAAATGAAGATATTTTAATGAAATCTGAGAGATGTCTCTTCCTCCATTGACTGCCTTTGCAATAACCACTTTGATGCTTCAAAAAGTTCATAAAGAGAA TGTAATCCATATTAAGAATCGAGCGGTTTAGTCCAAATTTTCTAAAGAGACTCGACCGCTTTTTGTGATGAAAAGATTTAATTTATGCTTTACTCACATGTAAACATTGATTAGCAAACATAAGCAGAAGCTCAACCGAACCTGAATAATGCACAAGAACAAACCTCTTCCAGAAGCTCAAACGTGCTGTGTAACCAATGAGGTTCA TTCTTGTGTGTTACGCAGCACGTTTGATCTTCCAGAAGAGGTTTTCAGAGAGTATATCTTGATATACATATTTAGTTTGAAACTTACTTTGTGTTCTGTGTAGTATGAAATTCGGATGTACTACATCTGCCATGTTGTCACTGTCATGTGACCTACGATGTCAGTTGCGTCGCTTCACCTCCATTCATAAATCCCCTCCCGTTGCCTCA GWAS analysis showed that when the genotype of the black-tailed culter at the Chr23: 18588931T>G locus was TT, its hypoxia tolerance was stronger; when the genotype at the Chr23: 18588931T>G locus was other types, its hypoxia tolerance was weaker. Figure 2 ).

[0022] Implementation Method 2: Primer design for detecting molecular marker sites of hypoxia tolerance in Culter albopictus includes the following steps: A specific set of primers was designed based on the upstream and downstream sequences of chromosome 23, nucleotide 18588931 (Chr23: 18588931T>G) of the Blacktail Culter albopictus genome.

[0023] The primer sequence for detecting SNP molecular markers associated with hypoxia in the black-tailed culter fish is shown below: F: TGAGTGCTGGGATGG (SEQ ID NO.2); R: TGAGGCAACGGGAG (SEQ ID NO. 3).

[0024] Implementation Method 3: The detection of molecular marker genotypes using the primer set of molecular markers designed in Implementation Method 2 includes the following steps: (1) Extraction of genomic DNA from Culter alburnus Genomic DNA was extracted from the fin rays of the black-tailed culter fish using the phenol-chloroform method.

[0025] (2) Establishment of genotyping PCR amplification system Genomic DNA is amplified by PCR to obtain PCR amplification products;

[0026] The PCR reaction program was set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 45 s, 72℃ extension for 30 s, and 34 cycles were performed; 72℃ extension for 5 min; and finally maintained at 12℃. (3) The PCR amplification products were sequenced, and the genotype of the SNP molecular marker was determined based on the sequencing results; (4) Determine the hypoxia tolerance of the black-tailed culter fish by genotype: Individuals with the TT genotype at the Chr23:18588931T>G locus exhibited significantly higher hypoxia tolerance than individuals with the TG and GG genotypes. For example... Figure 3 The image shows the sequencing peaks at the Chr23: 18588931T>G site. Figure 3 (A) is hypoxia-sensitive. Figure 3 (B) is the hypoxia-tolerant type.

[0027] Implementation Method 4: In another cultured population of *Culter alburnus*, the SNPChr23: 18588931T>G genotype also showed significant differences in hypoxia traits. In this population, genotyping was performed on 200 *Culter alburnus* individuals using primers and experimental methods described in embodiments 2 and 3. Sequencing analysis and statistical data showed that individuals with the TT genotype had a significantly higher average hypoxia tolerance time (i.e., surfacing time) than those with the TG and GG genotypes, indicating that this SNP has potential for marker-assisted breeding of hypoxia traits in *Culter alburnus*.

[0028] The above embodiments are only for illustrating the technical concept and features of the present invention, and are intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly. They should not be construed as limiting the scope of protection of the present invention. All equivalent transformations or modifications made in accordance with the spirit and essence of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A SNP molecular marker associated with the hypoxia trait of the black-tailed culter fish, characterized in that, The sequence of the SNP molecular marker is shown in SEQ ID NO:

1. The SNP molecular marker is located at position 653 of the nucleotide sequence of SEQ ID NO:1, and its base is T or G.

2. The SNP molecular marker related to the hypoxia trait of Culter albopictus according to claim 1, characterized in that: When the SNP locus genotype is TT, the black-tailed culter has the strongest tolerance to low oxygen.

3. A primer set for detecting SNP molecular markers associated with the hypoxia trait of the black-tailed culter fish as described in any one of claims 1-2, characterized in that: The primer set is as follows: F: TGAGTGCTGGGATGG; R: TGAGGCAACGGGAG.

4. The application of the primer set according to claim 3, characterized in that: Application of the primer set in the preparation of products for detecting the hypoxia tolerance of Culter alburnus.

5. The application of the primer set according to claim 3, characterized in that: Application of the primer set in detecting the hypoxia tolerance of the black-tailed culter.

6. The application of the primer set according to claim 3, characterized in that: Application of the primer set in molecular genetic breeding of the black-tailed culter fish for hypoxia tolerance.

7. The application of an SNP molecular marker associated with the hypoxia trait of Culter alburnus as described in any one of claims 1-2 in the molecular genetic breeding of Culter alburnus for hypoxia tolerance.

8. A method for detecting the hypoxia tolerance of the black-tailed culter, characterized in that, Includes the following steps: (1) Take the fin rays of the black-tailed bream and extract its genomic DNA; (2) Using genomic DNA as a template, PCR amplification was performed using the primer set described in claim 3, and the resulting amplification products were scanned for fluorescence signals. (3) Determine the genotype of the SNP site based on the fluorescence signal to determine the hypoxia tolerance of the black-tailed culter.

9. The method for detecting the hypoxia tolerance of the black-tailed culter according to claim 8, characterized in that: In step (3), when the SNP genotype is TT, the black-tailed culter has a stronger tolerance to low oxygen; when the SNP genotype is other types, the black-tailed culter has a weaker tolerance to low oxygen.