A primer set for detecting a SNP molecular marker significantly related to the reproductive trait of procambarus clarkii and application thereof

Abstract

The application belongs to the technical field of biomolecular markers, and particularly relates to a primer set for detecting a SNP molecular marker significantly related to the fecundity trait of Procambarus clarkii and application thereof. The primer set can quickly and effectively realize accurate genotyping of a SNP site of a vitellogenin Vg gene of the Procambarus clarkii, and the detection can be completed only by using conventional PCR and agarose gel electrophoresis, so that the detection process is simple, time-consuming is short, and cost is low, and the primer set is suitable for large-scale and high-throughput parent screening. The marker is significantly related to the fecundity traits such as clutch size of the Procambarus clarkii, the genotyping result is stable and reliable and has good repeatability, only the end of the tail fan needs to be sampled, dissection is not needed, and the genotype identification can be completed in the early stage of breeding, so that the selection and breeding cycle is greatly shortened, the high-fecundity parent screening efficiency is improved, the problems such as long selection and breeding cycle and low efficiency in traditional phenotype selection and breeding are effectively solved, a stable and practical molecular tool is provided for the genetic improvement and efficient breeding of the Procambarus clarkii, and the application has important industrial application value.

Description

Technical Field

[0001] This invention belongs to the field of biomolecular marker technology, specifically relating to a primer set for detecting SNP molecular markers that are significantly associated with the reproductive traits of red swamp crayfish and its application. Background Technology

[0002] Redclaw crayfish ( Cherax quadricarinatus Belonging to the class Crustacea, order Decapoda, family Pseudococcus, and genus Pseudococcus, the Australian freshwater crayfish (also known as the Australian mini crayfish) is a large, benthic freshwater shrimp. It is highly tolerant of low oxygen and ammonia levels, and its large size and high price have made it a preferred species for pond aquaculture and integrated rice-fish farming in recent years, giving it significant market value. However, compared to other freshwater shrimp, the industrialization of the redclaw crayfish has been slow. The main reasons for this are: firstly, a lack of high-quality, high-fertility broodstock, leading to a gradual decline in the number of eggs carried by offspring due to generations of unselected breeding; secondly, redclaw crayfish eggs are large, carry few eggs, and have a long carrying time, resulting in poor egg quality and susceptibility to mold and shedding when nutrition is insufficient; and thirdly, the lack of molecular markers for reproductive selection makes it difficult to achieve genetic-level breeding progress solely through egg-carrying capacity. Therefore, improving the reproductive capacity of redclaw crayfish broodstock and comprehensively increasing egg-carrying capacity are key factors in accelerating the development of the redclaw crayfish industry.

[0003] Currently, methods to enhance the reproductive capacity of redclaw crayfish mostly involve screening and strengthening the breeding of parent stock based on physiological traits. For example, the existing Chinese patent CN112136738B describes a method for screening and breeding high-egg-carrying redclaw crayfish parents. This method uses morphological traits related to egg production—using the width of the first abdominal segment / total length as an indicator instead of egg production—as selection indicators to indirectly select for egg production traits in redclaw crayfish. By adjusting the size ratio and mating number of male and female parent crayfish, it solves the difficulties in actual production, such as the inability to measure egg production in advance, the unsuitability for excessive manipulation of egg-carrying parent crayfish, and low egg-carrying rates. This provides a technical solution for establishing high-yielding parent populations of redclaw crayfish and lays the foundation for large-scale redclaw crayfish farming. However, this method cannot provide stable support for the reproductive selection of redclaw crayfish at the genetic level.

[0004] Single nucleotide polymorphisms (SNPs), as third-generation molecular markers, enable high-throughput, automated screening and detection, with a wide range of applications. Population genetic diversity analyses have been conducted in various shrimp species, including *Litopenaeus monodon*, *Litopenaeus vannamei*, *Macrobrachium japensii*, and *Procambarus clarkii*. Tetra-primer ARMS-PCR (Tetra-primer amplification inhibited mutation system PCR) utilizes four different primers to detect the presence and length of specific amplified product fragments, allowing for the determination of mutations in a sample through a single PCR reaction in a conventional laboratory. Current technology has been used to perform SNP genotyping on the *Litopenaeus monodon* ALFPm3 gene, exploring its association with white spot syndrome virus resistance. Analysis of two SNP sites screened on the *Trionyx sinensis* IGF2 gene revealed their potential as molecular markers for growth traits in *Trionyx sinensis* to assist in breeding. For redclaw crayfish, Chinese patent CN117904268B, "SNP molecular markers for identifying the genetic sex of redclaw crayfish and their application," mainly focuses on the identification of the genetic sex of redclaw crayfish, but fails to reveal molecular markers that are significantly related to reproductive traits, thus failing to provide strong support for breeding and selection.

[0005] Vitellogenin (Vg), a core molecule regulating reproductive performance, exhibits an expression pattern highly synchronized with gonadal development, making it an effective indicator of gonadal development. In terms of oocyte quality regulation, Vg content directly affects oocyte fertilization and hatching rates, thus potentially serving as a target gene for reproductive capacity molecular markers. However, current research primarily focuses on Vg's conventional functional domains, such as LPD_N, DUF1943, VWD, and restriction enzyme sites, without providing significant insights into their correlation with traits like egg-carrying capacity in redclaw crayfish.

[0006] It is evident that the aforementioned bottlenecks lead to low breeding efficiency of high-fertility broodstock in redclaw crayfish, hindering the sustainable development of the industry. Therefore, developing a molecular marker that is significantly correlated with egg-carrying capacity, can be stably genotyped, and has been validated through multiple generations of breeding is crucial for overcoming the genetic degradation predicament and is of great significance. Based on this, this invention is proposed. Summary of the Invention

[0007] The purpose of this invention is to solve the aforementioned problems in the prior art and to provide a primer set for detecting SNP molecular markers that are significantly associated with the reproductive traits of redclaw crayfish and its application in the breeding and selection of redclaw crayfish.

[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0009] This invention provides a primer set for detecting SNP molecular markers significantly associated with reproductive traits in redclaw crayfish, comprising:

[0010] Upstream primer: Its nucleotide sequence is shown in SEQ ID NO.1, specifically: CGAAGTGCTAGGACCAT;

[0011] Downstream primer: Its nucleotide sequence is shown in SEQ ID NO.2, specifically: TGTGGGAATGGAGGAGC;

[0012] SNP-A primers: Their nucleotide sequences are shown in SEQ ID NO.3, specifically: CTCCCCAGTGGACTTGTCATA;

[0013] SNP-G primer: Its nucleotide sequence is shown in SEQ ID NO.4, specifically: GCAGAGATAATGATTGTGGAAAGC.

[0014] Preferably, the nucleotide sequence containing the SNP molecular marker is shown in SEQ ID NO.5, which is 10640bp in total. The nucleotide sequence has an A>G mutation at position 6451, which is divided into three genotypes: AA, AG and GG.

[0015] This invention also provides an application of the above-mentioned primer set in detecting the reproductive traits of redclaw crayfish, comprising the following steps:

[0016] S1: Extract genomic DNA from the red claw crayfish to be tested, and perform tetra-primer ARMS-PCR amplification of SNPs using primer sets such as SEQ ID NO.1~SEQ ID NO.4;

[0017] S2: Perform electrophoresis on the amplification products, obtain the detection results, and determine the genotype at position 6451 of the genomic DNA.

[0018] Preferably, the genomic DNA in S1 is the vitellogenin gene of red swamp crayfish, preferably collected from the ovarian tissue of the red swamp crayfish to be tested.

[0019] Preferably, the tetra-primer ARMS-PCR reaction system in S1 is a 25 μL system, including: 12.5 μL PCRMix (the main components include dNTPs, MgCl2, and reaction buffer, with a concentration of 2×, preferably from Tiangen Biotech (Beijing) Co., Ltd., catalog number: KT201, but not limited to this reagent), 4 μL primer system (0.7 μL upstream primer, 0.7 μL downstream primer, 1.3 μL SNP-A primer and 1.3 μL SNP-G primer), 7.0 μL H2O, 1 μL gDNA (genomic DNA to be tested) and 0.5 μL Taq DNA polymerase (preferably from Tiangen Biotech (Beijing) Co., Ltd., catalog number: ET101, but not limited to this reagent).

[0020] Preferably, the PCR reaction program in S1 is as follows: 94℃ for 5 min pre-denaturation → 40 cycles (94℃, 30 s; 60℃, 30 s; 72℃, 30 s) → 72℃ for 10 min → 4℃ ∞.

[0021] Preferably, in S2, agarose gel electrophoresis is used to obtain the detection results, and the reaction bands are classified. The reaction bands include a control band (541 bp) and a target band (at least one of type A (399 bp) and type G (186 bp)). The classification of the detection results includes:

[0022] If a control band of 541 bp and an A-type band of 399 bp are present, it indicates that position 6451 is of type AA.

[0023] If a control band of 541 bp and a G-type band of 186 bp are present, it indicates that bit 6451 is of type GG.

[0024] If a control band of 541 bp, an A-type band of 399 bp, and a G-type band of 186 bp are present, it indicates that bit 6451 is of type AG.

[0025] The nucleotide sequence of the control band is shown in SEQ ID NO.6, totaling 541 bp, and is as follows:

[0026] 1 CGAAGTGCTA GGACCATATC GTTATTTGTT CGCGGCTGCG TTCAAGCACG GTACCTCAGT

[0027] 61 TATTATGCAG GTAGAGGGTC CACTACTAGT CTTGATCACC CAGGCTGTTG TGCACCTCCA

[0028] 121 AGCTCATATT ATGGTTGATG CTCTCCCCAG TGGACTTGTC AGAATTTCCA CAATCATTAT

[0029] 181 CTCTGCCAGA AATAAGCAAC AATTTTCCTT CGAATTAAAG AACCATCGTG AATCGCTATT

[0030] 241 CGATATAGAC TTTAATCTAG GTCTCGAGTC ACCTCAAAAG ACATCCATTG AATCTAAATT

[0031] 301 ATACATAACG GAAAATAATTC AACATAAGCT CGAAATAGTC ATAAAGAATA ATATTGCTTA

[0032] 361 TTATAATATG AATACGGTAT TGTTGACAAA TACTTCATGG GCTCGACGAG TGAAGAGTTT

[0033] 421 TGTTGACGTT GACATGGAGC ACCAGCGAGT GACTGGTGAG TTATACTGGG ACAGTGATCG

[0034] 481 CAACTCGAGC AAGAAGGTGA GCTGCGACGC CACGCTAGTC ACAAGCTCCT CCATTCCCAC

[0035] 541 A

[0036] The SNP molecular marker target band is a type A band, with the nucleotide sequence shown in SEQ ID NO.7, totaling 399 bp, specifically:

[0037] 1 CTCCCAGTG GACTTGTCAG AATTTCCACA ATCATTATCT CTGCCAGAAA TAAGCAACAA

[0038] 61 TTTTCCTTCG AATTAAAGAA CCATCGTGAA TCGCTATTCG ATATAGACTT TAATCTAGGT

[0039] 121 CTCGAGTCAC CTCAAAAGAC ATCCATTGAA TCTAAATTAT ACATAAACGGA AATAATTCAA

[0040] 181 CATAAGCTCG AAATAGTCAT AAAGAATAAT ATTGCTTATT ATAATATGAA TACGGTATTG

[0041] 241 TTGACAAATA CTTCATGGGC TCGACGAGTG AAGAGTTTTG TTGACGTTGA CATGGAGCAC

[0042] 301 CAGCGAGTGA CTGGTGAGTT ATACTGGGAC AGTGATCGCA ACTCGAGCAA GAAGGTGAGC

[0043] 361 TGCGACGCCACGCTAGTCACAAGCTCCTCCATTCCCACA

[0044] The SNP molecular marker target band is a G-type band, and the nucleotide sequence is shown in SEQ ID NO.8, totaling 186 bp, specifically:

[0045] 1 CGAAGTGCTA GGACCATATC GTTATTTGTT CGCGGCTGCG TTCAAGCACG GTACCTCAGT

[0046] 61 TATTATGCAG GTAGAGGGTC CACTACTAGT CTTGATCACC CAGGCTGTTG TGCACCTCCA

[0047] 121 AGCTCATATT ATGGTTGATG CTCTCCCCAG TGGACTTGTC AGAATTTCCA CAATCATTAT

[0048] 181 CTCTGC

[0049] Preferably, the significant correlation between the genotype at position 6451 and the reproductive traits of redclaw crayfish is as follows: the AA genotype shows a significant advantage over the AG and GG genotypes in both body weight and egg-carrying capacity. By detecting the SNP genotype at position 6451, the reproductive capacity of redclaw crayfish can be preliminarily assessed and it can help with breeding screening.

[0050] This invention also provides an application of the above-mentioned primer set in a kit, preferably in a kit for detecting the fertility of redclaw crayfish, the kit containing primer sets SEQ ID NO.1 to SEQ ID NO.4. Applying this kit to the detection of redclaw crayfish fertility can efficiently, conveniently, clearly, and stably screen for female redclaw crayfish with high fertility, which can be used as parent stock for breeding, thereby contributing to improving the development and efficiency of the redclaw crayfish industry.

[0051] Compared with existing technologies, the beneficial effects of this invention are as follows: This invention provides a SNP molecular marker that is significantly associated with the reproductive trait of redclaw crayfish, and provides a primer set for detecting the molecular marker, as well as the application of the molecular marker and primer set in detecting the reproductive capacity of redclaw crayfish. Using the primer set described in this invention, accurate genotyping of the Vg gene SNP site in redclaw crayfish can be achieved rapidly and effectively. Detection can be completed using only conventional PCR and agarose gel electrophoresis, without the need for expensive instruments and complex operations. The detection process is simple, time-saving, and low-cost, making it suitable for large-scale, high-throughput parental screening. This marker is significantly associated with reproductive traits such as egg-carrying capacity in redclaw crayfish. The genotyping results are stable, reliable, and reproducible. It only requires sampling from the end of the tail fan (which will regrow), eliminating the need for dissection and allowing genotyping to be completed early in the seedling stage. This significantly shortens the breeding cycle, improves the efficiency of screening high-fertility parents, and effectively solves the problems of long phenotypic breeding cycles, large errors, and low efficiency in traditional phenotypic breeding. It provides a stable and practical molecular tool for the germplasm improvement and efficient breeding of redclaw crayfish and has important industrial application value. Attached Figure Description

[0052] Figure 1 This is a gel electrophoresis result of the c.6451A>G site of the Vg2 gene in red swamp crayfish according to Example 1 of the present invention;

[0053] Figure 2 This is a schematic diagram of the analysis of the SNP-A primer (top) and SNP-G primer (bottom) of Example 1 of the present invention in the analysis software DNAMAN;

[0054] Figure 3 This is a gel electrophoresis image of the PCR reaction of different primer systems in Comparative Example 1 of this invention after annealing at 60℃. In the image, 1: represents primer system 1; 2: represents primer system 2; 3: represents primer system 3; 4: represents primer system 4.

[0055] Figure 4 This is a schematic diagram showing the results of the BLAST alignment analysis of the Vg2 gene sequence of the red claw crayfish in Comparative Example 2 of this invention using the NCBI system database.

[0056] Figure 5This is a schematic diagram illustrating the results of BLAST alignment analysis of the Vg2 gene sequence of the redclaw crayfish in Comparative Example 2 of this invention using the NCBI system database (continued). Figure 4 );

[0057] Figure 6 This is a BLAST sequence comparison diagram of the cqVg2 gene and the American crayfish gene in Comparative Example 2 of this invention. Detailed Implementation

[0058] To better clarify and understand the objectives, process solutions, and advantages of this invention, the technical solutions and implementation methods of this invention will be further described clearly, completely, and in detail below through specific embodiments and in conjunction with the accompanying drawings. It should be understood that the embodiments described in this invention are implemented under the premise of the technical solutions of this invention, providing detailed implementation methods and specific operating procedures, but are only some embodiments of this invention, not all embodiments. The specific implementation methods described are limited to illustrating and explaining this invention and do not limit this invention. Based on the embodiments of this invention, all other implementation methods obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0059] Unless otherwise specified, the experimental methods and conditions used in the embodiments of this invention are conventional methods and conditions. The materials, reagents, instruments, and equipment used in the embodiments, unless otherwise specified, are all conventional substances or equipment known to those skilled in the art and can be obtained commercially or prepared by conventional methods. The reaction conditions described in the invention's content can all achieve the stated reactions and obtain the desired products. Due to space limitations, some embodiments are listed below to further illustrate the advantages of the technical solution of this invention.

[0060] Example 1: Obtaining the Vg2 gene sequence of the redclaw crayfish and performing correlation analysis and detection of SNP molecular markers.

[0061] The applicant of this invention conducted research on the detection of molecular markers significantly related to reproductive capacity in the redclaw crayfish. Although molecular markers are an existing technology in genetic analysis, their application to the reproductive significance of redclaw crayfish is hampered by a highly repetitive genome background, incomplete assembly, and dynamic structural variations. These factors collectively contribute to the difficulty in isolating reproductive-related genetic loci, hindering the efficient development of relevant molecular markers and functional primers. Specifically, Liu et al. reported the complexity of the redclaw crayfish genome in BMCGenomics (2024). The estimated genome size of this species exceeds 6 Gb, with repetitive sequences accounting for as much as 93.36%. Transposable elements (TEs) account for 67.03% of the assembled sequences, and long, scattered nuclear elements (LINEs) are the main repetitive type. These highly redundant sequences not only lead to insufficient genome assembly integrity but also result in numerous sequence deletions and structural differences between different assembled versions. This buries reproductive-related functional genes and regulatory regions within repetitive sequences, making precise localization difficult. Meanwhile, the expansion of transposable elements and tandem repeat sequences—core drivers of genome expansion in decapod crustaceans—is particularly prominent in the redclaw crayfish genome. The frequent amplification and recombination of these dynamic repetitive sequences lead to a highly unstable genome structure, making it extremely easy to induce non-specific binding when designing primers, severely affecting the reliability of amplification results. This makes it difficult to readily obtain relevant molecular markers and primers in the current field.

[0062] References: Liu ZW, Zheng JB, Li HY et al. Genome assembly of redclawcrayfsh (Cherax quadricarinatus) provides insights into its immune adaptation and hypoxia tolerance. BMC Genomics (2024) 25:746.

[0063] This invention, through extensive research and experimental screening by the applicant, has successfully obtained molecular markers significantly associated with the reproductive capacity of the redclaw crayfish, representing a major breakthrough. The following illustrative description of some aspects of the work further illustrates the technical solution of this invention.

[0064] Using adult redclaw crayfish collected from the Zhejiang Freshwater Fisheries Research Institute as the research object, three female crayfish with an average body length of 11.27±0.16cm and an average weight of 66.13±1.27g were selected. Ovarian tissues were collected, cryopreserved, and then subjected to transcriptome sequencing. The full-length cDNA sequence of the redclaw crayfish vitellogenin gene, totaling 10640bp, was isolated from the transcriptome data and named cqVg2 gene. The nucleotide sequence is shown in SEQ ID NO.5, which is the nucleotide sequence containing the SNP molecular marker described in this invention.

[0065] Information in NCBI Cherax quadricarinatus The sequence of vitellogenin-like (LOC128695792), transcript variant X2, mRNA sequence number XM_053786634.2 scored the highest after BLAST analysis. DNAMAN software analysis revealed that the obtained sequence was 2312 bp longer than that in the NCBI database, and the similarity of the remaining parts was 99%. The cq Vg2 sequence of this invention contains the entire coding region of the gene and is the complete cDNA sequence of the gene.

[0066] Based on SNP data from the transcriptome and NCBI system, an A / G type SNP mutation was found at the 6451 bp site of the cq Vg2 gene. Tetra-primer ARMS PCR primers were designed targeting the c.6451A>G site. Tail fan DNA tissue was collected from 10 adult female shrimp (average body length 12.83±0.25 cm, average weight 69.23±1.46 g) as gDNA templates. The primer sequences for the PCR reaction are shown in Table 1 below.

[0067] The 25 μL system for ARMS-PCR reaction in SNP detection consisted of: 12.5 μL PCR Mix (including dNTPs, MgCl2, and reaction buffer at a concentration of 2×, sourced from Tiangen Biotech (Beijing) Co., Ltd., catalog number: KT201), 4 μL primer system (0.7 μL upstream primer, 0.7 μL downstream primer, 1.3 μL SNP-A primer, and 1.3 μL SNP-G primer), 7.0 μL H2O, 1 μL gDNA template, and 0.5 μL Taq DNA polymerase (sourced from Tiangen Biotech (Beijing) Co., Ltd., catalog number: ET101).

[0068] The PCR reaction program was as follows: 94℃ for 5 min pre-denaturation → 40 cycles (94℃, 30 s; 60℃, 30 s; 72℃, 30 s) → 72℃ for 10 min → 4℃ infinity. After the reaction, the bands were classified using agarose gel electrophoresis.

[0069]

[0070] Note: The bold italics in SNP-A and SNP-G primers are... T " G "These are non-specific mutation sites introduced by humans."

[0071] Results: A clear band pattern was observed at the cqVg2 c.6451A>G site after PCR, as shown below. Figure 1 As shown, by combining the positions of the four primers (upstream primer, downstream primer, SNP-A primer, and SNP-G primer) in the gene sequence, it can be known that... Figure 1 The three bands in the middle, from top to bottom, represent the control band (541 bp, nucleotide sequence as shown in SEQ ID NO.6) and the target band (A type 399 bp, nucleotide sequence as shown in SEQ ID NO.7 and G type 186 bp, nucleotide sequence as shown in SEQ ID NO.8).

[0072] The genotyping of SNP sites is determined as follows:

[0073] If a control band of 541 bp and an A-type band of 399 bp are present, it indicates that position 6451 is of type AA.

[0074] If a control band of 541 bp and a G-type band of 186 bp are present, it indicates that bit 6451 is of type GG.

[0075] If a control band of 541 bp, an A-type band of 399 bp, and a G-type band of 186 bp are present, it indicates that bit 6451 is of type AG.

[0076] As can be seen, the present invention has successfully screened out SNP molecular markers that are outside the conventional functional region of Vg in redclaw crayfish, adapted to the redclaw crayfish of the present invention, and capable of clear differentiation, and these molecular markers are unpredictable.

[0077] In fact, the primer design for the cq Vg2 c.6451A>G site in this invention is unique. Conventional primer design methods still struggle to accurately represent the genotype of this site. The applicant employed an unconventional primer design method for this site, specifically using the following method and primers:

[0078] The tetra-primer ARMS PCR typing primer SNP-A designed in this invention (nucleotide sequence shown in SEQ ID NO.3, specifically CTCCCCAGTGGACTTGTCA) T A), its sequence contains italics TThe core artificial mismatch design site is G, which is theoretically wild-type. This mismatch is not a conventional, arbitrary base modification, but a high-precision design based on the gradient law of mismatch instability at the 3' end of AMRS-PCR, exhibiting significant technical difficulty and non-obviousness. Randomly selecting mismatched bases or sites can lead to amplification inhibition and loss of specificity, preventing effective genotyping. This invention, while strictly balancing primer amplification activity and non-specific inhibition, enhances primer-DNA template mismatch instability through targeted mismatch introduction, overcoming the technical bottleneck of insufficient specificity in natural primers. This significantly improves the specificity and accuracy of site detection. The primer design process requires multiple parameter matching and verification, and cannot be accomplished through simple modification.

[0079] The tetra-primer ARMS PCR typing primer SNP-G designed in this invention (nucleotide sequence shown in SEQ ID NO.4, specifically GCAGAGATAATGATTGTGGAAA) G C), its sequence in italics G This is a key artificial mismatch site, with the theoretical wild-type base being T. Constructing this type of secondary mismatch is an extremely challenging step in tetra-primer ARMS primer design, as it cannot be achieved through conventional base substitution. Strict adherence to mismatch strength matching and site arrangement rules is essential. Inappropriate mismatch type or location selection can directly lead to primer failure or rampant non-specific amplification. Based on the core principles of AMRS-PCR mismatch compatibility, this invention precisely implements artificial site-directed mutagenesis to construct specific mismatch structures targeting the low-intensity mismatch characteristics of AG. It carefully controls the binding instability between primers and non-target templates, maximizing the blocking of non-specific extension while ensuring amplification efficiency. This significantly improves detection specificity and accuracy, fully demonstrating the technical creativity and non-obviousness of this primer design scheme, distinguishing it from conventional, arbitrary primer modification methods.

[0080] like Figure 2 The image shows that, according to the analysis software DNAMAN, the two bases "T" (top) and "G" (bottom) in the primer failed to bind specifically to the sequence, indicating that these were artificially introduced mismatch sites.

[0081] Comparative Example 1: Optimization of the SNP-based tetra-primer ARMS PCR reaction system

[0082] Besides the challenges in primer design, the tetra-primer ARMS PCR reaction system also requires optimization to obtain clearly distinguishable bands for genotyping. This invention addresses the inherent technical contradictions of the tetra-primer ARMS PCR four-primer coexistence amplification system by systematically optimizing the ratio of the four primers and the PCR annealing temperature conditions in an unconventional and unpredictable manner. In the four-primer amplification system, there is natural amplification competition, primer dimer interference, differences in extension efficiency, and the risk of non-specific binding among the upstream and downstream primers and the two allele-specific primers. These factors are coupled and mutually restrictive, and their optimal ratio and temperature conditions cannot be directly derived, predicted, or obtained through conventional orthogonal screening. This represents a non-obvious technical challenge, and conventional single-variable adjustments or empirical optimizations cannot achieve a synergistic balance between specificity and amplification efficiency. The following examples illustrate this.

[0083] Therefore, this invention employs a multi-gradient differential design for the addition volume of the four-primer system, constructing and validating four PCR reaction systems with substantial differences. The primer ratios for each system are set based on primer binding energy, amplification priority, and non-specific inhibition requirements. The specific systems are as follows:

[0084] Primer system 1: Total volume 4 μL, including 0.9 μL upstream primer, 0.9 μL downstream primer, 1.1 μL SNP-A primer, and 1.1 μL SNP-G primer;

[0085] Primer system 2: Total volume 4 μL, including 0.8 μL upstream primer, 0.8 μL downstream primer, 1.2 μL SNP-A primer, and 1.2 μL SNP-G primer;

[0086] Primer system 3: Total volume 4 μL, including 0.7 μL upstream primer, 0.7 μL downstream primer, 1.3 μL SNP-A primer, and 1.3 μL SNP-G primer;

[0087] Primer system 4: Total volume 4 μL, including 0.6 μL upstream primer, 0.6 μL downstream primer, 1.4 μL SNP-A primer, and 1.4 μL SNP-G primer.

[0088] Meanwhile, considering the highly complex and highly coupled effects of annealing temperature on primer-specific binding, mismatch extension inhibition, and non-specific amplification, this invention further sets three annealing temperature gradients of 58℃, 60℃, and 62℃, and cross-combines them with the above four primer systems for verification. There is no clear linear relationship between the conditions, and the final amplification effect cannot be predicted by conventional theoretical calculations or conventional experience. It can only be determined by actual amplification experiments, and has significant unpredictability.

[0089] This invention uses a mixed gDNA sample from the tail fans of 50 adult female redclaw crayfish (average body length 11.93±1.35cm, average weight 65.93±2.13g) with the same DNA template as the test material. The PCR amplification and genotyping effects under different combination conditions were verified one by one. The genotyping results of the four primer systems at annealing temperature of 60℃ are detailed in [link to relevant documentation]. Figure 3 Experimental results show that, under the same annealing temperature (60℃), the amplification effects of each primer system exhibit unexpected and significant differences: the addition ratio of SNP-A and SNP-G primers in primer system 1 is too low, resulting in insufficient target band brightness and low amplification product abundance under the same amplification driving force, failing to meet the requirements for clear genotyping; primer systems 2 and 4 both show obvious non-specific bands, with severe genotyping interference, and their specificity completely fails to meet the detection requirements. All of these results exceed the expected range of conventional optimization in this field. Furthermore, under primer system 3, when the annealing temperature is 58℃, the gel electrophoresis results after PCR reaction show an excessive number of non-specific bands. When the annealing temperature is 62℃, the band (186bp) of the G-type SNP site in the gel electrophoresis results after PCR reaction is weak and cannot meet the requirements of subsequent analysis. Only the combination of primer system 3 and annealing temperature 60℃ obtained by the present invention can completely suppress non-specific amplification while achieving sufficient amplification efficiency, and obtain the optimal amplification effect with clear bands, accurate genotyping, and no interference from impurities. This optimal combination cannot be derived by conventional techniques in the field and does not belong to conventional parameter adjustment or conventional optimization. Instead, it is a key technical solution obtained through a large number of non-obvious experimental verifications, which fully demonstrates the inventiveness and non-obviousness of the present invention.

[0090] Comparative Example 2: Specificity analysis of the cqVg2 c.6451A>G SNP site in redclaw crayfish.

[0091] BLAST alignment analysis using the NCBI database showed that among the cqVg2 sequences screened in this invention, homologous sequences with a coverage rate higher than 67% all originated from vitellogenin-like genes in redclaw crayfish, while the coverage rates of homologous sequences from other species were all below 24%. Verification of the top 100 alignment results revealed that... Figures 4-5 including American swamp crayfish Homarus americanus Japanese shrimp Penaeus japonicus , Procambarus clarkii Procambarus clarkii Among similar shrimp species, none of their published sequences cover the region containing the SNP site described in this invention. This site does not have a corresponding mutation or homologous polymorphism in other shrimp species. A comparative analysis of the cqVg2 gene sequence between the American swamp crayfish and that of this invention is as follows: Figure 6 As shown, the American swamp crayfish sequence does not cover the SNP site at 6451 bp of the Vg 2 gene in the redclaw crayfish. American swamp crayfish only shows some similarity after 9290 bp in the Vg 2 gene of the redclaw crayfish, and the overall similarity is not high. In the figure, Query represents the Vg 2 gene sequence of the redclaw crayfish, and Sbjct represents the gene sequence of the American swamp crayfish.

[0092] Therefore, the SNP loci described in this invention are species-specific and non-conservative, applicable only to redclaw crayfish and not universally applicable to other aquatic animals, especially closely related shrimp species. When using the primers of this invention for detection, other species cannot achieve specific amplification and effective genotyping. This locus cannot be routinely derived from existing gene sequences, functional domains, or information from closely related species, nor can it be expected to have a significant association with reproductive traits, exhibiting prominent non-obviousness.

[0093] Example 2: Association analysis between the cq Vg2 c.6451A>G locus and morphological data of populations with different reproductive capacities

[0094] (1) Preparation of three generations of high-fertility populations and unselected populations

[0095] Each generation of the study subjects consisted of two populations with different reproductive capacities: a high-fertility population of redclaw crayfish and an unselected population. The high-fertility population of redclaw crayfish originated from the Deqing base of the Zhejiang Freshwater Fisheries Research Institute, where selection began in 2019. Selection was conducted twice a year: the first selection was performed before mating (March) with a 50% selection rate based on body weight; the second selection was conducted after mating and egg-bearing (May), selecting the top 50% of individuals with the highest egg-bearing capacity as breeding stock. The high-fertility population was characterized by an egg-bearing capacity that was more than 10% higher than that of the unselected population in the same year. The unselected population served as a control group, also from the Deqing base of the Zhejiang Freshwater Fisheries Research Institute. This group did not undergo any selection each year; shrimp were randomly selected for breeding before mating (March) and after mating and egg-bearing (May). The unselected group was characterized by an egg-bearing capacity that was more than 10% lower than that of the high-fertility population in the same year.

[0096] In this comparative experiment: In October 2022, the high-fertility population and the unselected population of redclaw crayfish bred that year were transferred from the pond to the workshop for breeding. In March 2023, the high-fertility population of the previous year was selected for the first time according to the standard of 50% body weight selection rate. High-quality male shrimp were selected for mating. After mating and carrying eggs (in May), the top 50% of the egg-carrying shrimp were selected for the second selection. The selected population was named the high-fertility generation 0 (F0) in this invention. The number of female shrimp retained was not less than 500. When the egg color of the egg-carrying shrimp developed to orange, the body weight and egg-carrying capacity of 30 egg-carrying shrimp were counted and the tail fan DNA samples were collected.

[0097] Unselected Generation 0 (WX0) refers to the offspring of the previous year's unselected population, from which shrimp were randomly selected for breeding before mating (March) and after mating and carrying eggs (May), without specific selection. At least 500 female shrimp were retained. Similarly, when the eggs of the berried shrimp developed to orange color, the weight and egg-carrying capacity of 30 berried shrimp were recorded, and tail fan DNA samples were collected.

[0098] To achieve better egg-carrying performance, this invention employs nutritional fortification starting during the first egg-carrying stage of female redclaw crayfish. The fortification strategy is detailed in Table 2: the concentration of vitamin E added is 0.02 g / 100 g of feed. The weekly feeding ratio of ribbonfish, snail meat, carrots, and formulated feed is 3:2:1:2.75. After hatching and reaching approximately 1 cm in length, the juvenile crayfish are released into production control ponds. Both high-fertility and non-selective populations are cultured in two ponds to ensure consistent stocking density and feeding conditions throughout the entire rearing process.

[0099] In October 2023, after the high-fertility generation 0 (F0) and unselected generation 0 (WX0) shrimp reached adult size, they were transferred from ponds to the workshop for overwintering and preservation. The offspring of the high-fertility generation 0 (F0) shrimp, after two rounds of standardized selection, were named high-fertility generation 1 (F1), while the offspring of the unselected generation 0 (WX0) shrimp, without any selection, were named unselected generation 1 (WX1). Throughout this process, the farming and data collection methods were kept consistent with the previous year. After hatching, the juvenile shrimp of the high-fertility generation 1 (F1) and unselected generation 1 (WX1) shrimp populations were raised to about 1 cm and then released into the production comparison test pond. Throughout the entire farming process, the farming density and feeding conditions of the high-fertility and unselected populations were kept consistent.

[0100] In October 2024, after the high-fertility generation 1 (F1) and the unselected generation 1 (WX1) reached adult size, they were transferred from ponds to the workshop for overwintering and preservation. In March 2025, the offspring of the high-fertility generation 1 (F1) after two rounds of standardized selection were named the high-fertility generation 2 (F2), while the offspring of the unselected generation 1 (WX1) without selection were named the unselected generation 2 (WX2). Throughout this process, the farming and data collection methods were kept consistent with the previous year. Similarly, when the berried shrimp eggs developed to orange color, the weight and egg-carrying capacity of 30 berried shrimp were recorded, and tail fan DNA samples were collected.

[0101]

[0102] (2) Association analysis between SNP loci and fertility

[0103] The samples analyzed came from two different reproductive populations across three generations: F0, F1, F2 and WX0, WX1, WX2 (six populations in total). From each population, 30 berried shrimp were harvested after their eggs developed to orange color, and their tail fan tissue was preserved in alcohol. Genomic DNA of the redclaw crayfish was obtained using a DNA extraction kit. Following the optimized SNP tetra-primer ARMS PCR reaction system described in Example 1, the SNP genotyping band for the cq Vg2 c.6451A>G locus was obtained by agarose gel electrophoresis. The body weight, egg-carrying capacity, and SNP genotyping of each sample were statistically analyzed. The results were then analyzed using Duncan multiple comparisons in SPSS software to compare whether there were significant differences among the various genotypes (AA, AG, and GG) within the same population. When a difference was detected (P ≤ 0.05), the significant difference was indicated by different letters (a, b, c) after the corresponding number. The results are shown in Table 3 below.

[0104]

[0105] The results showed that the AA genotype exhibited significant advantages in both body weight and oviposition count: in the high-fertility selective breeding population, from F0 to F2 generations, the body weight of individuals with the AA genotype increased from 66.20g to 70.32g, and the oviposition count increased from 455.28 to 507.05, with the AA genotype showing significantly higher oviposition counts than the AG and GG genotypes in each generation; the unselected population also showed a trend consistent with the high-fertility population, with the AA genotype consistently showing significantly higher body weight and oviposition counts than the GG and AG genotypes. Artificial selection further enhanced the positive effect of the A allele, with the oviposition count and body weight of all genotypes in the selected population generally higher than those in the unselected population at the same time. In conclusion, the A allele at this SNP locus is significantly associated with high oviposition count, and the advantage continues to accumulate after multiple generations of selection, making it a potential target for molecular marker-assisted breeding and providing important molecular evidence for the targeted selection of high-yielding populations. Furthermore, the method described in this invention uses only four PCR primers and one PCR reaction to efficiently genotype the site by simply extracting DNA samples. It is simple, easy to operate, highly reproducible, convenient, and efficient, and has broad application prospects and extremely high economic value in the field of assisted breeding of redclaw crayfish.

[0106] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the present invention in any way. Other variations and modifications may be made without departing from the technical solutions described in the claims.

Claims

1. A primer set for detecting SNP molecular markers significantly associated with reproductive traits in redclaw crayfish, characterized in that, Include: Upstream primer: Its nucleotide sequence is shown in SEQ ID NO.1, specifically: CGAAGTGCTAGGACCAT; Downstream primer: Its nucleotide sequence is shown in SEQ ID NO.2, specifically: TGTGGGAATGGAGGAGC; SNP-A primers: Their nucleotide sequences are shown in SEQ ID NO.3, specifically: CTCCCCAGTGGACTTGTCATA; SNP-G primer: Its nucleotide sequence is shown in SEQ ID NO.4, specifically: GCAGAGATAATGATTGTGGAAAGC.

2. The primer set for detecting SNP molecular markers significantly associated with reproductive traits of redclaw crayfish according to claim 1, characterized in that, The nucleotide sequence containing the SNP molecular marker is shown in SEQ ID NO.

5. The nucleotide sequence has an A>G mutation at position 6451, which is divided into three genotypes: AA, AG and GG.

3. The application of the primer set described in claim 1 or 2 for detecting SNP molecular markers significantly associated with the reproductive traits of redclaw crayfish in the detection of the reproductive traits of redclaw crayfish, characterized in that, Includes the following steps: S1: Extract genomic DNA from the redclaw crayfish to be tested, and perform a tetra-primer ARMS-PCR amplification reaction of the SNP using the primer set described in claim 1 or 2 for detecting SNP molecular markers that are significantly related to the reproductive traits of redclaw crayfish. S2: Perform electrophoresis on the amplification product, obtain the detection results, and determine the genotype at position 6451 of the nucleotide sequence shown in SEQ ID NO.

5.

4. The application according to claim 3, characterized in that, Genomic DNA in S1 was collected from the ovarian tissue of the red swamp crayfish to be tested.

5. The application according to claim 3, characterized in that, The S1 tetra-primer ARMS-PCR reaction system is a 25 μL system, including: 12.5 μL PCR Mix, 4 μL primer system, 7.0 μL H2O, 1 μL gDNA, and 0.5 μL Taq DNA polymerase; wherein the primer system includes: 0.7 μL upstream primer, 0.7 μL downstream primer, 1.3 μL SNP-A primer, and 1.3 μL SNP-G primer.

6. The application according to claim 3, characterized in that, The PCR reaction program in S1 is as follows: 94℃ for 5 min pre-denaturation → 40 cycles → 72℃ for 10 min → 4℃ ∞; wherein the cycle includes: 94℃ for 30 s; 60℃ for 30 s; 72℃ for 30 s.

7. The application according to claim 3, characterized in that, In S2, agarose gel electrophoresis is used to obtain the detection results, and the reaction bands are classified. The reaction bands include control bands and target bands. The target bands include at least one type A band and a type G band. The classification of the detection results includes: If a control band of 541 bp and an A-type band of 399 bp are present, it indicates that position 6451 is of type AA. If a control band of 541 bp and a G-type band of 186 bp are present, it indicates that bit 6451 is of type GG. If a control band of 541 bp, an A-type band of 399 bp, and a G-type band of 186 bp are present, it indicates that bit 6451 is of type AG.

8. The use of the primer set of claim 1 or 2 for detecting SNP molecular markers that are significantly associated with the reproductive traits of redclaw crayfish in the preparation of a kit for detecting the reproductive capacity of redclaw crayfish.

Images