Kasp marker PH2-10-Kasp-147 closely linked with corn plant height and application of Kasp marker PH2-10-Kasp-147

Abstract

The invention relates to the technical field of plant molecular breeding, in particular to a Kasp marker PH2-10-Kasp-147 closely linked with corn plant height and application of the Kasp marker PH2-10-Kasp-147, an efficient corn plant height identification and dwarf screening technology is provided, a KASP primer group is designed in a matched manner by using an Indel site at 144727660 of a 10th chromosome of corn and polymorphism GCTGCTCATGAA / -, an optimized 10mu L PCR (Polymerase Chain Reaction) system and a three-stage reaction procedure are adopted, and a Kasp marker PH2-10-Kasp-147 is obtained. The plant height character is quantitatively judged through a relative value of a fluorescence signal, and through two-year four-plot verification of 465 maize inbred lines, the marker effect value E is smaller than or equal to-28, and the matching degree of typing, plant height phenotype and Sanger sequencing reaches 100%. The method is high in standardization degree and efficient in detection, early screening in the corn seedling stage can be achieved, the breeding efficiency of dwarf, lodging-resistant and close planting-resistant corn is remarkably improved, and powerful technical support is provided for guaranteeing grain safety.

Description

Technical Field

[0001] This invention relates to the field of plant molecular breeding technology, and more specifically, to a Kasp marker PH2-10-Kasp-147 closely linked to maize plant height and its application. Background Technology

[0002] Corn, as the most widely planted and highest-yielding grain crop in my country, accounts for approximately 40% of the country's total grain output and occupies a vital strategic position in ensuring national food security. However, my country's corn yield per unit area is only about 60% of that of the United States, while its fertilizer consumption per unit area is three times that of the US, indicating a significant gap in yield and resource utilization efficiency. Plant height, as a core agronomic trait of corn, directly determines lodging resistance and tolerance to dense planting. Developing new corn varieties with short stalks, lodging resistance, and tolerance to dense planting is a key breakthrough for increasing yield and ensuring food security. Identifying molecular markers closely linked to corn plant height and establishing an efficient detection system are core technological supports for accelerating the breeding process.

[0003] With the development of molecular biology techniques, single nucleotide polymorphisms (SNPs) and insertion / deletion markers (Indels) have become commonly used molecular marker types in crop genetics and breeding. Their wide distribution and genetic stability make them suitable for trait association analysis. Competitive allele-specific PCR (KASP) technology, with its advantages of high throughput, high precision, and low cost, has been widely used in marker-assisted breeding of crops, becoming a core platform for SNP and Indel marker genotyping. In existing technologies, reference document CN109337998A discloses an SNP marker associated with maize plant height and its corresponding KASP primers. This technology uses primers designed by screening SNP sites on specific maize chromosomes to achieve assisted selection for the maize plant height trait. However, practical verification has shown that this reference document has significant shortcomings: First, the association between the publicly disclosed SNP markers and maize plant height is limited, and the marker effect value is low. Validated in a single environment or with a small number of materials, the stability in multiple environments and large populations is insufficient, and it is easily affected by geographical and climatic conditions, leading to a decrease in the consistency between the genotyping results and the phenotype. Secondly, this technique does not specify the optimal concentration and volume ratio of primers, which can easily lead to non-specific amplification or primer dimers during PCR amplification, affecting the accuracy of genotyping. Third, there is a lack of quantitative criteria for determining plant height, and the judgment is based solely on the clustering trend of fluorescence signals, which is highly subjective and has poor repeatability between different laboratories. Fourth, it does not provide systematic algorithms for marker effect verification and genetic gain estimation, making it difficult to accurately assess the value of breeding applications. Summary of the Invention

[0004] The purpose of this invention is to provide a Kasp marker PH2-10-Kasp-147 closely linked to maize plant height and its application, in order to solve the problems mentioned in the background art, such as weak marker correlation, non-optimized detection system, poor result repeatability, and inaccurate evaluation of application value.

[0005] To achieve the above objectives, the present invention provides a Kasp marker PH2-10-Kasp-147 that is closely linked to maize plant height, comprising an Indel site that is closely linked to and identifies the maize plant height trait, a set of Kasp molecular marker primers for identifying the Indel site, and a kit for detecting the maize plant height trait. The Indel locus used to identify maize plant height is located on chromosome 10, 144727660, with a polymorphism of GCTGCTCATGBB / -. When the genotype is GCTGCTCATGAA:GCTGCTCATGAA, maize exhibits the dwarf trait; when the genotype is -:- or GCTGCTCATGAA:-, maize exhibits the tall trait.

[0006] Preferably, the Kasp molecular marker primer set includes forward primer 1, forward primer 2, and reverse primer; The sequence of the forward primer 1 is GAAGGTGACCAAGTTCATGCTCGGCAACACCAGCAGCT; The sequence of the forward primer 2 is GAAGGTCGGAGTCAACGGATTCGGCAACACCAGCAGCA; The sequence of the reverse primer is CCCGACTGCCCACTGACG; the association between the Kasp genotyping results of the primer set and the maize plant height trait conforms to the following judgment model: ; Where H represents the result of determining the maize plant height trait, and F... FAM The readings for the FAM fluorescent tag sequence at excitation wavelengths of 485 nm and emission wavelengths of 520 nm are given. HEX F represents the readings of the HEX fluorescent tag sequence at excitation wavelengths of 528 nm and emission wavelengths of 560 nm. ROX This is the reading for the reference dye.

[0007] Preferably, the concentrations of forward primer 1 and forward primer 2 are independently 4–10 μmol / L, and the concentration of the reverse primer is 4–10 μmol / L. The concentration range is determined based on validation using maize inbred lines. When the concentration is below 4 μmol / L, the PCR amplification signal intensity is insufficient, leading to ambiguous genotype clustering. When the concentration is above 10 μmol / L, non-specific amplification occurs, causing the genotyping accuracy to drop below 90%. A concentration of 6–8 μmol / L is selected, within which the fluorescence signal-to-noise ratio of Kasp genotyping is ≥3.5, the cluster dispersion of homozygous genotypes is ≤0.15, the cluster center deviation of heterozygous genotypes is ≤0.2, and the consistency with the maize plant height phenotype remains 100%.

[0008] Preferably, the volume ratio of the forward primer 1, the forward primer 2, and the reverse primer is 2:2:5.

[0009] Preferably, the kit includes the Kasp molecular marker primer set, as well as 2×ProbeMixA solution and ddH2O; the PCR amplification reaction system of the kit, per 10 μL, consists of: 2 μL maize genomic DNA, 0.14 μL primer set, 5 μL 2×ProbeMixA solution, and 2.86 μL ddH2O; the concentration of the maize genomic DNA is 50–100 ng / μL.

[0010] Preferably, the PCR amplification reaction program is as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 s, annealing at 61℃ for 40 s, for a total of 10 cycles; denaturation at 95℃ for 20 s, annealing at 55℃ for 40 s, for a total of 31 cycles; holding at 25℃ for 10 min; and storage at 4℃.

[0011] On the other hand, the present invention also provides an application of the Kasp marker PH2-10-Kasp-147, which is closely linked to maize plant height as described above, including its application in maize breeding and in screening for dwarf maize. When applied in maize breeding, the following marker effect verification algorithm is used to verify the association between the Indel site and maize plant height: ; Where E is the plant height effect value at the Indel site, H BBi Let be the plant height value of the i-th homozygous BB genotype maize material. The mean plant height is the homozygous bb genotype maize material, n is the number of homozygous BB genotype maize materials, and CV is the coefficient of variation of plant height data for all tested maize materials; when E≤-25, the Indel locus is considered to be significantly associated with the dwarf trait.

[0012] Preferably, the application in the screening of dwarf corn includes the following steps: (1) Extract genomic DNA from the maize materials to be screened; (2) The genomic DNA was amplified by PCR using the Kasp molecular marker primer set described in claim 2 to obtain the amplification product; (3) Perform Kasp genotyping on the amplified products and determine the plant height trait of maize materials according to the determination model described in claim 2; (4) Screening results for short-stalked corn materials to complete the screening of short-stalked corn.

[0013] Preferably, when applied in maize breeding, the following genetic gain estimation formula is used to evaluate selection efficiency during the breeding process: ; Where G is the genetic gain, h 2 Let σ represent the broad-sense heritability of maize plant height, i represent the selection intensity, and σ represent the heritability of the maize plant height trait. p The phenotypic standard deviation of maize plant height is given; the broad-sense heritability of the maize plant height trait is calculated using the following formula: ; Among them, V G V represents the genetic variance. E This represents environmental variance.

[0014] Preferably, when applying the method to screen dwarf maize, the degree of agreement between the Kasp genotyping results and the maize plant height trait is verified by the following formula: ; Where C represents the degree of fit, and N... 一致 N represents the number of maize materials whose Kasp genotyping results are consistent with the actual plant height trait. 总 The total number of maize materials tested; when C≥98%, the primer set is determined to be suitable for screening dwarf maize.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. The Kasp marker PH2-10-Kasp-147, which is tightly linked to maize plant height, and its application demonstrate a strong correlation with the trait, and the detection system is accurate and stable. Its Indel locus is located at 144727660 on maize chromosome 10. Systematic validation over two years across four locations using 465 maize inbred lines showed clear polymorphism and tight linkage with plant height, with a marker effect value E≤-28, significantly superior to conventional molecular markers. The KASP primer set designed based on this locus, optimized with a concentration of 6–8 μmol / L and a volume ratio of 2:2:5, exhibited outstanding PCR amplification specificity, primer dimer content ≤0.8%, and biallelic amplification efficiency difference ≤3%, effectively avoiding interference from non-specific amplification. The detection process does not require gel electrophoresis; typing is performed directly based on fluorescence signals. Combined with a standardized judgment model, the typing results show 100% agreement with Sanger sequencing and actual plant height traits. The fluorescence signal-to-noise ratio is ≥3.5, the homozygous cluster dispersion is ≤0.15, and the heterozygous cluster center deviation is ≤0.2, ensuring the reliability and consistency of the detection results.

[0016] 2. This study, focusing on the Kasp marker PH2-10-Kasp-147, which is closely linked to maize plant height, and its application, clarified the precise ratio of the PCR reaction system, the three-stage gradient annealing reaction procedure, and the quantified criteria for plant height determination. All parameters were optimized and finalized through multiple experiments. Different laboratories can obtain consistent results when operating according to the protocol, solving the problems of poor repeatability and ambiguous parameters in traditional molecular marker detection, thus facilitating large-scale promotion. In breeding practice, this marker can achieve early screening of maize seedling height traits without waiting for maturity. Combined with marker effect verification algorithms and genetic gain estimation formulas, it can accurately assess selection efficiency, increasing the efficiency of dwarf maize germplasm breeding by more than 40% and significantly shortening the breeding cycle. This technology aligns with the industry's demand for increased maize yield and quality in my country, providing an efficient and reliable technical tool for breeding new dwarf, lodging-resistant, and densely planted maize varieties, and has significant practical implications for ensuring national food security. Attached Figure Description

[0017] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are explained in detail together with the embodiments of the invention, but do not constitute a limitation thereof.

[0018] Figure 1 This is a normal distribution diagram of maize plant height trait in an embodiment of the present invention; Figure 2 This is a chromosome distribution diagram of SNP markers according to an embodiment of the present invention; Figures 3 - 12 The Manhattan plot and QQ plot are shown in the genome-wide association analysis of maize plant height in this embodiment of the invention. Figure 13Regional association analysis and LD heatmap of candidate gene Zm00001eb430990 in this embodiment of the invention; Figure 14 This invention provides an embodiment of the analysis of the plant height phenotypic effect of the allelic variation at the Indel locus at Chr10:144727660 based on resequencing data. Figure 15 This is a partial Sanger sequencing alignment result of maize Chr10 at 144727660 in Example 465 of this invention; Figure 16 This invention provides an embodiment based on Sanger sequencing data analysis of the plant height phenotypic effect of allelic variation at the Indel locus at Chr10:144727660; Figure 17 The results of KASP molecular marker typing of maize plant height in Example 465 of this invention; Figure 18 This invention provides an embodiment based on KASP data analysis of the plant height phenotypic effect of allelic variation at the Indel locus at Chr10:144727660. Detailed Implementation

[0019] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Example 1

[0020] I. Purpose of Implementation This embodiment aims to disclose in detail the preparation, detection methods, and application procedures of the Indel site and KASP molecular marker primer set closely linked to maize plant height, verify the effectiveness and stability of the marker in identifying maize plant height traits and screening dwarf maize, provide a reproducible and standardized technical solution for marker-assisted breeding of maize, and accelerate the breeding process of new dwarf, lodging-resistant, and densely planted maize varieties.

[0021] II. Experimental Materials and Instruments (a) Experimental materials 1. Maize materials used in the test: 465 high-quality maize inbred lines (DH lines) bred in the past 15 years were selected and provided by the Shenzhen Genomics Institute of the Chinese Academy of Agricultural Sciences. This population covers a wide range of plant height phenotypic variations, which are suitable for verifying the association between markers and traits.

[0022] 2. Planting locations: In 2024, the experimental field in Guangxing Village, Yangshu Street, Acheng District, Harbin City, Heilongjiang Province (126°53′8.73″E, 45°29′39.88″N) was planted; in 2025, the experimental fields in Acheng, Suihua City, Harbin City, Wangkui County, Huojian Town (126°20′23″E, 46°35′34″N), and Zhaodong City, Harbin City, Liming Town, Changfu Village (125°22′28″E, 45°11′24″N) were planted, for a total of four planting environments over two years.

[0023] 3. Reagents: 1.5×CTAB extraction buffer (containing 15g / L CTAB, 75mL / L 1mol / L [Tris.Cl](Tris.Cl) (pH 8.0), 30mL / L 0.5mol / L EDTA, 61.4g / L NaCl, with 0.2% mercaptoethanol added before use), chloroform / isoamyl alcohol (24:1 v / v), anhydrous ethanol, 75% ethanol, TE buffer, 2×Probe Mix A solution, ddH2O, KASP primers (synthesized by a professional biotechnology company), Hieff NGS® Fast-Pace DNA circularization kit (Yisheng Biotechnology, catalog number 13341ES96), Qubit® ssDNA detection kit (Thermo Fisher Scientific, catalog number Q10212).

[0024] (II) Experimental Instruments Liquid nitrogen tank, mortar and pestle, 15mL centrifuge tubes, constant temperature water bath, high-speed centrifuge, nucleic acid concentration analyzer, ABI 7500 qPCR instrument, MGI® DNBSEQ-T1 sequencer, high-throughput computer server, Microsoft Excel 2022, IBM SPSS Statistics V27.0, Origin 2021, R language 1me4 package, iqTree software, Plink software, Faststructure software, GEMMA software, Taqman Genotyper software.

[0025] III. Experimental Methods (I) Data Collection and Analysis of Maize Plant Height Phenotypic 1. Planting design: A randomized block design was adopted, with two rows planted for each maize sample, each row being 3m long, with a row spacing of 0.65m and a plant spacing of 0.2m. Fertilizer and water management were the same as in conventional field.

[0026] 2. Plant height measurement: During the corn maturity period, exclude the first plant in each row and select 5 representative plants. Measure the distance from the ground to the top of the corn plant and record the plant height data.

[0027] 3. Phenotypic Data Analysis: Data was processed using Microsoft Excel 2022, analyzed using IBM SPSS Statistics V27.0 for coefficient of variation, skewness, and kurtosis, and histograms of frequency distribution were plotted using Origin 2021 for normality testing. The generalized heritability was estimated using the R language package 1me4, with the following formula: ; Where VG represents genetic variance and VE represents environmental variance.

[0028] (II) Extraction of maize genomic DNA 1. Weigh 1.0g of fresh corn leaves, chop them, and place them in a mortar. Add liquid nitrogen and grind quickly until powdered. Immediately add 3mL of 1.5×CTAB extract, grind into a homogenate, and transfer to a 15mL centrifuge tube. Rinse the mortar with 1mL of 1.5×CTAB and transfer to the same centrifuge tube. The 1.5×CTAB formulation is as follows (1L): CTAB 15g 1 mol / L Tris.Cl (pH 8.0) 75 mL 0.5 mol / L EDTA 30 mL NaCl 61.4g 2. Place the centrifuge tubes in a 65°C constant temperature water bath for 30 minutes, and shake them slowly every 10 minutes during this period.

[0029] 3. After the sample has cooled to room temperature, add an equal volume of chloroform / isoamyl alcohol, gently invert and mix until the lower layer is dark green, then centrifuge at 4200 rpm for 10 min.

[0030] 4. Transfer the upper aqueous phase to a new 15mL centrifuge tube, add 2 volumes of pre-cooled anhydrous ethanol, mix gently, let stand for 5 minutes, and then place in a -20℃ freezer for 30 minutes to precipitate the DNA.

[0031] 5. Centrifuge at 4200 rpm for 10 min, discard the supernatant, wash the precipitate once with 1 mL of 75% ethanol, invert the centrifuge tube to air dry the DNA, add 50 μL of TE buffer to dissolve, and adjust the DNA concentration to 50–100 ng / μL using a nucleic acid concentration analyzer for later use.

[0032] (6) The DNA concentration was determined and adjusted to 20 ng / ul with water. A library was constructed using a simplified AIO-seq method. Multiple samples were fragmented using Tn5 transposase, and MGI® sequencing adapters were ligated during PCR amplification. After mixing the samples, fragment sizes were screened, and the selected mixed samples were circularized using the Hieff NGS® Fast-Pace DNA Circulation Kit. The enzyme digestion products were quantified using the Qubit® ssDNA Detection Kit. Finally, the circularized library was sequenced on an MGI® DNBSEQ-T1 sequencer, producing 150 bp paired-end reads and yielding approximately 5× resequencing data.

[0033] (III) Preparation of KASP molecular marker primer set 1. Primer Design: Based on the Indel site at 144727660 on maize chromosome 10 (polymorphism GCTGCTCATGAA / -), a set of KASP primers was designed, including forward primer 1 (PH2-10-KASP-147F1), forward primer 2 (PH2-10-KASP-147F2), and reverse primer (PH2-10-KASP-147R), with the following sequences: Forward primer 1: GAAGGTGACCAAGTTCATGCTCGGCAACACCAGCAGCT; Forward primer 2: GAAGGTCGGAGTCAACGGATTCGGCAACACCAGCAGCA; Reverse primer: CCCGACTGCCCACTGACG; 2. Primer concentration adjustment: Dilute forward primer 1, forward primer 2 and reverse primer to 6 μmol / L, respectively. The concentration range of forward primer 1 and forward primer 2 is 4 to 10 μmol / L, and the concentration range of reverse primer is 4 to 10 μmol / L, with a preferred concentration of 6 to 8 μmol / L.

[0034] 3. Primer Mix Preparation: Prepare the primer mix according to the ratio of forward primer 1: forward primer 2: reverse primer: ddH2O = 6μL: 6μL: 15μL: 23μL. This ratio corresponds to the volume ratio of forward primer 1, forward primer 2 and reverse primer in the primer set being 2:2:5.

[0035] (iv) PCR amplification and KASP genotyping detection 1. PCR reaction system: Prepared in a total volume of 10 μL, including 2 μL (4-50 ng) of maize genomic DNA, 0.14 μL of primer mix, 5 μL of 2×Probe Mix A solution, and 2.86 μL of ddH2O.

[0036] 2. PCR reaction procedure: Stage 1: Pre-denaturation at 95℃ for 10 min; Stage 2: Denaturation at 95℃ for 20 s, annealing at 61℃ for 40 s, for a total of 10 cycles; Stage 3: Denaturation at 95℃ for 20 s, annealing at 55℃ for 40 s, for a total of 31 cycles; Stage 4: Hold at 25℃ for 10 min, then store at 4℃ for later use.

[0037] 3. KASP Genotyping: PCR amplification products were placed on an ABI 7500 qPCR instrument and held at 35°C for 30 seconds for fluorescence signal detection. Readings were taken for the FAM fluorescent tag sequence (excitation 485nm, emission 520nm), the HEX fluorescent tag sequence (excitation 528nm, emission 560nm), and the reference dye ROX. Data standardization was performed using Taqman Genotyper Software, and the relative fluorescence value F was calculated. FAM / F ROX and F HEX / F RO .

[0038] 4. Determination of plant height trait: The following determination model was used to determine the maize plant height trait: ; in: F FAM / F ROX ≥0.8 and F HEX / F ROX ≤0.2 corresponds to homozygous genotype BB (containing GCTGCTCATGAA); F FAM / F ROX ≤0.2 and F HEX / F ROX ≥0.8 corresponds to the homozygous genotype bb (deleted GCTGCTCATGAA); 0.3≤F FAM / F ROX ≤0.7 and 0.3≤F HEX / F ROX ≤0.7 corresponds to the heterozygous genotype Bb.

[0039] (v) Verification of label validity and application effect 1. Marker effect verification: The following algorithm was used to verify the association between Indel sites and maize plant height: ; Where E is the plant height effect value of the Indel locus, HBBi is the plant height value of the i-th homozygous BB genotype maize material, is the average plant height value of the homozygous BB genotype maize material, n is the number of homozygous BB genotype maize materials, and CV is the coefficient of variation of plant height data of all tested maize materials; when E≤-25, the Indel locus is considered to be significantly associated with the dwarf trait.

[0040] 2. Consistency Verification: The consistency between the KASP genotyping results and the actual plant height trait was calculated using the following formula: ; Where C represents the degree of agreement, N_consistent represents the number of maize materials whose Kasp genotyping results are consistent with the actual plant height trait, and N_total represents the total number of maize materials tested.

[0041] 3. Genetic gain estimation: In maize breeding applications, the following formula is used to assess selection efficiency: ; Where G is the genetic gain, h2 is the broad heritability of maize plant height, i is the selection intensity, and σp is the phenotypic standard deviation of maize plant height.

[0042] IV. Experimental Results and Analysis (I) Phenotypic characteristics of maize plant height The mean plant height of 465 maize inbred lines in four different locations over two years ranged from 214.34 to 247.94 cm, with phenotypic variation ranging from 99.33 to 348.00 cm and coefficients of variation from 13.47% to 14.56%, all exceeding 13%, indicating rich phenotypic variation in plant height. The absolute values ​​of skewness and kurtosis for plant height were both less than 1, and the data distribution conformed to a normal distribution, consistent with quantitative trait characteristics. The broad-sense heritability was 86%, indicating that plant height is mainly influenced by genetic factors and is suitable for molecular marker association analysis.

[0043] (II) KASP genotyping results The genotyping results of the KASP marker PH2-10-KASP-147 on 465 maize materials showed that the marker could clearly distinguish three genotypes: the blue cluster was the homozygous BB genotype (containing GCTGCTCATGAA), the orange-red cluster was the homozygous bb genotype (lacking GCTGCTCATGAA), and the green cluster was the heterozygous Bb genotype (one containing GCTGCTCATGAA and one lacking GCTGCTCATGAA). Only a very small number of samples could not be clearly genotyped due to DNA quality issues, and the genotyping effect was good.

[0044] (III) Correlation between markers and plant height trait 1. Plant height phenotypic effect: The plant height of homozygous BB genotype maize materials in four locations over two years was significantly lower than that of homozygous bb and heterozygous Bb genotypes. The average plant height of homozygous BB genotype was 197.6–205.8 cm, that of homozygous bb genotype was 232.9–259.5 cm, and that of heterozygous Bb genotype was 222.6–235.0 cm. The marker effect value E≤-28 indicates that this Indel locus is significantly associated with the dwarf trait.

[0045] 2. Consistency verification: The concordance between the KASP genotyping results and the actual plant height trait was 100%, and the concordance with the Sanger sequencing results was also 100%, proving that the KASP marker can accurately identify the maize plant height trait.

[0046] (iv) Optimization effect of primer concentration and volume ratio When the concentrations of forward primer 1, forward primer 2, and reverse primer are 6–8 μmol / L, the fluorescence signal-to-noise ratio for KASP genotyping is ≥3.5, the cluster dispersion of homozygous genotypes is ≤0.15, and the cluster center deviation of heterozygous genotypes is ≤0.2, resulting in optimal genotyping accuracy. When the primer volume ratio is 2:2:5, the primer dimer content is ≤0.8%, the difference in biallelic amplification efficiency is ≤3%, and the clustering effect is clear with no cross-over, significantly better than other ratio combinations.

[0047] V. Implementation Conclusions 1. For example Figure 1 The figure shows the normal distribution of maize plant height, from left to right: plant height distribution in Acheng in 2024, Acheng in 2025, Wangkui in 2025, Zhaodong in 2025, and BLUP in 2025. The absolute values ​​of skewness and kurtosis for plant height are both less than 1, and the data distribution curve conforms to a normal distribution, indicating that the plant height data conforms to quantitative trait characteristics.

[0048] 2. GWAS analysis of maize plant height yielded significant SNPs and candidate genes. All sequencing data were processed and analyzed using a high-performance computer server. Raw data processing: After quality assessment of the raw PE (Pair-end) sequencing data using FastQC, quality control was performed using BWA. Sequencing reads were aligned to a reference genome (B73v5), and SNP and Indel detection was performed using GATK. After quality control filtering at the sample and variant levels, 6,945,041 high-quality SNP markers and 448,418 Indel markers (minimum allele frequency > 0.05, missing data < 20%) were selected, ensuring the accuracy and reliability of the analysis results. To better understand population structure and genetic background, a phylogenetic tree was constructed using iqTree software, principal component analysis (PCA) was performed on the whole-genome SNP data using Plink software, and population structure analysis was performed using Faststructure software to clarify the genetic structure within the population. Genome-wide association analysis was performed on plant height and its BLUP value using the previously selected high-quality SNPs. Association analysis between SNP markers and various traits was performed using a mixed linear model of genotype, phenotype, population structure, and kinship matrix in GEMMA. All SNPs satisfying p < 1.7286e-5 were extracted from the GWAS results file using awk and converted to BED format files (Chr, Start, End). Major SNPs associated with plant height trait were obtained through GWAS analysis based on data from two years, four locations, and BLUP. The bedtools intersect tool was used to compare significant SNPs and their upstream and downstream 100 kb regions with the B73RefGen_v5 GFF gene annotation file to screen candidate genes. Candidate genes with significant SNPs within their genes were prioritized. The candidate gene Zm00001eb430990, selected from candidates from the two years, four locations, and BLUP, was chosen as the final candidate gene. (See results in section 10). Figures 2 - 4 .

[0049] 3. Association analysis of candidate genes for maize plant height and discovery of new Indel loci and KASP markers Based on the SNPs and Indel markers obtained from resequencing in step 3, 326 SNPs and 54 Indel markers were extracted from the Zm00001eb430990 region of the candidate gene for plant height. Association analysis was performed using phenotypes to identify the top five markers with the highest significance. Among these was a 12-base deletion mutation, GCGTGCTCATGBB, located at exon 144727660. Based on genotype data from 465 maize samples at this location, combined with plant height phenotypic data from four locations over two years, the phenotypic effect of the Indel at this location on plant height was analyzed. The results showed that plant height with the deletion of 12 bases was significantly higher than that without the deletion, and this was highly significant in all four locations over two years. To verify the authenticity and reliability of the Indel data, genomic DNA was extracted from leaves of 465 maize inbred lines and the maize B73 variety using the CTAB method. DNA sequences containing the Indel marker were amplified, and Sanger sequencing was performed again to analyze the phenotypic effect of the Indel. The results showed that the data from first-generation sequencing and resequencing at this Indel were consistent, and the phenotypic effect analysis over two years and four locations was also highly significant. The amplification and sequencing primers are as follows: Primer Name F Forward Primer (5’ to 3’) ​ 659 ​ ​ 4. Development and validation of KASP markers for maize plant height Based on candidate gene association analysis, Indel variation sites that can be used to distinguish the height trait among different maize inbred lines were screened. KASP molecular markers for rapid identification were developed for these sites.

[0050] Specifically as follows: (1) DNA was extracted from 465 maize inbred lines using the CTAB method; (2) Using DNA as a template, fluorescent polymerase chain reaction (PCR) genotyping was performed using KASP primers. The KASP primers were designed based on the indel at position 144727660 on chromosome 10 of maize. The primers are shown in the table below:

[0051] The PCR amplification reaction system, in 10 μl increments, consisted of: 2 μl of 4-50 ng / μl genomic DNA, 0.14 μl of primer mix (prepared by mixing 6 μl of forward primer 1, 6 μl of forward primer 2, 15 μl of reverse primer, and 23 μl of ddH2O), 5 μl of 2x ProbeMix A solution, and 3 μl of ddH2O. The PCR amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 61℃ annealing for 40 s, 10 cycles; 95℃ denaturation for 20 s, 55℃ annealing for 40 s, 31 cycles; 25℃ for 10 min; 4℃ for storage.

[0052] After amplification, KASP detection was performed based on the AQP genotyping system operating instructions. The PCR program on the ABI 7500 qPCR instrument was set to 35℃ for 30 seconds. The results file was exported, and the genotypes were further determined according to the sample clusters. Results analysis was performed using Taqman Genotyper Software. The fluorescence values ​​corresponding to HEX and FAM for each PCR reaction well were obtained and divided by the value of the reference dye (ROX) for that well. The fluorescence values ​​were standardized to obtain the relative fluorescence values ​​of HEX and FAM for each PCR reaction well (FAM fluorescent tag sequences were observed at excitation wavelength of 485nm and emission wavelength of 520nm, and HEX fluorescent tag sequences were observed at excitation wavelength of 528nm and emission wavelength of 560nm). Based on the relative fluorescence values, the samples were clustered. The detection results are as follows: ​ As shown.

[0053] Depend on ​ It can be seen that there are three genotypes at this locus: the blue dot represents the homozygous genotype BB (containing GCTGCTCATGAA), the red dot represents the homozygous genotype bb (deleting GCTGCTCATGAA), and the green dot represents the heterozygous genotype Bb (one containing GCTGCTCATGAA and one deleting GCTGCTCATGAA).

[0054] The analysis shows the degree of agreement between the maize plant height trait and the typography results, the correspondence between the maize plant height trait and the typography results, and the degree of agreement (see table below). ​ ).

[0055] ​ ​ ​ ​ ​ ​ ​ ​ 1 ​ ​ 200 215 231.33 233.67 200.89 2 ​ ​ 194 216 212.67 220.33 195.13 3 ​ ​ 250 273 295.33 260.33 240.39 4 ​ ​ 234 280 241.67 243.67 226.79 5 ​ ​ 212 255 226.67 211.67 215.28 6 ​ ​ 190 231 198.67 191 215.78 7 ​ ​ 210 221 198 198 188.08 8 ​ ​ 261 280 240.33 232.33 259.54 9 ​ ​ 207 267 230.67 209 277.41 10 ​ ​ 193 240 206.33 208.67 271.15 12 ​ ​ 238 323 274.33 248.67 230.86 13 ​ ​ 200 235 197.33 195.33 267.18 14 ​ ​ 216 238 214 212.33 196.82 15 ​ ​ 213 236 210 196.33 234.83 16 ​ ​ 207 243 212.67 215 198.01 17 ​ ​ 254 289 266 269 276.31 18 ​ ​ 230 242 230.67 207 222.42 19 ​ ​ 190 241 197.33 181 215.67 20 ​ ​ 222 205 193.67 181 243.26 21 ​ ​ 164 198 171.33 173.67 226.79 22 ​ ​ 255 216 220.67 191.33 247.63 23 ​ ​ 202 224 215 192 168.14 24 ​ ​ 298 286 274.33 279.33 212.30 25 ​ ​ 236 273 246 235.33 216.07 26 ​ ​ 240 257 239.67 215.33 236.42 27 ​ ​ 268 290 266.33 258.67 267.78 28 ​ ​ 238 273 258.33 248.67 256.66 29 ​ ​ 250 275 280.67 262.33 218.26 30 - - 260 300 303 272.33 293.58 31 ​ ​ 235 316 305 283 227.09 32 ​ ​ 228 241 233.67 196.33 236.52 33 ​ ​ 212 235 195 223 274.72 34 ​ ​ 200 224 264 224.33 238.20 35 ​ ​ 242 265 260.67 240.67 218.65 38 ​ ​ 208 267 252 225 252.44 39 ​ ​ 242 240 246 232 219.85 40 ​ ​ 258 271 270.67 248 224.01 41 - - 272 261 272.67 260.33 239.89 42 ​ ​ 210 234 204.33 214 210.61 43 ​ ​ 236 253 239.67 228 213.39 44 ​ ​ 232 285 294 241 195.43 45 ​ ​ 265 257 271.5 237.33 220.54 46 ​ ​ 177 203 199.33 196.33 253.69 47 ​ ​ 188 225 229.67 201.67 255.47 48 ​ ​ 202 210 194.33 188.33 257.36 49 ​ ​ 203 220 177.67 175.67 278.89 50 - - 222 245 252.67 227.67 266.49 51 ​ ​ 184 211 199.33 200 213.49 52 ​ ​ 203 226 204.67 201.67 224.81 53 ​ ​ 213 222 222.67 235 265.40 54 ​ ​ 210 217 211.67 212.33 219.35 55 ​ ​ 174 208 180 184.67 226.89 56 ​ ​ 193 230 207 205.67 195.73 57 ​ ​ 240 255 212.67 220.67 237.91 58 ​ ​ 221 232 226.33 212 207.24 59 ​ ​ 153 160 156.67 155.67 208.13 60 ​ ​ 260 264 237 222.67 267.68 61 - - 213 338 226 188 250.71 62 ​ ​ 192 ​ ​ ​ 211.41 63 ​ ​ 186 221 207.33 197 211.31 64 ​ ​ 230 267 211 236 259.74 65 ​ ​ 197 221 209.33 204.33 246.84 66 ​ ​ 200 184 201.33 182.67 276.91 67 ​ ​ 180 170 200.33 171.33 208.83 68 ​ ​ 196 193 189.67 191.67 266.98 69 ​ ​ 157 203 182.33 166.33 169.93 70 ​ ​ 270 222 218.33 222.67 253.19 71 ​ ​ 192 230 210.67 218 274.43 72 ​ ​ 210 237 207 220 196.92 73 ​ ​ 237 262 232.67 219.67 250.21 74 ​ ​ 215 275 251 244 250.71 75 - - 230 285 290 235.67 267.98 76 ​ ​ 248 266 270 240 220.94 77 ​ ​ 266 262 260.33 226.67 206.94 79 ​ ​ 292 298 285.67 260.33 218.85 80 ​ ​ 253 260 269 253.33 269.66 81 ​ ​ 260 271 225.33 245.33 236.32 82 ​ ​ 258 310 276.33 268.33 265.79 83 ​ ​ 262 301 263.67 258 239.10 84 ​ ​ 269 294 253.33 251 267.48 85 ​ ​ 278 290 265.67 257.33 241.78 86 ​ ​ 183 246 224.67 220 268.57 87 ​ ​ 251 248 233.67 210.67 ​ 88 ​ ​ 250 261 227 226.33 240.19 89 ​ ​ 224 228 208.33 198.67 224.41 90 ​ ​ 220 243 237.67 210 278.69 91 ​ ​ 236 226 231.67 207 231.85 92 ​ ​ 257 245 230 198 222.22 93 ​ ​ 278 260 232.33 225 206.15 94 ​ ​ 268 273 255.33 255 242.18 95 ​ ​ 276 285 275 270 195.93 96 ​ ​ 260 281 270.67 257.67 233.84 97 ​ ​ 269 280 278 254.67 196.02 98 ​ ​ 250 270 233 180.67 238.11 99 ​ ​ 241 258 219.33 234.33 237.80 100 ​ ​ 205 246 214.67 194 234.04 101 ​ ​ 200 221 228.67 206.67 165.06 102 ​ ​ 265 306 272.67 271 258.40 103 ​ ​ 262 338 274.67 263 258.75 104 - - 235 250 232.67 234.33 211.41 105 ​ ​ 248 305 255 224.67 237.01 106 ​ ​ 272 305 252.67 257.67 210.22 107 ​ ​ 202 230 198.33 197 233.04 108 ​ ​ 195 227 186.33 165.67 221.93 109 ​ ​ 256 278 254.67 227.33 240.88 110 ​ ​ 183 198 196 189 270.36 111 ​ ​ 270 254 231 208 221.83 112 - - 228 231 232 202 245.15 113 ​ ​ 204 321 229 240.33 239.69 114 ​ ​ 236 280 253 230.33 231.16 115 ​ ​ 269 261 242.67 231.33 235.92 116 ​ ​ 253 310 248.33 218.33 265.79 117 ​ ​ 223 213 238.67 224.67 284.75 118 ​ ​ 246 256 252.33 241.33 244.26 119 ​ ​ 230 272 261 227 244.95 120 ​ ​ 151 173 152 163.67 245.25 121 ​ ​ 152 174 156 152.67 227.19 122 ​ ​ 117 165 ​ 136 267.28 123 ​ ​ 228 223 204 216.67 238.90 124 ​ ​ 175 195 209 175.33 230.07 125 ​ ​ 267 292 265.33 242 229.37 126 ​ ​ 243 292 270.67 254.67 225.70 127 ​ ​ 204 230 196.67 182.33 232.64 128 ​ ​ 204 240 208 203 222.33 129 ​ ​ 206 216 235 209 251.21 130 ​ ​ 206 235 234.33 212 219.65 131 ​ ​ 218 247 236 197.67 232.65 132 - - 250 274 276.33 229 281.57 133 ​ ​ 256 290 281.67 252 197.91 134 - - 270 308 281.33 251.33 227.98 135 ​ ​ 268 253 273 254.67 245.25 136 ​ ​ 232 285 264.67 261 195.53 137 ​ ​ 268 278 262 244.67 225.70 138 ​ ​ 260 298 172.67 263 252.30 139 ​ ​ 258 288 269.33 259 258.05 140 ​ ​ 225 306 278.33 267 181.54 141 ​ ​ 224 ​ 239 236 257.37 142 ​ ​ 164 ​ ​ ​ 230.76 143 ​ ​ 235 253 215.33 226 237.11 144 - - 215 242 203.67 226 224.11 145 ​ ​ 241 168 234 252.67 269.76 146 - - 177 314 186.67 196 250.71 147 - - 252 212 188.67 186 249.42 148 ​ ​ 245 274 256 241.67 265.59 149 ​ ​ 268 268 236.67 226.67 267.08 150 ​ ​ 240 218 223.67 203.33 205.75 151 ​ ​ 235 250 218.67 234.67 231.65 152 ​ ​ 257 295 238.33 243.67 170.72 154 ​ ​ 245 236 255 226.67 256.46 155 ​ ​ 225 215 228 226.33 199.10 156 ​ ​ 227 234 242.33 227.67 252.60 157 ​ ​ 197 223 250.33 213.33 212.55 158 ​ ​ 258 285 241.5 259.33 258.05 159 ​ ​ 234 278 247.67 256 245.45 160 ​ ​ 223 265 262.67 267 277.90 161 ​ ​ 280 220 206.33 201.67 222.42 162 ​ ​ 220 244 212 223.33 202.67 163 ​ ​ 218 209 209 206 219.35 164 ​ ​ 228 230 229 202.33 199.00 165 ​ ​ 220 248 204.33 211 254.18 166 ​ ​ 202 221 205 202.33 259.24 167 ​ ​ 250 297 271.33 257.67 255.77 168 ​ ​ 270 265 239.67 224 216.67 170 ​ ​ 226 206 223 211.67 228.87 171 ​ ​ 220 261 216 246 215.58 172 ​ ​ 204 221 212.67 196.67 248.33 173 ​ ​ 240 252 230.33 228 261.03 174 ​ ​ 203 233 195.33 228.67 217.66 175 ​ ​ 265 310 267.33 297 244.36 176 ​ ​ 252 272 250 243 221.33 177 ​ ​ 250 255 229 242.33 252.89 178 ​ ​ 260 254 253.33 233.33 222.13 179 ​ ​ 225 242 237.67 226 212.10 180 ​ ​ 210 247 229.33 204.67 245.84 181 ​ ​ 183 302 294.33 263.67 243.37 182 ​ ​ 267 279 282.67 254 252.20 183 ​ ​ 260 272 257.67 244.67 255.27 184 ​ ​ 258 270 248.33 241.67 234.53 186 ​ ​ 214 254 217.33 217 252.49 187 ​ ​ 220 242 254.67 241.33 262.12 188 ​ ​ 220 222 241.67 202.33 254.98 189 ​ ​ 210 237 233 229.33 275.92 190 ​ ​ 265 300 235.33 229.67 244.16 191 ​ ​ 216 251 229 213 250.61 193 ​ ​ 254 249 215.67 191 245.85 194 - - 236 212 206.67 200.33 257.65 195 ​ ​ 214 236 231 215.33 227.58 196 ​ ​ 277 306 289 268.67 219.94 197 ​ ​ 216 285 259.33 245.33 189.58 198 ​ ​ 278 332 284.33 252.67 240.59 199 ​ ​ 235 260 236.67 245 203.77 200 ​ ​ 210 317 208.33 231.33 229.37 201 ​ ​ 195 220 251.33 204.67 226.69 202 ​ ​ 175 205 190 180.33 239.89 204 ​ ​ ​ 276 244 188 235.23 205 ​ ​ ​ 225 202.33 209 210.61 206 ​ bb NA 206 203.33 204.67 244.37 207 BB BB NA 184 170.67 173 245.55 208 Bb Bb NA 268 236.67 223.67 186.10 209 bb bb NA 305 258.33 253.67 160.37 210 bb bb NA 276.5 257.94 247.94 269.76 211 Bb Bb NA 224 202 202 214.09 212 Bb Bb NA 263.71 247 228 256.86 213 bb bb 232 269 234.67 210.67 260.83 214 bb bb 234 240 225 215.33 234.83 215 Bb Bb 258 279 224.67 243.33 231.16 216 bb bb 258 250 243.67 249 209.82 217 Bb Bb 294 291 270.67 262.33 216.47 218 bb bb 296 312 264.33 271.67 227.09 219 bb bb 260 257 221.67 247.33 257.16 220 - - 267 300 255.67 259 216.42 221 bb bb 280 266 232.33 257.33 185.70 222 bb bb 244 285 251.67 231.67 211.51 223 bb bb 260 295 241.33 260 201.38 224 bb bb 248 290 256.67 263.33 220.04 225 bb bb 248 288 268.33 267.67 217.86 226 bb bb 246 278 245.67 234.67 280.48 227 bb bb 250 274 244.67 243.67 237.51 228 bb bb 250 268 249.67 242.33 230.56 229 Bb Bb 214 220 255.67 220.33 243.86 230 BB BB 240 220 232.33 184.67 230.76 231 bb bb 206 219 191 203 238.20 232 BB BB 158 156 186.33 149 213.89 233 Bb Bb 154 198 154.33 163.33 226.99 234 Bb Bb 210 205 184 197.67 251.70 235 Bb Bb 232 264 205.33 242.33 255.67 236 BB BB 206 231 271 202.33 261.52 237 bb bb 207 235 192.33 204.5 285.05 238 BB BB 228 263 228.33 229.67 177.96 239 Bb Bb 198 172 242.33 151.33 222.53 240 BB BB 228 300 214.33 228 223.71 241 bb bb 224 278 231.67 220.33 195.53 242 BB BB 242 250 236.33 220.33 236.62 243 bb bb 145 282 195.33 187.67 215.18 244 Bb Bb 230 260 236.33 228.33 261.63 245 Bb Bb 198 254 200.67 210.67 247.43 246 - - 265 338 266.67 249.33 267.48 247 bb bb 190 213 195 178.33 250.71 248 BB BB 210 252 219.33 193 234.33 249 bb bb 198 215 209.33 198.33 176.28 250 bb bb 226 295 249.67 244 210.12 251 BB BB 210 206 189 181 217.56 252 Bb Bb 200 210 202.67 189.67 222.22 253 BB BB 190 207 191 178.33 198.21 254 Bb Bb 213 233 205.67 207 196.42 255 bb bb 237 233 295.33 188.33 226.59 256 Bb Bb 219 260 219.67 201 212.80 257 Bb Bb 183 198 191 185.67 259.44 258 Bb Bb 227 220 212.67 209.33 176.77 259 BB BB 214 294 259 234 166.85 260 Bb Bb 204 234 206.33 204.5 215.97 261 Bb Bb 215 224 213 212 203.77 262 BB BB 246 264 274 225.33 203.96 263 - - 259 264 259.67 215 208.13 264 BB BB 230 252 232.67 216 250.21 265 BB BB 228 255 232 225.67 240.09 266 BB BB 248 232 251.67 243.33 235.32 267 BB BB 270 266 265 236.33 199.50 268 BB BB 183 203 194.33 197 206.84 269 Bb Bb 286 273 231.33 237 218.06 270 bb bb 250 273 240.33 230.67 211.11 271 BB BB 233 266 222 206.33 206.44 272 BB BB 268 273 236.33 234.33 236.32 273 Bb Bb NA 287 262 247.67 253.44 274 Bb Bb 268 251 239.67 244.67 246.44 275 Bb Bb 260 251 257 230.33 202.57 276 Bb Bb 230 228 218.33 203.33 202.08 277 bb bb 251 262 249.33 264 192.35 278 bb bb 276 251 245 237.67 182.03 279 bb bb 250 260 260 246 175.38 280 bb bb 234 290 254.33 272 225.10 281 - - 256 251 233.67 231 220.14 282 Bb Bb 238 273 224.67 222.67 202.48 283 bb bb 248 287 288 269.67 180.64 284 bb bb 246 251 230.33 242.33 194.04 285 Bb Bb 240 251 208 217 212.50 286 Bb Bb 200 307 234.33 218.33 203.37 287 - - 190 320 200.33 216.67 198.90 288 - - 236 275 239 229.67 206.64 289 Bb Bb 248 275 238 248.67 239.30 290 Bb Bb 238 258 229.67 217.33 181.73 291 bb bb 212 242 229.67 227.67 201.58 292 BB BB 282 264 233.67 220.33 186.50 293 BB BB 194 229 204.67 223 206.94 294 BB BB 170 215 195.33 172.33 198.41 295 BB BB 162 229 195.33 166 219.45 296 BB BB 166 210 178.67 166 251.40 297 BB BB 165 201 200 173.67 227.29 298 BB BB 170 213 194 171.67 192.85 299 Bb Bb 230 284 245 238 199.10 300 Bb Bb 220 270 256.67 242.5 245.94 301 Bb Bb 244 265 262 247 200.19 302 bb bb 223 265 258 222.67 215.58 303 BB BB 213 234 195.33 194.33 282.27 304 BB BB 267 218 188.33 192 235.52 305 BB BB 179 207 182 181.33 269.66 306 BB BB 203 219 192.33 185.33 217.86 307 BB BB 216 218 190 180.67 228.48 308 BB BB 213 219 168 177 250.31 309 BB BB 191 186 173.33 172.67 217.96 310 BB BB 185 186 180.67 162.67 217.66 311 BB BB 190 214 187.33 167.67 195.73 312 BB BB 190 200 179.33 152 160.40 313 BB BB 166 176 176.33 154.67 247.53 315 BB BB 218 234 217.67 214.67 251.40 316 BB BB 214 246 214.33 213.67 223.32 317 BB BB 225 248 217.67 207.67 217.86 318 BB BB 220 300 233.67 216.67 227.49 319 BB BB 197 245 221.67 190.67 212.70 320 BB BB 238 252 209 198.67 265.69 321 BB BB 217 236 180 182 205.45 322 BB BB 216 233 201.33 167.33 233.44 323 BB BB 170 195 181 171.67 196.72 324 BB BB 161 175 170 179.67 236.22 325 BB BB 194 204 190.33 190.67 254.88 326 BB BB 186 211 186 172.67 226.00 327 BB BB 203 194 197 169.33 207.94 328 BB BB 214 234 211.67 186 194.24 329 BB BB 205 235 211 192.33 247.83 330 BB BB 200 221 197.33 182.67 233.24 331 BB BB 224 239 200 193.33 207.24 332 BB BB 192 209 196.67 180.33 193.84 333 BB BB 173 220 188.67 190.67 218.75 334 BB BB 172 230 191.33 190.67 222.82 335 BB BB 206 270 210.67 219.67 211.61 336 BB BB 205 285 212 214.33 247.83 337 BB BB 220 298 206.67 217 219.15 338 BB BB 218 290 213.33 210.33 203.77 339 BB BB 219 270 188.67 206.33 203.57 340 BB BB 190 206 157.33 165 204.26 341 BB BB 186 214 172.67 173.67 224.71 342 BB BB 188 233 183.33 178.67 191.26 343 BB BB 187 237 185.67 189.67 220.29 344 BB BB 175 206 170 168.33 220.24 345 BB BB NA 207 192.67 187.33 212.70 346 BB BB 208 228 198.67 186.33 202.18 347 BB BB 193 218 201 193.33 212.60 348 BB BB 200 347 198.67 201.67 232.95 349 BB BB 172 241 203 192.33 208.93 350 BB BB 176 235 180.33 169 236.91 351 BB BB 210 265 201.33 204.67 222.42 352 BB BB 228 260 211.67 220.67 191.26 353 BB BB 214 242 201.33 205.33 231.25 354 BB BB 222 231 203 208 264.60 355 BB BB 213 252 198.33 214 199.20 356 BB BB 200 237 179 182 244.75 357 BB BB 174 210 185 188.67 225.60 358 BB BB 182 228 200 199.67 241.28 359 BB BB 183 210 178 189.67 207.44 360 BB BB 200 246 202.67 201 224.21 361 BB BB 213 257 203.33 218.67 178.56 362 BB BB 194 NA NA NA 242.87 363 BB BB 214 241 201.67 190 251.70 364 BB BB 206 242 197 211 206.74 365 BB BB 134 295 246.33 248 202.48 366 BB BB 139 296 255 242.33 241.87 367 BB BB 135 188 168 155.67 NA 368 BB BB 146 154 158 144.67 226.49 369 BB BB 157 162 161 155.33 233.74 370 BB BB 213 243 224.33 234.67 233.44 371 BB BB 204 230 199.33 214 251.60 372 BB BB 205 225 222.67 220.33 221.53 373 BB BB 188 212 205.33 185 239.89 374 BB BB 198 224 212 194.33 226.09 375 BB BB 156 223 196.67 183.33 248.33 376 BB BB 185 246 199.67 186.67 252.79 377 BB BB 208 217 206 194 235.72 378 BB BB 228 269 234.67 220 207.44 379 BB BB 218 288 234.33 236 182.83 380 BB BB 230 348 234 228.33 202.97 381 BB BB 240 265 234.33 225 155.63 382 BB BB 200 267 224 210.67 224.91 383 - - 222 243 236 229.33 211.21 384 - - 198 248 212 217.33 205.95 385 BB BB 168 204 200.33 183.67 187.49 386 BB BB 190 221 194.33 195 206.25 387 BB BB 192 222 193.33 197.33 214.48 388 BB BB 184 223 198.67 186.33 231.26 389 BB BB 186 249 197.33 204 222.92 390 BB BB 189 345 208 199 236.22 391 BB BB 193 220 208.33 198.67 254.18 392 BB BB 201 248 201 194.33 197.71 393 BB BB 200 225 186.33 200 206.75 394 bb bb 230 243 235.33 223.67 249.91 395 bb bb 241 251 238.67 222 213.89 396 bb bb 232 253 232.33 215 283.46 397 bb bb 217 257 235.33 219 240.68 398 bb bb 248 258 241.67 210 242.87 399 Bb Bb 255 237 240.33 199.67 252.00 400 BB BB 205 197 174.33 178.33 211.31 401 bb bb 207 210 216.67 189.67 218.95 402 bb bb 207 213 218 183.67 254.68 403 Bb Bb 245 274 238 238.33 212.10 404 Bb Bb 210 205 197.33 218 264.11 405 bb bb 226 255 229 217.33 206.15 406 BB BB 213 215 199.33 201 232.94 407 bb bb 207 215 200.33 198.67 199.70 408 bb bb 215 200 202.67 197 207.64 409 BB BB 217 226 221.33 205.33 219.05 411 BB BB 220 209 212.67 197.67 220.84 412 BB BB 128 212 129.33 99.33 285.24 413 bb bb 223 238 221 194.67 214.39 414 Bb Bb 222 223 212 193.67 202.88 415 bb bb 230 275 140 212.33 200.09 416 BB BB 201 245 210.67 198.33 234.53 417 Bb Bb 190 202 191 192 251.11 418 BB BB 208 216 198.67 187.67 234.13 419 BB BB 209 220 199.33 190.33 232.64 420 BB BB 205 322 294.67 259.33 260.63 421 Bb Bb 180 222 194 188 203.57 422 Bb Bb 175 215 196.33 199.33 215.97 423 BB BB 201 237 215 220.67 209.12 424 BB BB 220 248 192.33 195 182.63 425 bb bb 209 252 202.33 203.5 213.59 426 Bb Bb 190 233 206 199 222.42 427 Bb Bb 222 244 194.67 219 241.48 428 BB BB 225 253 213 228.67 219.85 429 bb bb 183 220 184.67 192.33 204.26 430 BB BB 177 238 214 172 233.34 431 bb bb 187 235 207.67 189.33 208.83 432 BB BB 207 238 221.67 207 198.61 433 bb bb 202 234 204 181.67 210.22 434 Bb Bb 177 217 192 181 242.17 435 BB BB 238 310 225 236.67 206.74 436 Bb Bb 197 247 210.33 207.67 198.61 437 bb bb 220 275 244 210 230.56 438 BB BB 177 206 203 173 246.94 439 bb bb 218 262 234.33 198.33 217.66 440 BB BB 197 252 238.67 215 285.15 441 bb bb 228 305 252 249.67 209.23 442 BB BB 233 291 253 213.33 248.52 443 BB BB 223 280 253.67 206.33 222.22 444 bb bb 210 266 251 214.33 269.76 445 BB BB 214 265 216 194.67 225.80 446 bb bb 245 265 256.67 239.67 197.02 447 Bb Bb 208 229 214 171.67 211.41 448 bb bb 267 328 284 258 249.02 449 Bb Bb 164 194 155.33 168.33 262.42 450 BB BB 211 255 220 224.33 224.21 451 BB BB 203 221 209.33 182 245.94 452 bb bb 247 330 293 243 259.54 453 bb bb 226 295 252 217.33 239.00 454 bb bb 240 227 263 219 244.30 455 bb bb 221 264 236 230.33 212.70 456 BB BB 252 308 264 251.67 194.93 457 bb bb 166 207 202.33 194.67 NA 458 Bb Bb 220 241 232.33 212 193.54 459 BB BB 203 245 202.33 206 188.68 460 bb bb 180 283 247.67 228 241.38 461 bb bb 247 228 223 227.67 237.11 462 BB BB 201 238 216.67 194.33 275.72 463 Bb Bb 156 186 166.33 157.67 269.37 464 BB BB 190 185 203.67 186.67 237.11 465 ​ ​ 223 251 233.67 218.33 222.72 According to Table 1 above, ​ and ​ It can be seen that when the fluorescence signal of the amplification product is orange-red, the maize plant height trait is identified as tall, and the corresponding genotype is homozygous bb; when the fluorescence signal of the amplification product is green, the maize plant height trait is identified as tall, and the corresponding genotype is heterozygous Bb; when the fluorescence signal of the amplification product is blue, the maize plant height trait is identified as short, and the corresponding genotype is homozygous BB. The KASP experimental results in Example 5 are consistent with the actual plant height trait of the tested samples, and the KASP detection results have a 100% consistency with the trait. The KASP detection results also have a 100% consistency with the sequencing results. This indicates that using this molecular marker to perform KASP experiments on the tested materials can effectively detect their genotypes, thereby completing the identification of germplasm.

[0056] This implementation method, through two years of field trials and laboratory testing in four locations, verified the close association between the Indel locus at 144727660 on maize chromosome 10 and plant height trait. The KASP molecular marker primer set designed based on this locus exhibits high specificity and stability. The PCR amplification reaction system, reaction procedure, and genotyping model of this marker are highly standardized, enabling rapid and accurate identification of maize plant height traits. The KASP detection results show 100% concordance with the plant height phenotype. The marker effect verification algorithm and genetic gain estimation formula can effectively evaluate the application value of the marker, significantly improving the breeding efficiency of dwarf maize germplasm and providing a reliable technical tool and complete application process for marker-assisted breeding of maize.

[0057] This invention utilizes a specific Kasp marker, PH-03-Kasp-106, for maize plant height detection, demonstrating significant benefits in various aspects, including maize breeding. The specific benefits are as follows: The markers in this invention exhibit a strong correlation with traits, and the detection system is precise and stable. The Indel locus is located at 144727660 on chromosome 10 of maize. Systematic validation over two years across four locations using 465 maize inbred lines showed clear polymorphism and a close linkage to plant height, with a marker effect value E≤-28, significantly superior to conventional molecular markers. The KASP primer set designed based on this locus, optimized with a concentration of 6–8 μmol / L and a volume ratio of 2:2:5, demonstrated outstanding PCR amplification specificity, primer dimer content ≤0.8%, and biallelic amplification efficiency difference ≤3%, effectively avoiding non-specific amplification interference. The detection process eliminates the need for gel electrophoresis, directly genotyping based on fluorescence signals. Combined with a standardized judgment model, the genotyping results showed 100% agreement with Sanger sequencing and actual plant height traits, with a fluorescence signal-to-noise ratio ≥3.5, homozygous cluster dispersion ≤0.15, and heterozygous cluster center deviation ≤0.2, ensuring the reliability and consistency of the detection results.

[0058] This invention clarifies the precise ratio of the PCR reaction system, the three-stage gradient annealing reaction procedure, and the quantified plant height determination criteria. All parameters have been optimized and finalized through multiple experiments. Different laboratories can obtain consistent results by following the protocol, solving the problems of poor repeatability and ambiguous parameters in traditional molecular marker detection, thus facilitating large-scale promotion. In breeding practice, this marker can achieve early screening of maize seedling height traits without waiting for maturity. Combined with marker effect verification algorithms and genetic gain estimation formulas, it can accurately assess selection efficiency, increasing the efficiency of dwarf maize germplasm breeding by more than 40% and significantly shortening the breeding cycle. This technology aligns with the industrial demand for increased maize yield and quality in my country, providing an efficient and reliable technical tool for breeding new dwarf, lodging-resistant, and densely planted maize varieties, and has significant practical implications for ensuring national food security.

[0059] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely preferred examples and are not intended to limit the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention.

Claims

1. A Kasp marker PH2-10-Kasp-147 closely linked to maize plant height, characterized in that, The kit includes an Indel site that is closely linked to and identifies maize plant height, a set of Kasp molecular marker primers for identifying the Indel site, and a kit for detecting maize plant height. The Indel locus used to identify maize plant height is located on chromosome 10, 144727660, with a polymorphism of GCTGCTCATGBB / -. When the genotype is GCTGCTCATGAA:GCTGCTCATGAA, maize exhibits the dwarf trait; when the genotype is -:- or GCTGCTCATGAA:-, maize exhibits the tall trait.

2. The Kasp marker PH2-10-Kasp-147, which is closely linked to maize plant height according to claim 1, is characterized in that... The Kasp molecular marker primer set includes forward primer 1, forward primer 2, and reverse primer; The sequence of the forward primer 1 is GAAGGTGACCAAGTTCATGCTCGGCAACACCAGCAGCT; The sequence of the forward primer 2 is GAAGGTCGGAGTCAACGGATTCGGCAACACCAGCAGCA; The sequence of the reverse primer is CCCGACTGCCCACTGACG; The association between the Kasp genotyping results of the primer set and the maize plant height trait conforms to the following judgment model: ； Where H represents the result of determining the maize plant height trait, and F... FAM The readings for the FAM fluorescent tag sequence at excitation wavelengths of 485 nm and emission wavelengths of 520 nm are given. HEX F represents the readings of the HEX fluorescent tag sequence at excitation wavelengths of 528 nm and emission wavelengths of 560 nm. ROX This is the reading for the reference dye.

3. The Kasp marker PH2-10-Kasp-147, which is closely linked to maize plant height according to claim 2, is characterized in that... The concentrations of forward primer 1 and forward primer 2 are independently 4–10 μmol / L, and the concentration of the reverse primer is 4–10 μmol / L. These concentration ranges are determined based on validation using maize inbred lines. When the concentration is below 4 μmol / L, the PCR amplification signal intensity is insufficient, leading to ambiguous genotype clustering. When the concentration is above 10 μmol / L, non-specific amplification occurs, causing the genotyping accuracy to drop below 90%. A concentration of 6–8 μmol / L is selected, within which the fluorescence signal-to-noise ratio of Kasp genotyping is ≥3.5, the cluster dispersion of homozygous genotypes is ≤0.15, the cluster center deviation of heterozygous genotypes is ≤0.2, and the consistency with the maize plant height phenotype remains 100%.

4. The Kasp marker PH2-10-Kasp-147, which is closely linked to maize plant height according to claim 3, is characterized in that... The volume ratio of the forward primer 1, forward primer 2 and reverse primer is 2:2:

5.

5. The Kasp marker PH2-10-Kasp-147 closely linked to maize plant height according to any one of claims 4, characterized in that, The kit includes the Kasp molecular marker primer set, as well as 2×ProbeMixA solution and ddH2O; the PCR amplification reaction system of the kit, per 10 μL, consists of: 2 μL maize genomic DNA, 0.14 μL primer set, 5 μL 2×ProbeMixA solution, and 2.86 μL ddH2O; the concentration of the maize genomic DNA is 50–100 ng / μL.

6. The Kasp marker PH2-10-Kasp-147, which is closely linked to maize plant height according to claim 1, is characterized in that... The PCR amplification reaction program is as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 s, annealing at 61℃ for 40 s, for a total of 10 cycles; denaturation at 95℃ for 20 s, annealing at 55℃ for 40 s, for a total of 31 cycles; hold at 25℃ for 10 min; store at 4℃.

7. An application of the Kasp marker PH2-10-Kasp-147, which is closely linked to maize plant height as described in any one of claims 1-6, including its application in maize breeding and in screening for dwarf maize; When applied in maize breeding, the following marker effect verification algorithm was used to verify the association between Indel loci and maize plant height: ； in, E represents the plant height effect value at the Indel site, H BBi Let be the plant height value of the i-th homozygous BB genotype maize material. The mean plant height is the homozygous bb genotype maize material, n is the number of homozygous BB genotype maize materials, and CV is the coefficient of variation of plant height data for all tested maize materials; when E≤-25, the Indel locus is considered to be significantly associated with the dwarf trait.

8. The application of the Kasp marker PH2-10-Kasp-147, which is closely linked to maize plant height, as described in claim 7, is characterized in that... When applying the above method to screen dwarf corn, the following steps are included: (1) Extract genomic DNA from the maize materials to be screened; (2) The genomic DNA was amplified by PCR using the Kasp molecular marker primer set described in claim 2 to obtain the amplification product; (3) Perform Kasp genotyping on the amplified products and determine the plant height trait of maize materials according to the determination model described in claim 2; (4) Screening results for short-stalked corn materials to complete the screening of short-stalked corn.

9. The application of the Kasp marker PH2-10-Kasp-147, which is closely linked to maize plant height, as described in claim 1, is characterized in that... When applied in maize breeding, the following genetic gain estimation formula is used to assess selection efficiency during the breeding process: ； Where G is the genetic gain, h 2 Let σ represent the broad-sense heritability of maize plant height, i represent the selection intensity, and σ represent the heritability of the maize plant height trait. p The phenotypic standard deviation of maize plant height is given; the broad-sense heritability of the maize plant height trait is calculated using the following formula: ； Among them, V G V represents the genetic variance. E This represents environmental variance.

10. The application of the Kasp marker PH2-10-Kasp-147, which is closely linked to maize plant height, according to claim 1, is characterized in that... When applied to the screening of dwarf maize, the degree of agreement between the Kasp genotyping results and the maize plant height trait is verified by the following formula: ； Where C represents the degree of fit, and N... 一致 N represents the number of maize materials whose Kasp genotyping results are consistent with the actual plant height trait. 总 The total number of maize materials tested; when C≥98%, the primer set is determined to be suitable for screening dwarf maize.

Images