Application of KCNJ2 inhibitor in preparation of medicine for preventing and / or treating asthma

By reducing the expression and activity of KCNJ2 in airway epithelial cells through KCNJ2 inhibitors, this approach addresses the problem that existing asthma treatments cannot effectively target airway epithelial cell inflammation and remodeling, achieving multidimensional improvements in asthma, including alleviating airway inflammation, inhibiting airway remodeling and excessive mucus secretion, and providing a new strategy for the prevention and treatment of asthma.

CN122031691APending Publication Date: 2026-05-15GUANGZHOU NAT LAB
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
GUANGZHOU NAT LAB
Filing Date
2026-02-12
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

Current asthma treatments are unable to effectively target the inflammation and remodeling mechanisms originating from airway epithelial cells, resulting in some patients having irreversible remodeling characteristics such as airway mucus plug formation and airway wall thickening. There is a lack of precise intervention strategies targeting KCNJ2, which fails to fully utilize its potential role in regulating Ca2+ influx and K+ efflux to block the NLRP3 pathway.

Method used

We provide KCNJ2 inhibitors, which reduce the expression and activity of KCNJ2 in airway epithelial cells, inhibit NLRP3 activation, reduce intracellular Ca2+ levels and increase K+ levels in airway epithelial cells, reduce the expression of MUC5AC positive goblet cells and alarm cells, block the early initiation of Th2 inflammation, and achieve comprehensive improvement in asthma.

Benefits of technology

It significantly alleviates airway inflammation and Th2 immune response, inhibits airway remodeling and excessive mucus secretion, and blocks the early initiation of Th2 inflammation, providing a novel and effective asthma prevention and treatment strategy with comprehensive efficacy and potential safety advantages.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of a KCNJ2 inhibitor in preparation of a medicine for preventing and / or treating asthma. It is found for the first time that by reducing the expression quantity, content and / or activity of KCNJ2, multi-dimensional improvement on asthma airway inflammation, remodeling and the like can be achieved, and then asthma is prevented and treated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of KCNJ2 inhibitors in the preparation of drugs for the prevention and / or treatment of asthma. Background Technology

[0002] Asthma is a common chronic inflammatory airway disease. Its main pathological features include airway hyperresponsiveness, Th2 immune response, airway inflammatory cell infiltration, goblet cell metaplasia, and / or excessive mucus production, leading to airway remodeling and a decline in patients' quality of life.

[0003] In current technologies, asthma treatment mainly relies on inhaled corticosteroids, long-acting β2 receptor agonists, long-acting muscarinic receptor antagonists, and biologics (such as monoclonal antibodies against IL-4 / IL-13 or IL-5). These methods can control symptoms and acute exacerbations to some extent, but their effectiveness in intervening in asthma accompanied by goblet cell metaplasia and excessive mucus secretion is limited.

[0004] Studies have shown that NLRP3 inflammasome activation (NLRP3 activation) is involved in the airway inflammation process in asthma, and its inhibition can alleviate inflammation and Th2 cytokine production in animal models. However, existing research mainly focuses on the downstream effects or global inhibition of NLRP3, lacking in-depth exploration of the specific upstream regulatory mechanisms of airway epithelial cells, especially the role of potassium channels. Certain members of the potassium channel family (such as KCNK6 and KCNK13) have been reported in macrophages to promote K... + Efferent flow triggers NLRP3 activation, but the function of the inward rectifying potassium channel KCNJ2 in airway epithelial cells, particularly in regulating NLRP3 activation, Th2 inflammation initiation (alarm release), and goblet cell differentiation (SPDEF-MUC5AC axis), remains unclear.

[0005] Current asthma treatments are ineffective in addressing the inflammation and remodeling mechanisms originating from airway epithelial cells, leading to irreversible remodeling features such as airway mucus plug formation and airway wall thickening in some patients. Furthermore, the lack of precise intervention strategies targeting KCNJ2 prevents the full utilization of its role in calcium channel blockade. 2+ Inflow and K + The potential role of efflux regulation in blocking the NLRP3 pathway could lead to comprehensive improvement in asthma. Summary of the Invention

[0006] The first aspect of the present invention is to provide the application of KCNJ2 inhibitors.

[0007] A second aspect of the present invention is to provide a composition.

[0008] The third aspect of this invention is to provide a product.

[0009] The fourth aspect of this invention aims to provide a method for aggravating the asthma phenotype in an animal model of asthma.

[0010] The fifth aspect of this invention aims to provide a method.

[0011] The sixth aspect of this invention aims to provide an application of the animal model obtained by the method of the fourth aspect of this invention.

[0012] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect of the invention provides the use of the KCNJ2 inhibitor in any one of a1)-a8): a1) Prepare medicines for the prevention and / or treatment of asthma; a2) In vitro inhibition of NLRP3 activation in airway epithelial cells; a3) In vitro reduction of intracellular calcium in airway epithelial cells 2+ Levels and / or increases in intracellular K+ in airway epithelial cells + level; a4) Reduce the level of MUC5AC-positive goblet cells in airway organoids; a5) Reduce the expression levels of MUC5AC and / or SPDEF in airway organoids; a6) Reduce alarm hormone expression levels in airway organoids; a7) Inhibits NLRP3 activation in airway organoids; a8) Prepare a product, said product being used in at least one of a2)-a7).

[0013] In this invention, the airway epithelial cells include bronchial epithelial cells.

[0014] In this invention, the airway organoids include bronchial organoids.

[0015] In this invention, inhibiting NLRP3 activation in airway epithelial cells or inhibiting NLRP3 activation in airway organoids includes reducing the expression levels of NLRP3, pro-caspase-1, and / or activated caspase-1.

[0016] In this invention, the alarm elements include IL-33, TSLP, and / or CCL2.

[0017] In this invention, the airway organoids are obtained by culturing airway epithelial cells through an air-liquid interface.

[0018] In this invention, the airway organoids are delivered via PneumaCult. TMIt was obtained by culturing in ALI medium.

[0019] In this invention, the airway epithelial cells are derived from asthma patients, or the airway epithelial cells are derived from healthy animals and the airway epithelial cells are treated with house dust mites or IL-13.

[0020] In this invention, the airway epithelial cells are selected from primary pHBE cells from asthma patients, 16HBE cells treated with house dust mites, or primary pHBE cells from healthy animals treated with IL-13.

[0021] In this invention, the airway epithelial cells are derived from animals.

[0022] In this invention, the animal is a mammal; further selected from humans, non-human primates (e.g., orangutans, apes), rodents (e.g., rats, mice, guinea pigs), pets (e.g., cats, dogs), livestock (e.g., horses, cattle, sheep, pigs, rabbits); and further selected from humans.

[0023] In some embodiments, the product is a reagent.

[0024] In this invention, the drug prevents and / or treats asthma by improving airway inflammation and remodeling.

[0025] In this invention, the drug prevents and / or treats asthma by at least one of b1)-b3): b1) relieving airway inflammation and / or Th2 immune response; b2) inhibiting airway remodeling and / or excessive mucus secretion; b3) blocking the early initiation of Th2 inflammation.

[0026] In this invention, the drug prevents and / or treats asthma by at least one of c1)-c9): c1) reducing airway hyperresponsiveness; c2) reducing inflammation score and cell infiltration; c3) reducing airway wall thickness; c4) reducing serum IgE and / or IgG1 protein levels; c5) reducing Th2 cytokine expression levels; c6) reducing alarm hormone expression levels; c7) reducing the number of PAS-positive goblet cells and / or MUC5AC-positive goblet cells; c8) reducing Muc5ac and / or Spdef expression levels; c9) inhibiting NLRP3 activation.

[0027] In this invention, the Th2 cytokines include IL-4, IL-5 and / or IL-13.

[0028] In this invention, the inhibition of NLRP3 activation includes: reducing the expression levels of NLRP3, pro-caspase-1, precursor IL-1β, mature IL-1β, and / or activated caspase-1.

[0029] In this invention, the KCNJ2 inhibitor includes at least one of the following: a substance that inhibits KCNJ2 activity, a substance that degrades KCNJ2, and a substance that reduces the expression level of KCNJ2; further includes at least one of the following: a substance that inhibits KCNJ2 activity and a substance that reduces the expression level of KCNJ2; and even further includes a substance that inhibits KCNJ2 activity.

[0030] In this invention, the substance that reduces KCNJ2 expression levels includes at least one of (a1)-(a3): (a1) siRNA, esiRNA, dsRNA, microRNA, antisense oligonucleotide, ribozyme, sgRNA or shRNA targeting KCNJ2; (a2) Nucleic acid molecules that express (a1); (a3) An expression cassette, vector, cell or microorganism that contains (a2).

[0031] In this invention, the substance that reduces KCNJ2 expression levels includes sgRNA that targets KCNJ2.

[0032] In this invention, the sgRNA targeting KCNJ2 includes sgRNA1 and / or sgRNA2, wherein sgRNA1 includes the nucleotide sequence shown in SEQ ID NO:1 and sgRNA2 includes the nucleotide sequence shown in SEQ ID NO:2.

[0033] In this invention, the substance that inhibits KCNJ2 activity includes at least one of (b1)-(b3): (b1) Antibodies that specifically bind to KCNJ2; (b2) A ligand protein or polypeptide that specifically binds to KCNJ2; (b3) Non-protein compounds that specifically bind to KCNJ2.

[0034] In this invention, the antibody includes at least one of polyclonal antibody, monoclonal antibody, single-chain antibody, functional antibody fragment, antibody Fab region, nanobody, chimeric antibody, and multispecific antibody.

[0035] In this invention, the substance that inhibits KCNJ2 activity includes ML133 or a pharmaceutically acceptable salt thereof; more specifically, ML133 HCl.

[0036] In this invention, the KCNJ2 is derived from animals.

[0037] In this invention, the login number of KCNJ2 is NM_000891.3.

[0038] In some embodiments, the drug also includes other active ingredients.

[0039] In some embodiments, the product also includes other active ingredients.

[0040] In this invention, the other active ingredients include Ca. 2+ At least one of a chelating agent and an NLRP3 inhibitor; further comprising Ca 2+ Chelating agents or NLRP3 inhibitors; further including NLRP3 inhibitors.

[0041] In this invention, the Ca 2+ Chelating agents include BAPTA-AM or its pharmaceutically acceptable salts.

[0042] In this invention, the NLRP3 inhibitor includes at least one of the following: a substance that inhibits NLRP3 activity, a substance that degrades NLRP3, and a substance that reduces NLRP3 expression levels; further includes at least one of the following: a substance that inhibits NLRP3 activity and a substance that reduces NLRP3 expression levels; and even further includes a substance that inhibits NLRP3 activity.

[0043] In this invention, the substance that reduces NLRP3 expression levels includes at least one of (c1)-(c3): (c1) siRNA, esiRNA, dsRNA, microRNA, antisense oligonucleotide, ribozyme, sgRNA or shRNA targeting NLRP3; (c2) expresses the nucleic acid molecule of (c1); (c3) contains an expression cassette, vector, cell, or microorganism of (c2).

[0044] In this invention, the substance that inhibits NLRP3 activity includes at least one of (d1)-(d3): (d1) Antibody that specifically binds to NLRP3; (d2) A ligand protein or polypeptide that specifically binds to NLRP3; (d3) Non-protein compounds that specifically bind to NLRP3.

[0045] In this invention, the substance that inhibits NLRP3 activity includes MCC950 or a pharmaceutically acceptable salt thereof.

[0046] In this invention, the NLRP3 is derived from animals.

[0047] In this invention, the NLRP3 accession number is NM_001243133.2.

[0048] In some embodiments, the molar ratio of the KCNJ2 inhibitor to other active ingredients in the drug or product is (0.5-4):1; more specifically (2.5-3.5):1.

[0049] In some embodiments, the drug also includes pharmaceutically acceptable excipients.

[0050] In some embodiments, the pharmaceutically acceptable excipients include at least one of diluents, excipients, binders, humectants, surfactants, lubricants, and disintegrants.

[0051] In some embodiments, the drug is in a dosage form suitable for children or for adults.

[0052] In some embodiments, the dosage form is selected from gastrointestinal or non-gastrointestinal dosage forms.

[0053] In some embodiments, the gastrointestinal dosage form includes at least one of powder, tablet, granule, capsule, sustained-release, solution, dry suspension, effervescent tablet, emulsion, suspension, syrup, drops, and chewable tablet.

[0054] In some embodiments, the non-gastrointestinal drug delivery dosage forms include at least one of the following: injectable dosage forms (e.g., injections, including various injections such as intravenous injections, intramuscular injections, subcutaneous injections, intradermal injections, and intracavitary injections); respiratory dosage forms (e.g., sprays, aerosols, powder inhalers, etc.); skin dosage forms (e.g., topical solutions, lotions, liniments, ointments, plasters, pastes, patches, etc.); mucosal dosage forms (e.g., eye drops, nasal drops, ophthalmic ointments, mouthwashes, sublingual tablets, adhesive tablets, films, etc.); and cavity dosage forms (e.g., suppositories, aerosols, effervescent tablets, drops, pills, etc., for use in the rectum, vagina, urethra, nasal cavity, ear canal, etc.).

[0055] In some embodiments, the drug is administered to animals.

[0056] In some embodiments, the animal is a mammal; further selected from humans, non-human primates (e.g., orangutans, apes), rodents (e.g., rats, mice, guinea pigs), pets (e.g., cats, dogs), livestock (e.g., horses, cattle, sheep, pigs, rabbits); and even further selected from humans.

[0057] In this invention, the pharmaceutically acceptable salt includes at least one of the following: metal salt, ammonium salt, salt formed with an organic base, salt formed with an inorganic acid, salt formed with an organic acid, salt formed with a basic amino acid, and salt formed with an acidic amino acid.

[0058] In this invention, the metal salt includes at least one of alkali metal salts (e.g., sodium salts, potassium salts, etc.), alkaline earth metal salts (e.g., calcium salts, magnesium salts, barium salts, etc.), and aluminum salts.

[0059] In this invention, the salt formed with an organic base includes salts formed with one or more of the following organic bases: trimethylamine, triethylamine, pyridine, methylpyridine, 2,6-dimethylpyridine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, and N,N'-dibenzylethylenediamine.

[0060] In this invention, the salt formed with the inorganic acid includes salts formed with one or more of the following inorganic acids: hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, and phosphoric acid.

[0061] In this invention, the salt formed with organic acids includes salts formed with one or more of the following organic acids: formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, and p-toluenesulfonic acid.

[0062] In this invention, the salt formed with basic amino acids includes salts formed with one or more of the following basic amino acids: arginine, lysine, and ornithine.

[0063] In this invention, the salt formed with acidic amino acids includes salts formed with one or more of the following acidic amino acids: aspartic acid and glutamic acid.

[0064] A second aspect of the invention provides a composition comprising: a KCNJ2 inhibitor; and Other active ingredients, including Ca 2+ At least one of a chelating agent and an NLRP3 inhibitor; further comprising Ca 2+ Chelating agents or NLRP3 inhibitors; further including NLRP3 inhibitors.

[0065] In some embodiments, the molar ratio of the KCNJ2 inhibitor to other active ingredients is (0.5-4):1; more specifically (2.5-3.5):1.

[0066] A third aspect of the invention provides a product comprising the composition of the second aspect of the invention.

[0067] In some embodiments, the product is a drug or reagent.

[0068] In some embodiments, the product is used for any one of a1)-a7): a1) Prevention and / or treatment of asthma; a2) In vitro inhibition of NLRP3 activation in airway epithelial cells; a3) In vitro reduction of intracellular calcium in airway epithelial cells 2+ Levels and / or increases in intracellular K+ in airway epithelial cells + level; a4) Reduce the level of MUC5AC-positive goblet cells in airway organoids; a5) Reduce the expression levels of MUC5AC and / or SPDEF in airway organoids; a6) Reduce alarm hormone expression levels in airway organoids; a7) Inhibits NLRP3 activation in airway organoids.

[0069] In some embodiments, the product is a drug, and the drug further includes pharmaceutically acceptable excipients.

[0070] In some embodiments, the pharmaceutically acceptable excipients include at least one of diluents, excipients, binders, humectants, surfactants, lubricants, and disintegrants.

[0071] In some embodiments, the drug is in a dosage form suitable for children or for adults.

[0072] In some embodiments, the dosage form is selected from gastrointestinal or non-gastrointestinal dosage forms.

[0073] In some embodiments, the gastrointestinal dosage form includes at least one of powder, tablet, granule, capsule, sustained-release, solution, dry suspension, effervescent tablet, emulsion, suspension, syrup, drops, and chewable tablet.

[0074] In some embodiments, the non-gastrointestinal drug delivery dosage forms include at least one of the following: injectable dosage forms (e.g., injections, including various injections such as intravenous injections, intramuscular injections, subcutaneous injections, intradermal injections, and intracavitary injections); respiratory dosage forms (e.g., sprays, aerosols, powder inhalers, etc.); skin dosage forms (e.g., topical solutions, lotions, liniments, ointments, plasters, pastes, patches, etc.); mucosal dosage forms (e.g., eye drops, nasal drops, ophthalmic ointments, mouthwashes, sublingual tablets, adhesive tablets, films, etc.); and cavity dosage forms (e.g., suppositories, aerosols, effervescent tablets, drops, pills, etc., for use in the rectum, vagina, urethra, nasal cavity, ear canal, etc.).

[0075] In some embodiments, the drug is administered to animals.

[0076] In some embodiments, the animal is a mammal; further selected from humans, non-human primates (e.g., orangutans, apes), rodents (e.g., rats, mice, guinea pigs), pets (e.g., cats, dogs), livestock (e.g., horses, cattle, sheep, pigs, rabbits); and even further selected from humans.

[0077] A fourth aspect of the present invention provides a method for aggravating the asthma phenotype in an animal model of asthma, comprising the following steps: The expression level, content, or activity of KCNJ2 in the animals was increased before, after, or during the construction of an asthma animal model.

[0078] In some embodiments, the method includes the step of increasing the expression level, content, or activity of KCNJ2 in the animal during the construction of an asthma animal model.

[0079] In some embodiments, the construction of the asthma animal model is achieved by inducing an asthma animal model using house dust mites or ovalbumin.

[0080] In some embodiments, the animal is a non-human mammal; further selected from non-human primates (e.g., orangutans, apes), rodents (e.g., rats, mice, guinea pigs), pets (e.g., cats, dogs), livestock (e.g., horses, cattle, sheep, pigs, rabbits); and even further selected from mice.

[0081] In some embodiments, the method for increasing the expression level, content, or activity of KCNJ2 in animals is to introduce the KCNJ2 encoding gene into the animals.

[0082] In some embodiments, the gene encoding KCNJ2 is introduced into the animal via a vector (preferably an AAV6 vector).

[0083] In some embodiments, the asthma phenotype of the aggravated asthma animal model includes at least one of d1)-d8): d1) increased airway hyperresponsiveness; d2) increased inflammation score and cell infiltration; d3) increased airway wall thickness; d4) increased serum IgE and / or IgG1 protein levels; d5) increased Th2 cytokine expression levels; d6) increased alarmist expression levels; d7) increased number of PAS-positive goblet cells and / or MUC5AC-positive goblet cells; d8) increased Muc5ac and / or Spdef expression levels.

[0084] In some implementations, the enhancement described in d1)-d8) is compared to an asthmatic animal model that has not been treated to enhance the expression, content, or activity of KCNJ2.

[0085] In some implementations, the method is used to construct animal models of asthma.

[0086] A fifth aspect of the present invention provides a method for preventing and / or treating asthma, comprising the steps of administering an effective amount of a KCNJ2 inhibitor (preferably administering an effective amount of the drug of the first aspect of the present invention to the subject).

[0087] In some implementations, the subject is an animal.

[0088] In this invention, the asthma includes allergic asthma.

[0089] A method to inhibit NLRP3 activation in airway epithelial cells in vitro or reduce intracellular calcium in airway epithelial cells in vitro 2+ Levels and / or increases in intracellular K+ in airway epithelial cells + The method comprises the following steps: treating the airway epithelial cells with a KCNJ2 inhibitor (preferably the product of the first aspect of the invention).

[0090] In some embodiments, the final concentration of the KCNJ2 inhibitor is 20-40 μM.

[0091] In some embodiments, the final concentration of the other active ingredients is 20-40 μM.

[0092] A method for reducing the level of MUC5AC-positive goblet cells in airway organoids, reducing the expression levels of MUC5AC and / or SPDEF in airway organoids, reducing the expression levels of alarm hormones in airway organoids, or inhibiting NLRP3 activation in airway organoids, comprising the following steps: treating the airway organoids with a KCNJ2 inhibitor (preferably the product of the first aspect of the present invention).

[0093] In some embodiments, the final concentration of the KCNJ2 inhibitor is 20-40 μM.

[0094] In some embodiments, the final concentration of the other active ingredients is 7-13 μM.

[0095] A sixth aspect of the invention provides the use of an animal model obtained by the method of the fourth aspect of the invention in screening drugs or preparing products of screening drugs for the prevention and / or treatment of asthma.

[0096] The beneficial effects of this invention are: This invention is the first to discover that reducing the expression, content, and / or activity of KCNJ2 can achieve multidimensional improvement in airway inflammation and remodeling in asthma, thereby preventing and treating asthma, as detailed below: 1. Significantly alleviates airway inflammation and Th2 immune response: In animal models, reducing the expression, content and / or activity of KCNJ2 can reduce airway hyperresponsiveness, reduce peribronchial and perivascular inflammatory cell infiltration, reduce total cell, eosinophil and lymphocyte counts in bronchoalveolar lavage fluid, reduce serum specific IgE / IgG1 levels and Th2 cytokine (IL-4, IL-5, IL-13) production, thereby effectively controlling allergic inflammatory response.

[0097] 2. Inhibition of airway remodeling and excessive mucus secretion: In animal models, reducing the expression, content and / or activity of KCNJ2 can reduce airway wall thickness, reduce the number of PAS-positive and MUC5AC-positive goblet cells, downregulate the expression of Muc5ac and Spdef, while having no significant effect on MUC5B, thus achieving targeted inhibition of goblet cell metaplasia and excessive mucus production and improving the risk of airway obstruction.

[0098] 3. Blocking the mechanism of inflammation initiation: In animal models, reducing the expression, content and / or activity of KCNJ2 can reduce the expression of airway epithelial cell-derived alarmins (IL-33, Tslp, Ccl2) and block the early initiation of Th2 inflammation; in human cell models, the levels of IL-33, TSLP and CCL2 are also reduced.

[0099] 4. The mechanism is well-defined and relies on the NLRP3 pathway: by simultaneously restricting Ca... 2+ Inflow and K + Efflux, inhibiting NLRP3 inflammasome activation (reducing NLRP3, pro-caspase-1 expression and caspase-1 / IL-1β maturation), this effect can be partially reversed by NLRP3 agonists and enhanced by NLRP3 inhibitors, providing a therapeutic mechanism independent of the traditional hormone pathway, which helps overcome hormone resistance.

[0100] 5. Validation results in human models: In the air-fluid interface culture of primary bronchial epithelial cells from asthma patients and in organoid models, reducing the expression, content and / or activity of KCNJ2 can significantly reduce the proportion of MUC5AC positive goblet cells and mucus production, demonstrating its strong clinical translational potential and high specificity.

[0101] 6. Revealing the potential for synergistic therapy: Both KCNJ2 inhibitor (ML133) and downstream NLRP3 inhibitor (MCC950) are effective in inhibiting goblet cell metaplasia and mucus secretion when used alone, and their combined use produces a significant synergistic enhancement effect, providing direct evidence for the development of asthma combination therapy regimens based on the "KCNJ2-NLRP3-SPDEF-MUC5AC" axis target.

[0102] This invention provides a novel and effective asthma prevention and treatment strategy by precisely intervening in the KCNJ2-NLRP3-SPDEF-MUC5AC axis at the bronchial epithelial cell level. It has comprehensive efficacy, potential safety advantages, and application value. Attached Figure Description

[0103] Figure 1This shows that knocking out the Kcnj2 gene inhibits ovalbumin-induced airway hyperresponsiveness, airway inflammation, and Th2 immune response in asthmatic mice. a) Shows the timeline of the ovalbumin-induced asthmatic mouse model, with sensitization, challenge, and analysis time points marked (IP: intraperitoneal injection): Sensitization phase: 100 μL 5% ovalbumin + 100 μL aluminum adjuvant; Challenge phase: 5% ovalbumin, 30 minutes. b) Shows the airway responsiveness assay results of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6) to escalating doses of nebulized methacholine. c shows representative images of hematoxylin-eosin stained sections of lung tissue from mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6). d shows the quantitative analysis results of lung tissue inflammation scores from mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6). e shows the quantitative analysis results of airway wall thickness from mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6). f shows the total cell count in the BALF of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6). g shows the eosinophil count in the BALF of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6). h shows the lymphocyte count in the BALF of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6). i shows the ovalbumin-specific immunoglobulin E (IgE) levels in the serum of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6).j shows the ovalbumin-specific immunoglobulin G1 (IgG1) level in the serum of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6). k shows the IL-4 protein level in the BALF of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6), as detected by ELISA. l shows the IL-5 protein level in the BALF of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6), as detected by ELISA. m shows the IL-13 protein level in the BALF of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6), as detected by ELISA. n shows the Il-33 gene level in the lung tissue of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6), as detected by RT-qPCR. o shows the Tslp gene level in the lung tissue of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6), as detected by RT-qPCR. p shows the Ccl2 gene levels in the lung tissues of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6), as detected by RT-qPCR. Data are expressed as mean ± standard deviation and were analyzed using two-way ANOVA (b) and one-way ANOVA (dp).

[0104] Figure 2This demonstrates that knocking out the Kcnj2 gene inhibits ovalbumin-induced airway goblet cell metaplasia and excessive mucus secretion in asthmatic mice. a shows representative periodic acid-Schiff (PAS) staining images of lung tissue sections from wild-type-saline (n = 6), wild-type-ovalbumin (n = 6), Kcnj2CKO-saline (n = 6), and Kcnj2CKO-ovalbumin (n = 6) mice. b shows the quantitative analysis results of PAS-positive cells per 100 μm airway in wild-type-saline (n = 6), wild-type-ovalbumin (n = 6), Kcnj2CKO-saline (n = 6), and Kcnj2CKO-ovalbumin (n = 6) mice. c shows the percentage of PAS-positive cells in the airway epithelium of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6). d shows the immunostaining results of MUC5AC (green) and DAPI (blue) in lung tissue sections from mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6). e shows the percentage of MUC5AC-positive goblet cells in the airway epithelium of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6). f shows the quantitative analysis results of MUC5AC-positive goblet cells per 100 μm airway in mice from the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6). g shows the RT-qPCR analysis results of Muc5ac expression in lung tissues of mice from the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6). h shows the Western blot detection results of MUC5AC and ACTB in lung tissues of mice from the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6).i shows the quantitative results of the relative levels of MUC5AC in the lung tissues of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6). j shows the MUC5AC protein levels in the BALF of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6) as detected by ELISA. k shows the RT-qPCR analysis results of Spdef expression in the lung tissues of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6). Data are expressed as mean ± standard deviation and analyzed using one-way ANOVA.

[0105] Figure 3This study demonstrates that knocking out the Kcnj2 gene inhibits ovalbumin-induced NLRP3 inflammasome activation in asthmatic mice. a shows the Western blot results for NLRP3, pro-caspase-1, pro-IL-1β, activated caspase-1, mature IL-1β, and ACTB in the lung tissues of mice from the wild-type-saline group (n = 4), wild-type-ovalbumin group (n = 4), Kcnj2CKO-saline group (n = 4), and Kcnj2CKO-ovalbumin group (n = 4). b shows the quantitative results of the relative levels of NLRP3 in the lung tissues of mice from the wild-type-saline group (n = 4), wild-type-ovalbumin group (n = 4), Kcnj2CKO-saline group (n = 4), and Kcnj2CKO-ovalbumin group (n = 4). c shows the relative quantitative results of precursor caspase-1 in the lung tissue of mice in the wild-type-saline group (n = 4), wild-type-ovalbumin group (n = 4), Kcnj2CKO-saline group (n = 4), and Kcnj2CKO-ovalbumin group (n = 4). d shows the relative quantitative results of precursor IL-1β in the lung tissue of mice in the wild-type-saline group (n = 4), wild-type-ovalbumin group (n = 4), Kcnj2CKO-saline group (n = 4), and Kcnj2CKO-ovalbumin group (n = 4). e shows the relative quantitative results of activated caspase-1 in the lung tissue of mice in the wild-type-saline group (n = 4), wild-type-ovalbumin group (n = 4), Kcnj2CKO-saline group (n = 4), and Kcnj2CKO-ovalbumin group (n = 4). f shows the quantitative results of the relative levels of mature IL-1β in the lung tissues of mice in the wild-type-saline group (n = 4), wild-type-ovalbumin group (n = 4), Kcnj2CKO-saline group (n = 4), and Kcnj2CKO-ovalbumin group (n = 4). g shows the IL-1β protein levels in the serum of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6) as detected by ELISA. h shows representative immunohistochemical images of NLRP3 and caspase-1 in the lung tissues of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6).i shows the quantitative results of the mean optical density of NLRP3 in the lung tissues of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6). j shows the quantitative results of the mean optical density of caspase-1 in the lung tissues of mice in the wild-type-saline group (n = 6), wild-type-ovalbumin group (n = 6), Kcnj2CKO-saline group (n = 6), and Kcnj2CKO-ovalbumin group (n = 6). Data are expressed as mean ± standard deviation and analyzed using one-way ANOVA.

[0106] Figure 4The inhibition of KCNJ2 by ​​ML133 was shown to reduce airway hyperresponsiveness, airway inflammation, and Th2 immune response in house dust mite-induced asthmatic mice. a shows the timeline of the house dust mite-induced asthmatic mouse model, indicating the time points of sensitization (10 μg house dust mite), challenge (10 μg house dust mite), and analysis (in: intranasal). ML133: 40 μL, 25 μM, administered every 3 days starting from day 0. b shows the airway responsiveness assays of mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6) to escalating doses of nebulized methacholine. c shows representative images of hematoxylin-eosin stained sections of lung tissue from mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6). d shows the quantitative analysis results of lung tissue inflammation scores from mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6). e shows the quantitative analysis results of airway wall thickness from mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6). f shows the total cell count in the BALF of mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6). g shows the eosinophil count in the BALF of mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6). h shows the lymphocyte count in the BALF of mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6). i shows the level of house dust mite-specific immunoglobulin E (IgE) in the serum of mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6). j shows the level of house dust mite-specific immunoglobulin G1 (IgG1) in the serum of mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6).k shows the IL-4 protein level in the BALF of mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6), as detected by ELISA. l shows the IL-5 protein level in the BALF of mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6), as detected by ELISA. m shows the IL-13 protein level in the BALF of mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6), as detected by ELISA. n shows the Il-33 gene level detected by RT-qPCR in the lung tissues of mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6). o shows the Tslp gene level detected by RT-qPCR in the lung tissues of mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6). p shows the Ccl2 gene level detected by RT-qPCR in the lung tissues of mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6). Data are expressed as mean ± standard deviation and were analyzed using two-way ANOVA(b) and one-way ANOVA(dp).

[0107] Figure 5The inhibition of KCNJ2 by ​​ML133 was shown to alleviate goblet cell metaplasia and excessive mucus secretion induced by house dust mite in asthmatic mice. a shows representative periodic acid-Schiff (PAS) staining images of lung tissue sections from mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6). b shows the quantitative analysis results of PAS-positive cells per 100 μm airway in mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6). c shows the percentage of PAS-positive cells in the airway epithelium of mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6). d shows the RT-qPCR analysis results of Muc5ac expression in the lung tissue of mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6). e shows the RT-qPCR analysis results of Spdef expression in the lung tissue of mice in the saline-DMSO group (n = 6), saline-ML133 group (n = 6), house dust mite-DMSO group (n = 6), and house dust mite-ML133 group (n = 6). Data are expressed as mean ± standard deviation and analyzed using one-way ANOVA.

[0108] Figure 6This study demonstrates that KCNJ2 overexpression promotes airway hyperresponsiveness, inflammation, Th2 immune response, and alarmist expression in house dust mite-induced asthmatic mice. a shows the timeline of the house dust mite-induced asthmatic mouse model, noting the time points of sensitization (10 μg house dust mite), challenge (10 μg house dust mite), and analysis (in: intranasal; IT: intratracheal). AAV6-empty vector or AAV6-Kcnj2 overexpressing virus: 5 × 10^11 genome copies (GC) per mouse, 50 μL total volume injected per injection on day 5. b shows the airway responsiveness assays of mice in the saline-AAV6-empty vector group (n = 6), saline-AAV6-Kcnj2 group (n = 6), house dust mite-AAV6-empty vector group (n = 6), and house dust mite-AAV6-Kcnj2 group (n = 6) to escalating doses of nebulized methacholine. c shows representative images of hematoxylin-eosin stained sections of mouse lung tissue from the saline-AAV6-empty vector group (n = 6), saline-AAV6-Kcnj2 group (n = 6), house dust mite-AAV6-empty vector group (n = 6), and house dust mite-AAV6-Kcnj2 group (n = 6). d shows the quantitative analysis results of lung tissue inflammation scores from the saline-AAV6-empty vector group (n = 6), saline-AAV6-Kcnj2 group (n = 6), house dust mite-AAV6-empty vector group (n = 6), and house dust mite-AAV6-Kcnj2 group (n = 6). e shows the quantitative analysis results of airway wall thickness in mice in the saline-AAV6-empty vector group (n = 6), saline-AAV6-Kcnj2 group (n = 6), house dust mite-AAV6-empty vector group (n = 6), and house dust mite-AAV6-Kcnj2 group (n = 6). f shows the total cell count in the BALF of mice in the saline-AAV6-empty vector group (n = 6), saline-AAV6-Kcnj2 group (n = 6), house dust mite-AAV6-empty vector group (n = 6), and house dust mite-AAV6-Kcnj2 group (n = 6). g shows the number of eosinophils in the BALF of mice in the saline-AAV6-empty vector group (n = 6), saline-AAV6-Kcnj2 group (n = 6), house dust mite-AAV6-empty vector group (n = 6), and house dust mite-AAV6-Kcnj2 group (n = 6). h shows the number of lymphocytes in the BALF of mice in the saline-AAV6-empty vector group (n = 6), saline-AAV6-Kcnj2 group (n = 6), house dust mite-AAV6-empty vector group (n = 6), and house dust mite-AAV6-Kcnj2 group (n = 6).i shows the level of house dust mite-specific immunoglobulin E (IgE) in the serum of mice in the saline-AAV6-empty vector group (n = 6), saline-AAV6-Kcnj2 group (n = 6), house dust mite-AAV6-empty vector group (n = 6), and house dust mite-AAV6-Kcnj2 group (n = 6). j shows the level of house dust mite-specific immunoglobulin G1 (IgG1) in the serum of mice in the saline-AAV6-empty vector group (n = 6), saline-AAV6-Kcnj2 group (n = 6), house dust mite-AAV6-empty vector group (n = 6), and house dust mite-AAV6-Kcnj2 group (n = 6). k shows the IL-4 protein levels in the BALF of mice in the saline-AAV6-empty vector group (n=6), saline-AAV6-Kcnj2 group (n=6), house dust mite-AAV6-empty vector group (n=6), and house dust mite-AAV6-Kcnj2 group (n=6), as detected by ELISA. l shows the IL-5 protein levels in the BALF of mice in the saline-AAV6-empty vector group (n=6), saline-AAV6-Kcnj2 group (n=6), house dust mite-AAV6-empty vector group (n=6), and house dust mite-AAV6-Kcnj2 group (n=6), as detected by ELISA. m shows the IL-13 protein level in the BALF of mice in the saline-AAV6-empty vector group (n=6), saline-AAV6-Kcnj2 group (n=6), house dust mite-AAV6-empty vector group (n=6), and house dust mite-AAV6-Kcnj2 group (n=6), as detected by ELISA. n shows the Il-33 gene level in the lung tissue of mice in the saline-AAV6-empty vector group (n=6), saline-AAV6-Kcnj2 group (n=6), house dust mite-AAV6-empty vector group (n=6), and house dust mite-AAV6-Kcnj2 group (n=6), as detected by RT-qPCR. o shows the Tslp gene level in the lung tissues of mice in the saline-AAV6-empty vector group (n = 6), saline-AAV6-Kcnj2 group (n = 6), house dust mite-AAV6-empty vector group (n = 6), and house dust mite-AAV6-Kcnj2 group (n = 6), as detected by RT-qPCR. p shows the Ccl2 gene level in the lung tissues of mice in the saline-AAV6-empty vector group (n = 6), saline-AAV6-Kcnj2 group (n = 6), house dust mite-AAV6-empty vector group (n = 6), and house dust mite-AAV6-Kcnj2 group (n = 6), as detected by RT-qPCR. Data are expressed as mean ± standard deviation and were analyzed using two-way ANOVA (b) and one-way ANOVA (dp).

[0109] Figure 7 This study demonstrates that KCNJ2 overexpression promotes goblet cell metaplasia and excessive mucus secretion in house dust mite-induced asthmatic mice. Image a shows representative periodic acid-Schiff (PAS) staining images of lung tissue sections from mice in the saline-AAV6-empty vector group (n = 6), saline-AAV6-Kcnj2 group (n = 6), house dust mite-AAV6-empty vector group (n = 6), and house dust mite-AAV6-Kcnj2 group (n = 6). Image b shows the quantitative analysis results of PAS-positive cells per 100 μm airway in mice from the saline-AAV6-empty vector group (n = 6), saline-AAV6-Kcnj2 group (n = 6), house dust mite-AAV6-empty vector group (n = 6), and house dust mite-AAV6-Kcnj2 group (n = 6). c shows the percentage of PAS-positive cells in the airway epithelium of mice in the saline-AAV6-empty vector group (n = 6), saline-AAV6-Kcnj2 group (n = 6), house dust mite-AAV6-empty vector group (n = 6), and house dust mite-AAV6-Kcnj2 group (n = 6). d shows the RT-qPCR analysis results of Muc5ac expression in the lung tissue of mice in the saline-AAV6-empty vector group (n = 6), saline-AAV6-Kcnj2 group (n = 6), house dust mite-AAV6-empty vector group (n = 6), and house dust mite-AAV6-Kcnj2 group (n = 6). e shows the RT-qPCR analysis results of Spdef expression in mouse lung tissue from the saline-AAV6-empty vector group (n = 6), saline-AAV6-Kcnj2 group (n = 6), house dust mite-AAV6-empty vector group (n = 6), and house dust mite-AAV6-Kcnj2 group (n = 6). Data are expressed as mean ± standard deviation and analyzed using one-way ANOVA.

[0110] Figure 8 Inhibition of KCNJ2 showed that it reduced intracellular calcium levels in bronchial epithelial cells induced by house dust mite exposure. 2+Levels and NLRP3 inflammasome activation. a shows the RT-qPCR analysis results of KCNJ2 in 16HBE cells treated with PBS and house dust mites. b shows the timeline of ML133, house dust mite, and BAPTA-AM administration. c shows Fluo-4 AM imaging of 16HBE cells in the control, house dust mite, and ML133+ house dust mite groups. d shows the quantification of mean Fluo-4 AM fluorescence intensity in 16HBE cells in the control, house dust mite, and ML133+ house dust mite groups. e shows the Western blotting results of NLRP3, pro-caspase-1, activated caspase-1, and ACTB in 16HBE cells in the control, house dust mite, ML133+ house dust mite, and ML133+ house dust mite+BAPTA-AM groups. f shows the quantification of relative NLRP3 levels in 16HBE cells in the control, house dust mite, ML133+ house dust mite, and ML133+ house dust mite+BAPTA-AM groups. g shows the relative quantitative results of pro-caspase-1 levels in 16HBE cells from the control group, house dust mite group, ML133+ house dust mite group, and ML133+ house dust mite+BAPTA-AM group. h shows the relative quantitative results of activated caspase-1 levels in 16HBE cells from the control group, house dust mite group, ML133+ house dust mite group, and ML133+ house dust mite+BAPTA-AM group. i shows the timeline of ML133, house dust mite, and ionomycin administration. j shows the Western blotting results of NLRP3, pro-caspase-1, activated caspase-1, and ACTB in 16HBE cells from the control group, house dust mite group, house dust mite+Ionomycin group, and ML133+ house dust mite+Ionomycin group. k shows the relative quantitative results of NLRP3 levels in 16HBE cells from the control group, house dust mite group, house dust mite+Ionomycin group, and ML133+ house dust mite+Ionomycin group. l shows the relative quantitative results of pro-caspase-1 levels in 16HBE cells from the control group, house dust mite group, house dust mite + Ionomycin group, and ML133 + house dust mite + Ionomyci group. m shows the relative quantitative results of activated caspase-1 levels in 16HBE cells from the control group, house dust mite group, house dust mite + Ionomycin group, and ML133 + house dust mite + Ionomyci group. Data are expressed as mean ± standard deviation. Unpaired Student's test (a). One-way ANOVA (dh).

[0111] Figure 9 Inhibition of KCNJ2 showed that it increased intracellular K+ in bronchial epithelial cells induced by house dust mite exposure. +Levels and reductions in NLRP3 inflammasome activation. a shows the timeline of ML133, house dust mite, and Nigericin administration. b shows IPG-4 AM imaging of 16HBE cells in the control group, house dust mite group, ML133+ house dust mite group, house dust mite+ Nigericin group, and ML133+ house dust mite+ Nigericin group. c shows the quantification of mean IPG-4 AM fluorescence intensity in 16HBE cells in the control group, house dust mite group, ML133+ house dust mite group, house dust mite+ Nigericin group, and ML133+ house dust mite+ Nigericin group. d shows the Western blotting results of NLRP3, pro-caspase-1, activated caspase-1, and ACTB in 16HBE cells in the control group, house dust mite group, ML133+ house dust mite group, house dust mite+ Nigericin group, and ML133+ house dust mite+ Nigericin group. e shows the relative quantitative results of NLRP3 levels in 16HBE cells from the control group, house dust mite group, ML133+ house dust mite group, house dust mite+Nigericin group, and ML133+ house dust mite+Nigericin group. f shows the relative quantitative results of pro-caspase-1 levels in 16HBE cells from the control group, house dust mite group, ML133+ house dust mite group, house dust mite+Nigericin group, and ML133+ house dust mite+Nigericin group. g shows the relative quantitative results of activated caspase-1 levels in 16HBE cells from the control group, house dust mite group, ML133+ house dust mite group, house dust mite+Nigericin group, and ML133+ house dust mite+Nigericin group.

[0112] Figure 10The NLRP3 inflammasome activity is shown to be downstream of KCNJ2, regulating goblet cell differentiation and mucus production in bronchial epithelial cells of asthma patients. a shows the timeline of ML133, BMS-986299, and MCC950 administration. b shows the immunohistochemical results of MUC5AC (green) and DAPI (blue) staining in pHBE cells from the control group (n=4), ML133 group (n=4), BMS-986299 group (n=4), ML133+BMS-986299 group (n=4), MCC950 group (n=4), and ML133+MCC950 group (n=4). c shows the percentage of MUC5AC+ goblet cells in pHBE cells from the control group (n = 4), ML133 group (n = 4), BMS-986299 group (n = 4), ML133+BMS-986299 group (n = 4), MCC950 group (n = 4), and ML133+MCC950 group (n = 4). d shows the RT-qPCR analysis results of MUC5AC in pHBE cells from the control group (n = 4), ML133 group (n = 4), BMS-986299 group (n = 4), ML133+BMS-986299 group (n = 4), MCC950 group (n = 4), and ML133+MCC950 group (n = 4). e shows the RT-qPCR analysis results of SPDEF in pHBE cells from the control group (n = 4), ML133 group (n = 4), BMS-986299 group (n = 4), ML133+BMS-986299 group (n = 4), MCC950 group (n = 4), and ML133+MCC950 group (n = 4). f shows the Western blotting results of SPDEF, NLRP3, pro-caspase-1, activated caspase-1, and ACTB in pHBE cells from the control group (n = 4) and ML133 group (n = 4). g shows the relative quantitative results of SPDEF in pHBE cells from the control group (n = 4) and ML133 group (n = 4). h shows the relative quantitative results of NLRP3 in pHBE cells from the control group (n = 4) and ML133 group (n = 4). i shows the relative quantitative results of pro-caspase-1 levels in pHBE cells from the control group (n = 4) and the ML133 group (n = 4). j shows the relative quantitative results of activated caspase-1 levels in pHBE cells from the control group (n = 4) and the ML133 group (n = 4). k shows the Il-33 gene levels in pHBE cells from the control group (n = 4) and the ML133 group (n = 4) as detected by RT-qPCR.l shows the Tslp gene level in pHBE cells from the control group (n = 4) and the ML133 group (n = 4) as detected by RT-qPCR. m shows the Ccl2 gene level in pHBE cells from the control group (n = 4) and the ML133 group (n = 4) as detected by RT-qPCR. Data are expressed as mean ± standard deviation and were analyzed using one-way ANOVA (ce) and unpaired Student's t-test (g, in).

[0113] Figure 11 The NLRP3 inflammasome activation showed that KCNJ2 inhibition-regulated IL-13-induced goblet cell proliferation and mucus production were inhibited. a shows the timeline of ML133, BMS-986299, and IL-13 administration. b shows the immunohistochemical results of MUC5AC (green) and DAPI (blue) in pHBE cells from the control group (n = 6), IL-13 group (n = 6), IL-13+ML133 group (n = 6), and IL-13+ML133+BMS-986299 group (n = 6). c shows the percentage of MUC5AC+ goblet cells in pHBE cells from the control group (n = 6), IL-13 group (n = 6), IL-13+ML133 group (n = 6), and IL-13+ML133+BMS-986299 group (n = 6). Table d shows the RT-qPCR analysis results of MUC5AC in pHBE cells from the control group (n = 6), IL-13 group (n = 6), IL-13+ML133 group (n = 6), and IL-13+ML133+BMS-986299 group (n = 6). Table e shows the RT-qPCR analysis results of SPDEF in pHBE cells from the control group (n = 6), IL-13 group (n = 6), IL-13+ML133 group (n = 6), and IL-13+ML133+BMS-986299 group (n = 6). Data are expressed as mean ± standard deviation (one-way ANOVA, ce).

[0114] Figure 12 The results of KCNJ2 expression analysis in lung tissues of wild-type and Kcnj2CKO mice are shown. a) RT-qPCR analysis of KCNJ2 in lung tissues of wild-type (n=6) and Kcnj2CKO (n=6) mice. b) Representative immunohistochemical images of KCNJ2 in lung tissues of wild-type (n=6) and Kcnj2-CKO (n=6) mice. c) Quantitative analysis of mean optical density values ​​of KCNJ2 in lung tissues of wild-type (n=6) and Kcnj2-CKO (n=6) mice. Data are expressed as mean ± standard deviation. Unpaired Student's t-test was used.

[0115] Figure 13 This section shows the expression of KCNJ2 in house dust mite-induced asthma mice. a) Representative fluorescence images of GFP expression in lung tissues of mice in the saline-AAV6-empty vector group (n = 6), saline-AAV6-Kcnj2 group (n = 6), house dust mite-AAV6-empty vector group (n = 6), and house dust mite-AAV6-Kcnj2 group (n = 6). b) RT-qPCR analysis results of Kcnj2 in lung tissues of mice in the saline-AAV6-empty vector group (n = 6), saline-AAV6-Kcnj2 group (n = 6), house dust mite-AAV6-empty vector group (n = 6), and house dust mite-AAV6-Kcnj2 group (n = 6). Data are expressed as mean ± standard deviation and analyzed using one-way ANOVA. Detailed Implementation

[0116] The present invention will be further described in detail below through specific embodiments.

[0117] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0118] Unless otherwise specified, experimental methods in the following examples are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in these examples are commercially available. For reagents whose manufacturers are listed, similar products from other manufacturers are substituted.

[0119] The following are examples: In animal models, the effects of inhibiting KCNJ2 on airway hyperresponsiveness, inflammatory cell infiltration, airway wall thickness, serum IgE / IgG1 protein levels, Th2 cytokine (IL-4, IL-5, IL-13) production, alarming factor (IL-33, TSLP, CCL2) expression, goblet cell metaplasia, and excessive mucus secretion were verified by knocking out the Kcnj2 gene specifically from lung epithelial cells (using Nkx2.1-Cre-driven conditional knockout mice), or by administering KCNJ2 selective small molecule inhibitors (such as ML133) intranasally / tracheally, or by adeno-associated virus (AAV6)-mediated Kcnj2 overexpression.

[0120] At the cellular level, by applying a KCNJ2 inhibitor (such as ML133) to human bronchial epithelial cells (16HBE or primary pHBE cells), combined with Ca... 2+ Chelating agent (BAPTA-AM), Ca 2+ Inducing agent (Ionomycin), K +Efflux inducer (Nigericin) and NLRP3 inhibitor / agonist (MCC950 / BMS-986299) were used to investigate how KCNJ2 simultaneously regulates Ca2+. 2+ Inflow and K + The mechanism by which efflux inhibits NLRP3 inflammasome activation was investigated. Specifically, by setting up single and combined treatment groups for KCNJ2 inhibitor (ML133) and NLRP3 inhibitor (MCC950), it was confirmed that both inhibitors, used alone, effectively inhibited SPDEF expression and MUC5AC production, with the combined use showing a significantly enhanced effect.

[0121] In human air-fluid interface (ALI) culture and airway organoid models, primary bronchial epithelial cells derived from asthma patients were used to verify the ameliorative effect of KCNJ2 inhibition on goblet cell differentiation, mucus production, and alarmist expression, and to confirm that this effect depends on the NLRP3 pathway.

[0122] This invention: This study reveals for the first time the role of KCNJ2 in promoting inflammation and remodeling in airway epithelial cells during asthma: it confirms that decreased KCNJ2 expression in airway epithelium of asthma patients is associated with goblet cell metaplasia and excessive production of MUC5AC; KCNJ2 inhibition or knockout can significantly alleviate airway inflammation, Th2 response and remodeling phenotype in animal and human cell models, while overexpression aggravates symptoms.

[0123] A novel pathway for KCNJ2 to regulate NLRP3 activation via a dual ion flux mechanism is elucidated: KCNJ2 simultaneously promotes Ca... 2+ Inflow and K + Outflow leads to activation of the NLRP3 inflammasome; inhibiting KCNJ2 can block this process, thereby inhibiting NLRP3 expression and caspase-1 / IL-1β maturation.

[0124] Establishing the key role of the KCNJ2-NLRP3-SPDEF-MUC5AC axis in goblet cell differentiation: KCNJ2 inhibition specifically reduces MUC5AC production and goblet cell metaplasia by downregulating NLRP3-dependent SPDEF expression, while having no effect on MUC5B, providing a precise intervention point for excessive mucus secretion.

[0125] Inhibiting the release of alarming substances from the airway epithelium and blocking the initiation of Th2 inflammation: KCNJ2 inhibition reduces the expression of IL-33, TSLP and CCL2, blocking the early stage of the Th2 immune response from upstream.

[0126] Validation results in human models of asthma patients: In primary bronchial epithelial cell ALI culture and organoid models, KCNJ2 inhibition significantly improved goblet cell differentiation and mucus production, in dependence of the NLRP3 pathway. Both the KCNJ2 inhibitor (ML133) and the downstream NLRP3 inhibitor (MCC950) were effective individually in inhibiting goblet cell metaplasia and mucus secretion, and their combined use produced a significant synergistic effect, providing new experimental evidence and ideas for developing more effective combination therapies for asthma.

[0127] In this invention, although the embodiments mainly use an allergic asthma model, the KCNJ2 inhibitor blocks the Ca2+ of airway epithelial cells. 2+ Inflow and K + The mechanism by which KCNJ2 inhibitors inhibit NLRP3 inflammasome activation, thereby downregulating SPDEF expression, reducing MUC5AC production, and decreasing alarm hormone (IL-33, TSLP, CCL2) release, is universally applicable. Furthermore, it is well known to those skilled in the art that NLRP3 inflammasome activation is widely involved in asthma airway inflammatory cell infiltration, airway remodeling, and mucus secretion. Given that the embodiments of this invention have demonstrated that KCNJ2 inhibitors can effectively block NLRP3 activation in airway epithelium and significantly improve Th2 inflammation, goblet cell metaplasia, and excessive mucus secretion, combined with the recognized role of NLRP3 in various asthma subtypes, those skilled in the art can reasonably expect that KCNJ2 inhibitors are also suitable for the prevention and / or treatment of other types of asthma.

[0128] In the following examples, ML133 refers to ML133 hydrochloride (ML133 HCl), which is the hydrochloride form of ML133 (i.e., the commercial, stable form). The hydrochloride form can improve solubility, stability and bioavailability, and is the standard pharmaceutical form, thereby ensuring the accuracy of pharmacological effects and the reproducibility of experiments.

[0129] Example 1: Application of Kcnj2 knockout in an ovalbumin-induced asthma mouse model This embodiment uses 8-week-old adult female wild-type mice weighing 20-22g and lung epithelial cell-specific Kcnj2 knockout mice. Kcnj2 CKO) (of which, Kcnj2 The CKO mouse strain was constructed using the Cre-LoxP system and driven by Nkx2.1-Cre. The loss of KCNJ2 expression levels in its lung tissue was as follows: Figure 12As shown. This strain was constructed by Biocytogen (Beijing) Pharmaceutical Technology Co., Ltd. using the CRISPR-Cas9 system (wherein, the sgRNA sequence targeting Kcnj2 is as follows: 5' Guide #2: TTGCACCAGCTTTTGATAGTAGG, SEQ ID NO:1; 3' Guide #14: GGACCATCAAGCCCTGGTAATGG, SEQ ID NO:2), the relevant project number is EGE-DJH-039-A). The asthma model construction was divided into two phases: sensitization and challenge. In the sensitization phase (days 0 and 7), wild-type ovalbumin group (wild-type ovalbumin) and Kcnj2 knockout ovalbumin group ( Kcnj2 CKO-ovalbumin mice were administered an intraperitoneal injection. Specifically, 100 μL of a 5% ovalbumin solution (ovalbumin, Sigma-Aldrich) dissolved in 0.9% saline was thoroughly mixed with 100 μL of aluminum adjuvant (Invitrogen, catalog number 77161) to prepare a total of 200 μL of sensitizing emulsion, which was then injected intraperitoneally into each mouse. During the challenge phase (days 14 to 28), mice were challenged daily using an ultrasonic nebulizer with a 5% ovalbumin solution for 30 minutes each time. The nebulization rate was strictly controlled at 0.4 mL / min, with a total volume of 12 mL per challenge. The control groups (wild-type - saline and Kcnj2 CKO - saline) were treated at the same time points with an equal volume of 0.9% saline instead of the ovalbumin and aluminum adjuvant mixture or the ovalbumin solution. Twenty-four hours after the last challenge (day 29), invasive airway hyperresponsiveness (AHR) was first assessed. Subsequently, on day 30, mice were anesthetized, and bronchoalveolar lavage fluid (BALF) was collected. Serum was separated for IgE / IgG1 level detection. The left lobe of lung tissue was fixed in 4% paraformaldehyde and subjected to HE staining, PAS staining, and MUC5AC immunohistochemical analysis for inflammation scoring, airway wall thickness, and goblet cell count. Simultaneously, total RNA and protein were extracted from the remaining lung tissue, and cytokines (IL-4 / 5 / 13), alarm factors (Il-33 / Tslp / Ccl2), mucin-related genes (Muc5ac / Spdef), and the activation status of the NLRP3 / caspase-1 inflammasome were detected using qPCR and Western blotting. Figure 1 a).

[0130] Experimental results are as follows Figures 1 to 3 As shown. Regarding airway physiological function, compared to the wild-type ovalbumin group, Kcnj2 CKO-ovalbumin group mice showed significantly reduced airway hyperresponsiveness ( Figure 1 (b) suggests that Kcnj2 knockout can effectively improve increased airway resistance caused by asthma. Pathological evaluation of lung tissue showed that Kcnj2 knockout significantly reduced peribronchial inflammatory cell infiltration, lowered inflammation scores, and decreased airway wall thickness. Figure 1 c-1h). Immunological test results confirmed that Kcnj2 Serum IgE and IgG1 levels in the CKO-ovalbumin group were significantly lower than those in the wild-type-ovalbumin group. Figure 1 i-1j), and the expression levels of typical Th2 cytokines (IL-4, IL-5, IL-13) in BALF and epithelial-derived alarm factors (IL-33, Tslp, Ccl2) in lung tissue were significantly downregulated. Figure 1 K-1P). Further detection of airway mucus hypersecretion showed that the number of PAS and MUC5AC-positive goblet cells in the lung tissue of mice in the Kcnj2 CKO-ovalbumin group was significantly reduced. Figure 2 a-2f), while the mRNA expression levels of Muc5ac and its regulator Spdef were significantly decreased ( Figure 2 g-2k). Furthermore, Western blot results indicate that ( Figure 3 Knocking out Kcnj2 significantly inhibited ovalbumin-induced activation of the NLRP3 inflammasome in lung tissue, manifested as a decrease in the levels of proteins such as NLRP3 and cleaved-caspase-1.

[0131] Conclusion: In summary, Kcnj2 The absence of ovalbumin can comprehensively alleviate inflammation and remodeling in ovalbumin-induced asthma.

[0132] Example 2: Application of the KCNJ2 small molecule inhibitor ML133 in a house dust mite-induced asthma mouse model This study used 8-week-old adult female wild-type mice weighing 20-22g to establish an asthma mouse model through intranasal sensitization and challenge with house dust mites, and explored the intervention effect of the KCNJ2 small molecule inhibitor ML133. The experiment was divided into four groups: saline-DMSO group, saline-ML133 group, house dust mite-DMSO group, and house dust mite-ML133 group. House dust mite-DMSO group and house dust mite-ML133 group used a mouse model of house dust mite sensitization and challenge via nasal administration. Simultaneously, DMSO (25 µM) or ML133 (AbMole, catalog number M2181, 25 µM) was administered intranasally as follows: From day 0 to day 3 (four times in total), each mouse was injected with 10 μg of house dust mite (Greer labs, catalog number RMB84M) via nasal administration. This extract was dissolved in physiological saline for allergen stimulation. From day 8 to day 14, each mouse was injected with 10 μg of house dust mite via nasal administration once daily (seven times in total). From day 0 to day 12, each mouse was injected intranasally with 40 μL of 25 μM DMSO or ML133 every three days (five times in total). The total volume of nasal solution received by the mice at each administration was 40 μL. The treatment methods for the saline-DMSO group and the saline-ML133 group were the same as those for the house dust mite-DMSO group and the house dust mite-ML133 group, respectively, except that the house dust mites were replaced with an equal volume of 0.9% saline. Twenty-four hours after the last challenge (day 15), invasive airway hyperresponsiveness (AHR) was first tested. Subsequently, on day 16, mice were anesthetized, bronchoalveolar lavage fluid (BALF) was collected, and serum was separated for IgE / IgG1 level detection. The left lobe of lung tissue was fixed with 4% paraformaldehyde and then subjected to HE staining, PAS staining, and MUC5AC immunohistochemical analysis to evaluate inflammation score, airway wall thickness, and goblet cell count. Simultaneously, total RNA and protein were extracted from the remaining lung tissue, and the expression levels of cytokines (IL-4 / 5 / 13), alarm factors (Il-33 / Tslp / Ccl2), and mucin-related genes (Muc5ac / Spdef) were detected by qPCR and Western blotting techniques. Figure 4 a).

[0133] Experimental results are as follows Figures 4 to 5 As shown. Regarding airway function and pathology, compared to the house dust mite-DMSO group, the house dust mite-ML133 group showed decreased airway hyperresponsiveness (…). Figure 4 b) Decreased inflammation score and cell infiltration ( Figure 4 c-4d, 4f-4h), airway wall thickness decreased ( Figure 4 e), decreased serum IgE / IgG1 protein levels ( Figure 4 Decreased expression of i-4j), Th2 cytokines, and alarmins (i-4j), Th2 cytokines, and alarmins. Figure 4 The number of K-4M and 4N-4P positive goblet cells is reduced (k-4m and 4n-4p), and the number of PAS-positive goblet cells is decreased. Figure 5 downregulation of a-5c and Muc5ac / Spdef expression ( Figure 5 d-5e).

[0134] Conclusion: The small molecule inhibitor ML133 can effectively control airway inflammation and alleviate airway remodeling in house dust mite-induced asthma by inhibiting KCNJ2 activity.

[0135] Example 3: Application of KCNJ2 overexpression in a house dust mite-induced asthma mouse model This study used 8-week-old adult female wild-type mice weighing 20-22g to investigate the function of the Kcnj2 gene by intratracheal injection of adeno-associated virus (AAV6) to induce Kcnj2 overexpression in the lungs, combined with a house dust mite-induced asthma model. The experiment consisted of four groups: saline-AAV6-empty vector group, saline-AAV6-Kcnj2 group, house dust mite-AAV6-empty vector group, and house dust mite-AAV6-Kcnj2 group. The experimental procedures for the house dust mite-AAV6-empty vector group and the house dust mite-AAV6-Kcnj2 group were as follows: From day 0 to day 3 (four times in total), each mouse was injected intranasally with 10 micrograms of house dust mite extract, dissolved in saline for sensitization. From day 8 to day 14, each mouse was injected intranasally with 10 micrograms of house dust mite extract once daily (seven times in total). On day 5, all mice received intratracheal injections of either an empty AAV6 vector or an AAV6-Kcnj2 overexpressing virus (5 × 10^11 genome copies (GC) per mouse, 50 μL per injection, provided by Guangzhou Paizhen Biotechnology Co., Ltd., with Kcnj2 accession number NM_008425.4). The treatment methods for the saline-AAV6-empty vector (saline-AAV6-Empty / Vector) group and the saline-AAV6-Kcnj2 (saline-AAV6-Kcnj2) group were the same as those for the house dust mite-AAV6-empty vector and house dust mite-AAV6-Kcnj2 groups, except that the house dust mites were replaced with an equal volume of 0.9% saline. On day 16, the expression of KCNJ2 in each group of mice was as follows: Figure 13 As shown. AHR was measured on day 15. On day 16, mice were anesthetized to collect samples for analysis. Figure 6 a). The detection indicators are the same as in Example 1.

[0136] The results are as follows Figure 6-7 As shown: Compared with the house dust mite-AAV6-unloaded group, the house dust mite-AAV6-Kcnj2 group showed enhanced airway hyperresponsiveness. Figure 6b) Increased inflammation score and cell infiltration ( Figure 6 c-6d, 6f-6h), increased airway wall thickness ( Figure 6 e), elevated serum IgE / IgG1 protein levels ( Figure 6 Increased expression of i-6j), Th2 cytokines, and alarmins (i-6j), Th2 cytokines, and alarmins) Figure 6 The number of K-6M and 6N-6P positive goblet cells increased (k-6M and 6N-6P) Figure 7 upregulation of a-7c and Muc5ac / Spdef expression ( Figure 7 d-7e).

[0137] Conclusion: Overexpression of KCNJ2 in the lungs exacerbates the asthma phenotype, confirming that KCNJ2 activity promotes airway inflammation and remodeling.

[0138] Example 4: Application of KCNJ2 inhibitor ML133 in regulating ion flow and NLRP3 activation at the cellular level The ML133+ house dust mite group used house dust mite-stimulated 16HBE cells, which were then treated with ML133: 16HBE cells were cultured in 12-well plates for 24 hours (at hour -24), and then (at hour 0) treated with house dust mite extract (Greer labs, catalog number RMB84M) and ML133 (AbMole, catalog number M2181) at a final concentration of 100 μg / mL for 24 hours. The treatment method for the house dust mite group was the same as that for the ML133+ house dust mite group, except that ML133 at a final concentration of 30 μM was not added. The treatment method for the control group was the same as that for the ML133+ house dust mite group, except that house dust mites were replaced with an equal volume of PBS, and ML133 at a final concentration of 30 μM was not added. The treatment method for the ML133 + house dust mite + BAPTA-AM (calcium ion chelator, Selleck, catalog number S7534) group was the same as that for the ML133 + house dust mite group, the only difference being that BAPTA-AM (calcium ion chelator, Selleck, catalog number S7534) was added at a final concentration of 30 μM along with house dust mites and ML133. Figure 8 b). The treatment method for the house dust mite + Ionomycin (calcium ion carrier, MedChemExpress, catalog number HY-13434) group was the same as that for the ML133 + house dust mite group, except that: ML133 was not added to a final concentration of 30 μM, and Ionomycin to a final concentration of 10 μM was added for 4 hours at the 20th hour. The treatment method for the ML133 + house dust mite + Ionomycin group was the same as that for the ML133 + house dust mite group, except that: Ionomycin to a final concentration of 10 μM was added for 4 hours at the 20th hour. Figure 8 i). House dust mites + Nigericin (inducing K) +The treatment method for the Sigma-Aldrich (product number N7143-5) group was the same as that for the ML133 + house dust mite group, except that ML133 was not added to a final concentration of 30 μM, and Nigericin was added to a final concentration of 10 μM for 1 hour at the 23rd hour. The treatment method for the ML133 + house dust mite + Nigericin group was the same as that for the ML133 + house dust mite group, except that Nigericin was added to a final concentration of 10 μM for 1 hour at the 23rd hour. Figure 9 a). Detecting intracellular Ca at 24 hours. 2+ / K + Levels (Fluo-4AM / IPG-4 AM staining) and NLRP3 / pro-caspase-1 / caspase-1 activation (Western blot).

[0139] The experimental results are shown in Figures 8 and 9. Regarding ion current regulation, fluorescence staining results showed that ML133 significantly reduced intracellular Ca2+ induced by house dust mites. 2+ internal flow ( Figure 8 c-8d), and effectively increased intracellular K+ + Level, that is, inhibiting the outflow of potassium ions ( Figure 9 (b-9c). Regarding inflammasome activation, Western blotting results confirmed (Figs. 8e-8h) that ML133 significantly inhibited house dust mite-induced NLRP3 inflammasome activation. This inhibitory effect was further enhanced upon the addition of the calcium chelator BAPTA-AM. Conversely, the addition of Ionomycin (which increases calcium influx) or Nigericin (which promotes potassium efflux) partially reversed the inhibitory effect of ML133 on NLRP3 activation (Figs. 8j-8m, 9d-9g).

[0140] Conclusion: The KCNJ2 inhibitor ML133 regulates intracellular Ca2+ in epithelial cells. 2+ With K + It can restore ion balance, thereby inhibiting the signal transduction of the NLRP3 inflammasome and achieving an anti-inflammatory effect.

[0141] Example 5: Application of the KCNJ2 inhibitor ML133 in a human bronchial epithelial cell model from asthma patients A gas-liquid interface (ALI) culture and organoid model were established using primary pHBE cells from asthma patients (4 cases). pHBE cells were first expanded in expansion medium (STEMCELL, #05008) at 37 °C in a 5% CO2 incubator. Then, 300,000 pHBE cells were seeded (-1) onto membrane supports in 12-well Transwell chambers (Corming, #3460). Each chamber received 1 mL of expansion medium in the basal chamber and 0.5 mL in the upper chamber, respectively, and were cultured at 37 °C in a 5% CO2 incubator. Once the pHBE cells were fully adhered (24 hours later, i.e., day 0), the culture medium was carefully aspirated from both chambers. The basal chamber was treated with PneumaCult... TM -ALI medium (STEMCELL #05001) was supplemented to initiate cell differentiation (day 0). ALI cultures were maintained under air-liquid interface conditions, with the medium in the basal chamber changed every two days. From the second week onwards, D-PBS (calcium-free) was used. 2+ and Mg 2+ Cells were washed to remove excess mucus from the surface of the upper chamber. During ALI culture, ML133 (ML133 group, final concentration 30 μM, AbMole, catalog number M2181) was administered on day 0. On day 2, ML133 was administered alone (i.e., DMSO (final concentration 30 μM) was administered on day 0 and NLRP3 inhibitor MCC950 (Selleck, catalog number S8930) or agonist BMS-986299 (Selleck, catalog number S9899) (MCC950 / BMS-986299 group, final concentration 10 μM) was administered on day 2, or in combination with NLRP3 inhibitor MCC950 (10 μM) or in combination with agonist BMS-986299 (10 μM) was administered continuously (i.e., ML133 (final concentration 30 μM) was administered on day 0 and NLRP3 inhibitor MCC950 or agonist BMS-986299 (final concentration 10 μM) was administered on day 2). μM), ML133+MCC950 / BMS-986299 group. Figure 10 a) The control group received DMSO (final concentration 30 μM) on day 0 and DMSO (final concentration 10 μM) on day 2. Administration of DMSO / ML133 / NLRP3 inhibitor MCC950 / agonist BMS-986299 was achieved by adding to PneumaCult™-ALI medium. Samples were collected for analysis up to day 21. The proportion of MUC5AC-positive goblet cells, MUC5AC / SPDEF expression, NLRP3 activation, and alarmist levels were measured.

[0142] The results are as follows Figure 10As shown: Treatment with ML133 alone or MCC950 alone can effectively reduce MUC5AC-positive goblet cells ( Figure 10 b-10c), reduced MUC5AC / SPDEF expression and alarmist levels ( Figure 10 d-10e and 10f-10g, 10k-10m), inhibiting NLRP3 activation ( Figure 10 h-10j). After combined treatment with ML133 and MCC950, the improvement in all the above indicators was significantly greater than that of either drug alone. Figure 10 b-10e) showed a synergistic enhancing effect. BMS-986299 partially reversed this effect ( Figure 10 b-10e).

[0143] Primary pHBE cells from healthy individuals were cultured at the air-liquid interface (ALI) and an organoid model was established (6 cases). pHBE cells were first expanded in expansion medium (STEMCELL, #05008) at 37 °C in a 5% CO2 incubator. Then, 300,000 pHBE cells were seeded (-1) onto membrane supports in 12-well Transwell chambers (Corming, #3460). Each chamber received 1 mL of expansion medium in the basal chamber and 0.5 mL in the upper chamber, respectively, and were cultured at 37 °C in a 5% CO2 incubator. Once the pHBE cells were fully adhered (24 hours later, i.e., day 0), the medium was carefully aspirated from both chambers. The basal chamber was replenished with PneumaCult™-ALI medium (STEMCELL #05001) to initiate cell differentiation (day 0). ALI culture was maintained under air-liquid interface conditions, with the medium in the basal chamber changed every two days. From the second week onwards, D-PBS (calcium-free) was used. 2+ and Mg 2+ Cells were washed to remove excess mucus from the surface of the upper chamber. During ALI culture, ML133 (final concentration 30 μM, AbMole, catalog number M2181) was administered on day 0 and IL-13 (final concentration 10 ng / mL) on day 14 (IL-13+ML133 group). On day 2, the NLRP3 agonist BMS-986299 (10 μM) was administered continuously (i.e., ML133 (final concentration 30 μM) was administered on day 0, IL-13 (final concentration 10 ng / mL) on day 14, and NLRP3 agonist BMS-986299 (final concentration 10 μM) on day 2, IL-13+ML133+BMS-986299 group). Figure 11a). The IL-13 group received DMSO (final concentration 30 μM) on day 0, IL-13 (final concentration 10 ng / mL) on day 14, and DMSO (final concentration 10 μM) on day 2. The control group received DMSO (final concentration 30 μM) on day 0, DMSO (final concentration 10 ng / mL) on day 14, and DMSO (final concentration 10 μM) on day 2. DMSO / ML133 / IL-13 / agonist BMS-986299 was administered by adding it to PneumaCult™-ALI medium. Samples were collected on day 21 for analysis. The proportion of MUC5AC-positive goblet cells and MUC5AC / SPDEF expression were measured. Results are as follows: Figure 11 As shown, with Figure 10 The results were similar.

[0144] Conclusion: The KCNJ2 inhibitor ML133 reduces goblet cell differentiation and mucus production in patient-derived epithelial cells in an NLRP3-dependent manner. Both the KCNJ2 inhibitor (ML133) and the NLRP3 inhibitor (MCC950) are effective individually in an asthma airway epithelial model, and their combined use is even more effective.

[0145] The above embodiments demonstrate that the present technical solution can effectively intervene in asthma in various models, with stable effects and a clear mechanism.

[0146] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

1. Application of KCNJ2 inhibitors in any of a1)-a8): a1) Prepare medicines for the prevention and / or treatment of asthma; a2) In vitro inhibition of NLRP3 activation in airway epithelial cells; a3) In vitro reduction of intracellular calcium in airway epithelial cells 2+ Levels and / or increases in intracellular K+ in airway epithelial cells + level; a4) Reduce the level of MUC5AC-positive goblet cells in airway organoids; a5) Reduce the expression levels of MUC5AC and / or SPDEF in airway organoids; a6) Reduce alarm hormone expression levels in airway organoids; a7) Inhibits NLRP3 activation in airway organoids; a8) Prepare a product, said product being used in at least one of a2)-a7).

2. The application according to claim 1, characterized in that, The KCNJ2 inhibitor includes at least one of the following: a substance that inhibits KCNJ2 activity, a substance that degrades KCNJ2, and a substance that reduces KCNJ2 expression levels; further includes at least one of the following: a substance that inhibits KCNJ2 activity and a substance that reduces KCNJ2 expression levels; and even further includes a substance that inhibits KCNJ2 activity. Preferably, the substance that reduces KCNJ2 expression level includes at least one of (a1)-(a3): (a1) siRNA, esiRNA, dsRNA, microRNA, antisense oligonucleotide, ribozyme, sgRNA or shRNA targeting KCNJ2; (a2) Nucleic acid molecules that express (a1); (a3) An expression cassette, vector, cell, or microorganism that includes (a2); Preferably, the substance that reduces KCNJ2 expression levels includes sgRNA that targets KCNJ2; Preferably, the sgRNA targeting KCNJ2 includes sgRNA1 and / or sgRNA2, wherein sgRNA1 includes the nucleotide sequence shown in SEQ ID NO:1 and sgRNA2 includes the nucleotide sequence shown in SEQ ID NO:2; Preferably, the substance inhibiting KCNJ2 activity includes at least one of (b1)-(b3): (b1) Antibodies that specifically bind to KCNJ2; (b2) A ligand protein or polypeptide that specifically binds to KCNJ2; (b3) Non-protein compounds that specifically bind to KCNJ2; Preferably, the antibody comprises at least one of polyclonal antibody, monoclonal antibody, single-chain antibody, functional antibody fragment, antibody Fab region, nanobody, chimeric antibody, and multispecific antibody; Preferably, the substance that inhibits KCNJ2 activity includes ML133 or a pharmaceutically acceptable salt thereof.

3. The application according to any one of claims 1-2, characterized in that, The drug also includes other active ingredients; Preferably, the product further includes other active ingredients; Preferably, the other active ingredients include Ca. 2+ At least one of a chelating agent and an NLRP3 inhibitor; further comprising Ca 2+ Chelating agents or NLRP3 inhibitors; further including NLRP3 inhibitors; Preferably, the Ca 2+ Chelating agents include BAPTA-AM or its pharmaceutically acceptable salts; Preferably, the NLRP3 inhibitor comprises at least one of a substance that inhibits NLRP3 activity, a substance that degrades NLRP3, and a substance that reduces NLRP3 expression levels; further comprises at least one of a substance that inhibits NLRP3 activity and a substance that reduces NLRP3 expression levels; and even further comprises a substance that inhibits NLRP3 activity. Preferably, the substance that reduces NLRP3 expression levels includes at least one of (c1)-(c3): (c1) siRNA, esiRNA, dsRNA, microRNA, antisense oligonucleotide, ribozyme, sgRNA or shRNA targeting NLRP3; (c2) expresses the nucleic acid molecule of (c1); (c3) Contains an expression cassette, vector, cell, or microorganism of (c2); Preferably, the substance inhibiting NLRP3 activity includes at least one of (d1)-(d3): (d1) Antibody that specifically binds to NLRP3; (d2) A ligand protein or polypeptide that specifically binds to NLRP3; (d3) Non-protein compounds that specifically bind to NLRP3; Preferably, the antibody comprises at least one of polyclonal antibody, monoclonal antibody, single-chain antibody, functional antibody fragment, antibody Fab region, nanobody, chimeric antibody, and multispecific antibody; Preferably, the substance that inhibits NLRP3 activity includes MCC950 or a pharmaceutically acceptable salt thereof; Preferably, the molar ratio of the KCNJ2 inhibitor to other active ingredients in the drug or product is (0.5-4):

1.

4. The application according to any one of claims 1-3, characterized in that, The drug also includes pharmaceutically acceptable excipients; Preferably, the pharmaceutically acceptable excipients include at least one of diluents, excipients, binders, humectants, surfactants, lubricants, and disintegrants; Preferably, the dosage form of the drug is a dosage form suitable for children or an adult; Preferably, the dosage form is selected from gastrointestinal or non-gastrointestinal dosage forms.

5. A composition comprising: KCNJ2 inhibitors; and Other active ingredients, including Ca 2+ At least one of a chelating agent and an NLRP3 inhibitor; further comprising Ca 2+ Chelating agents or NLRP3 inhibitors; further including NLRP3 inhibitors.

6. The composition according to claim 5, characterized in that, The KCNJ2 inhibitor includes at least one of the following: a substance that inhibits KCNJ2 activity, a substance that degrades KCNJ2, and a substance that reduces KCNJ2 expression levels; further includes at least one of the following: a substance that inhibits KCNJ2 activity and a substance that reduces KCNJ2 expression levels; and even further includes a substance that inhibits KCNJ2 activity. Preferably, the substance that reduces KCNJ2 expression level includes at least one of (a1)-(a3): (a1) siRNA, esiRNA, dsRNA, microRNA, antisense oligonucleotide, ribozyme, sgRNA or shRNA targeting KCNJ2; (a2) Nucleic acid molecules that express (a1); (a3) An expression cassette, vector, cell, or microorganism that includes (a2); Preferably, the substance that reduces KCNJ2 expression levels includes sgRNA that targets KCNJ2; Preferably, the sgRNA targeting KCNJ2 includes sgRNA1 and / or sgRNA2, wherein sgRNA1 includes the nucleotide sequence shown in SEQ ID NO:1 and sgRNA2 includes the nucleotide sequence shown in SEQ ID NO:2; Preferably, the substance inhibiting KCNJ2 activity includes at least one of (b1)-(b3): (b1) Antibodies that specifically bind to KCNJ2; (b2) A ligand protein or polypeptide that specifically binds to KCNJ2; (b3) Non-protein compounds that specifically bind to KCNJ2; Preferably, the antibody comprises at least one of polyclonal antibody, monoclonal antibody, single-chain antibody, functional antibody fragment, antibody Fab region, nanobody, chimeric antibody, and multispecific antibody; Preferably, the substance that inhibits KCNJ2 activity includes ML133 or a pharmaceutically acceptable salt thereof; Preferably, the molar ratio of the KCNJ2 inhibitor to other active ingredients is (0.5-4):

1.

7. The composition according to any one of claims 5-6, characterized in that, The Ca 2+ Chelating agents include BAPTA-AM or its pharmaceutically acceptable salts; Preferably, the NLRP3 inhibitor comprises at least one of a substance that inhibits NLRP3 activity, a substance that degrades NLRP3, and a substance that reduces NLRP3 expression levels; further comprises at least one of a substance that inhibits NLRP3 activity and a substance that reduces NLRP3 expression levels; and even further comprises a substance that inhibits NLRP3 activity. Preferably, the substance that reduces NLRP3 expression levels includes at least one of (c1)-(c3): (c1) siRNA, esiRNA, dsRNA, microRNA, antisense oligonucleotide, ribozyme, sgRNA or shRNA targeting NLRP3; (c2) expresses the nucleic acid molecule of (c1); (c3) Contains an expression cassette, vector, cell, or microorganism of (c2); Preferably, the substance inhibiting NLRP3 activity includes at least one of (d1)-(d3): (d1) Antibody that specifically binds to NLRP3; (d2) A ligand protein or polypeptide that specifically binds to NLRP3; (d3) Non-protein compounds that specifically bind to NLRP3; Preferably, the antibody comprises at least one of polyclonal antibody, monoclonal antibody, single-chain antibody, functional antibody fragment, antibody Fab region, nanobody, chimeric antibody, and multispecific antibody; Preferably, the substance that inhibits NLRP3 activity includes MCC950 or a pharmaceutically acceptable salt thereof.

8. A product comprising the composition according to any one of claims 5-7.

9. The product according to claim 8, characterized in that, The product is a drug or reagent; Preferably, the product is a drug, and the drug further includes pharmaceutically acceptable excipients; Preferably, the pharmaceutically acceptable excipients include at least one of diluents, excipients, binders, humectants, surfactants, lubricants, and disintegrants; Preferably, the dosage form of the drug is a dosage form suitable for children or an adult; Preferably, the dosage form is selected from gastrointestinal or non-gastrointestinal dosage forms.

10. A method for aggravating the asthma phenotype in an animal model of asthma, comprising the following steps: The expression level, content, or activity of KCNJ2 in the animals was increased before, after, or during the construction of an asthma animal model.

11. The use of the animal model obtained by the method of claim 10 in screening drugs or preparing products of screening drugs for the prevention and / or treatment of asthma.